Traditional Chinese medicine compound essential oil and application thereof in preparation of product for preventing and treating hyperlipidemia
The compound essential oil composed of Morinda officinalis, Coptis chinensis and Aucklandia lappa has solved the problem of the single mechanism of action of traditional Chinese medicine essential oils. It has achieved significant reduction in body weight and blood lipid levels in hyperlipidemic mice, regulated lipid metabolism, and improved hyperlipidemic symptoms, showing broad application potential.
Patent Information
- Application Number
- CN202511396819.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-28
- Publication Date
- 2026-03-27
- Estimated Expiration
- 2045-09-28
AI Technical Summary
Existing single-herb essential oils in the treatment of hyperlipidemia have a single mechanism and lack comprehensive effects. Furthermore, drug treatment may produce drug interactions and toxic side effects. There is a need to develop a new compound essential oil formula of traditional Chinese medicine that can effectively regulate lipid metabolism in a targeted and comprehensive manner.
This invention provides a compound essential oil of traditional Chinese medicine composed of Morinda officinalis, Coptis chinensis and Aucklandia lappa essential oils. The oil is extracted by supercritical carbon dioxide extraction, and the purity of the essential oil is maintained at over 99%. It is used to prepare external dosage forms for aromatherapy, with the addition of medically acceptable excipients, for the prevention and treatment of hyperlipidemia.
It significantly reduced body weight and serum and liver levels of triglycerides, cholesterol, and LDL in hyperlipidemic mouse models, increased HDL levels, improved hyperlipidemic symptoms, regulated lipid metabolism, inhibited hepatic steatosis, and achieved therapeutic effects on hyperlipidemic mice by upregulating genes related to lipid oxidation and decomposition.
Smart Images

Figure CN121287803B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of Chinese herbal medicine essential oil, and particularly relates to a traditional Chinese medicine compound essential oil and application thereof in preparation of a product for preventing and treating hyperlipidemia. BACKGROUND
[0002] Hyperlipidemia is characterized by elevated cholesterol, free fatty acids, low-density lipoprotein cholesterol (LDL) and decreased high-density lipoprotein cholesterol (HDL). Hyperlipidemia is closely related to various health problems, including the combined effects of diabetes, obesity and hypertension, i.e. metabolic syndrome, which seriously endangers human health. Especially with overweight and obesity, excessive accumulation of triglycerides (TG) in the patient's serum, mild or severe inflammation of the liver, increases the risk of suffering from coronary artery disease, hypertension, respiratory disease and obstructive sleep apnea, and also brings huge economic burden to the society. Based on the cross-sectional study of 1580 million adult physical examination data in 2019, the prevalence rates of overweight and obesity in China are 34.8% and 14.1% respectively, and the overall trend of overweight / obesity in China is that men are higher than women and the north is higher than the south. It is estimated that in 2030, 63.5% of adults in China will reach overweight / obesity. Therefore, it is urgent to control the hyperlipidemia of obesity or metabolic syndrome patients.
[0003] At present, the treatment scheme for hyperlipidemia in the relevant guidelines at home and abroad is to first choose lifestyle intervention, and then to improve it through diet and exercise, and then to treat hyperlipemia with drugs, so as to produce drug interactions and even toxic side effects, and affect the final treatment outcome.
[0004] Chinese herbal medicine essential oil is a volatile oily liquid extracted from Chinese herbal medicine, which can be extracted from the roots, stems, flowers, leaves, seeds and fruits of Chinese herbal medicine. The chemical components of essential oil extracted from different parts of the same medicinal material are different, and the functional efficacy also changes. In modern society, the quality of life has improved significantly, and people hope that the products can be safer, more environmentally friendly and greener while meeting all their needs. Chinese herbal medicine essential oil is directly derived from nature and has complex components, mainly including terpenoids, aromatic compounds, aliphatic compounds and nitrogen and sulfur-containing compounds. Compared with human-synthesized chemical products, it has the characteristics of small toxicity and high safety, and has good biological activity in antitumor, antiviral, tranquilizing, antioxidant, lipid metabolism regulation and immune regulation, and has broad application prospects in the future.
[0005] At present, many single traditional Chinese medicine essential oils are confirmed to have the effect of resisting high blood lipids. For example, magnolia officinalis essential oil, angelica essential oil, salvia miltiorrhiza essential oil and the like. However, there is evidence that these single essential oils have single mechanism and the like. Traditional Chinese medicine compound has the advantages of reasonable matching, complementary advantages and comprehensive effect. Therefore, it is necessary to continuously carry out matching and optimization research of traditional Chinese medicine compound, seek a new compound which has strong pertinence and can regulate lipid metabolism for hyperlipidemia, and it is also necessary to develop the application. SUMMARY
[0006] (I) Technical problems solved
[0007] In view of the deficiencies in the prior art, the present application provides a traditional Chinese medicine compound essential oil and an application thereof in preparation of a product for preventing and / or improving and / or treating hyperlipidemia.
[0008] (II) Technical solutions
[0009] To achieve the above object, the present application is implemented by the following technical solutions:
[0010] In a first aspect, the present application provides a traditional Chinese medicine compound essential oil, which is composed of the following volume fractions of traditional Chinese medicine plant essential oils: 0.1-2 parts of radix morindae officinalis essential oil, 0.5-3 parts of coptis chinensis essential oil and 0.5-3 parts of saussurea lappa essential oil.
[0011] Further, the traditional Chinese medicine compound essential oil is composed of the following volume fractions of traditional Chinese medicine plant essential oils: 0.3-1.2 parts of radix morindae officinalis essential oil, 0.8-2 parts of coptis chinensis essential oil and 0.8-2 parts of saussurea lappa essential oil.
[0012] Further, the traditional Chinese medicine compound essential oil is composed of the following volume fractions of traditional Chinese medicine plant essential oils: 0.6 parts of radix morindae officinalis essential oil, 1 part of coptis chinensis essential oil and 1 part of saussurea lappa essential oil.
[0013] Further, the radix morindae officinalis essential oil, the coptis chinensis essential oil and the saussurea lappa essential oil are respectively extracted from Chinese herbal medicine radix morindae officinalis, coptis chinensis and saussurea lappa by using a carbon dioxide supercritical extraction method, and the essential oil purity is maintained at more than 99%.
[0014] Further, the radix morindae officinalis essential oil, the coptis chinensis essential oil and the saussurea lappa essential oil can also be purchased on the market.
[0015] In a second aspect, the present application further provides an application of the above traditional Chinese medicine compound essential oil in preparation of a product for preventing and / or improving and / or treating hyperlipidemia, wherein the product is an aromatic therapy product, and specifically, radix morindae officinalis essential oil, coptis chinensis essential oil and saussurea lappa essential oil are weighed according to the above volume fractions, uniformly mixed, and then medical acceptable excipients are added to prepare an external dosage form for aromatic therapy.
[0016] Further, in the product for preventing and / or improving and / or treating hyperlipidemia, the effective content of the Chinese medicine recurrent essential oil is 20% or more.
[0017] Morinda: It is the dried root of Morinda officinalis How of Rubiaceae, sweet and pungent, slightly warm, and belongs to kidney and liver meridians. It has the effects of tonifying kidney yang, strengthening muscles and bones, and dispelling wind and dampness. It is commonly used for impotence and spermatorrhea, cold uterus and infertility, irregular menstruation, cold pain in the lower abdomen, rheumatism and arthralgia. Morinda contains active substances such as anthraquinones, iridoid glycosides, sugars, lignins, and volatile oils, and has pharmacological effects such as antioxidant, anti-aging, immune regulation, anti-depression, memory enhancement, anti-tumor, and anti-fatigue. Currently, there is no related research report on the volatile oil of Morinda for hyperlipidemia.
[0018] Coptis: It is the dried rhizome of Coptis chinensis Franch., Coptis deltoidea C.Y.Cheng et Hsiao, or Coptis teeta Wall. of Ranunculaceae, bitter and cold, and belongs to heart, spleen, stomach, liver, gallbladder, and large intestine meridians. It has the effects of clearing heat and drying dampness, purging fire and detoxifying, and is used for damp-heat distention, vomiting and acid regurgitation, dysentery, jaundice, high fever and convulsions, heart fire, insomnia, palpitation, blood heat, epistaxis, red eyes, toothache, diabetes, and carbuncle and sore. It is also used for external treatment of eczema, tinea, and ear discharge. Coptis contains alkaloids, flavonoids, lignans, organic acids, and volatile oils, etc. The volatile oil of Coptis mainly includes monoterpenes, sesquiterpenes, and their oxygen derivatives, etc., and has pharmacological effects such as antibacterial and anti-inflammatory, antioxidant, anti-tumor, and improvement of cardiovascular function.
[0019] Costus: It is the dried root of Aucklandia lappa Decne. of Asteraceae. It is pungent and bitter, warm, and belongs to spleen, stomach, large intestine, triple energizer, and gallbladder meridians. It has the effects of regulating qi and relieving pain, and invigorating spleen and digestion, and is used for chest and abdominal distention and pain, diarrhea, food retention, and loss of appetite. The volatile oil of Costus contains terpenoids and aromatic compounds, and has pharmacological effects such as regulation of gastrointestinal function, anti-inflammatory, antioxidant, protection of cardiovascular, anti-tumor, anti-anxiety, and sedation.
[0020] (Three) beneficial effects
[0021] The traditional Chinese medicine compound essential oil composed of Radix Morindae Officinalis essential oil, Rhizoma Coptidis essential oil and Radix Aucklandiae essential oil provided by the application has great application potential in treating or preventing hyperlipidemia, and the specific performance is as follows: the traditional Chinese medicine compound essential oil can significantly reduce the weight increase trend of a hyperlipidemia mouse model, reduce the weight of the mouse, effectively reduce the triglyceride, cholesterol and LDL levels in serum and liver of the hyperlipidemia mouse model, increase the HDL level, significantly improve the hyperlipidemia symptoms of the model mouse, and achieve the purpose of regulating lipid metabolism; meanwhile, the traditional Chinese medicine compound essential oil can inhibit liver steatosis and reduce the diameter of adipocytes; further, the traditional Chinese medicine compound essential oil can treat the hyperlipidemia mouse by up-regulating the related genes ATGL, HSL, PPAR-α and CPT-1 of fat oxidation and decomposition, and inhibiting the liposynthesis genes PPAR-γ, SCD-1, FAS and Cidea. BRIEF DESCRIPTION OF DRAWINGS
[0022] Figure 1 The effects of different formula compound essential oils on the weight (A) of the hyperlipidemia model mouse and the TC (B), TG (C) levels in serum. Note: in (A), *P<0.05, **P<0.01; in (B) and (C), compared with the HFD group, *P<0.05, **P<0.01, compared with the F1 group, # P<0.05.
[0023] Figure 2 The weight change (A) of each group of mice, and the TC (B), TG (C), HDL (D), LDL (G) in serum of different groups of mice and the TC (E), TG (F) content in liver. Note: ns P>0.05, *P<0.05, **P<0.01.
[0024] Figure 3 The HE staining and oil red staining of the liver and fat of each group of mice.
[0025] Figure 4 The detection results of the expression amounts of the liver fat metabolism related genes of each group of mice. Note: ns P>0.05, *P<0.05, **P<0.01. DETAILED DESCRIPTION
[0026] In order to make the purpose, technical scheme and advantages of the embodiments of the application clearer, the technical scheme in the embodiments of the application will be described clearly and completely below in combination with the embodiments of the application. Obviously, the described embodiments are part of the embodiments of the application, rather than all the embodiments of the application. Based on the embodiments in the application, all other embodiments obtained by those skilled in the art without creative labor fall within the protection scope of the application.
[0027] Embodiment 1
[0028] A traditional Chinese medicine compound essential oil, which is composed of the following volume parts of traditional Chinese medicine plant essential oils: 0.6 parts of Radix Morindae Officinalis essential oil, 1 part of Coptis essential oil, and 1 part of Saussurea essential oil.
[0029] The Radix Morindae Officinalis essential oil, the Coptis essential oil, and the Saussurea essential oil are respectively extracted from the traditional Chinese medicine Radix Morindae Officinalis, Coptis, and Saussurea by using the carbon dioxide supercritical extraction method, and the purity of the essential oils is kept above 99%.
[0030] The above traditional Chinese medicine compound essential oil is used for preparing a product for preventing and / or improving and / or treating hyperlipidemia, which is a product for aromatherapy, specifically, the Radix Morindae Officinalis essential oil, the Coptis essential oil, and the Saussurea essential oil are taken according to the above volume parts, uniformly mixed, and then medical acceptable excipients are added to prepare an external dosage form for aromatherapy. In the product, the effective content of the traditional Chinese medicine compound essential oil is above 20%.
[0031] Example 2
[0032] The difference between this example and Example 1 is that the traditional Chinese medicine compound essential oil is composed of the following volume parts of traditional Chinese medicine plant essential oils: 0.1 part of Radix Morindae Officinalis essential oil, 0.5 part of Coptis essential oil, and 0.5 part of Saussurea essential oil.
[0033] Example 3
[0034] The difference between this example and Example 1 is that the traditional Chinese medicine compound essential oil is composed of the following volume parts of traditional Chinese medicine plant essential oils: 2 parts of Radix Morindae Officinalis essential oil, 3 parts of Coptis essential oil, and 3 parts of Saussurea essential oil.
[0035] Example 4
[0036] The difference between this example and Example 1 is that the traditional Chinese medicine compound essential oil is composed of the following volume parts of traditional Chinese medicine plant essential oils: 1.5 parts of Radix Morindae Officinalis essential oil, 2.8 parts of Coptis essential oil, and 2.8 parts of Saussurea essential oil.
[0037] Example 5
[0038] The difference between this example and Example 1 is that the traditional Chinese medicine compound essential oil is composed of the following volume parts of traditional Chinese medicine plant essential oils: 0.3 part of Radix Morindae Officinalis essential oil, 0.8 part of Coptis essential oil, and 0.8 part of Saussurea essential oil.
[0039] Example 6
[0040] The difference between this example and Example 1 is that the traditional Chinese medicine compound essential oil is composed of the following volume parts of traditional Chinese medicine plant essential oils: 1.2 parts of Radix Morindae Officinalis essential oil, 2 parts of Coptis essential oil, and 2 parts of Saussurea essential oil.
[0041] Example 7
[0042] The embodiment is different from the embodiment 1 in that the traditional Chinese medicine compound essential oil is composed of essential oils of traditional Chinese medicine plants in the following volume parts: 0.8 parts of radix morindae officinalis essential oil, 1.2 parts of coptis chinensis essential oil, and 1.5 parts of saussurea lappa essential oil.
[0043] Test example 1
[0044] The traditional Chinese medicine compound essential oil in the application is obtained by reasonably matching different Chinese herbal medicine plants based on the characteristics and pharmacological effects of the plants. The influence of the compound essential oil composed of essential oils of multiple different Chinese herbal medicine plants on a hyperlipidemia mouse model is studied. Since there are too many experimental data, the present application provides a differential formula screening experiment to illustrate the advantages of the traditional Chinese medicine compound.
[0045] 1 Experimental animal
[0046] C57BL / 6J mice of 7 weeks old and a standard strain with a body weight of (20±1) g are raised in a room with suitable temperature and humidity control, and are allowed to freely drink and eat, with a 12-hour light / dark cycle. The mice are fed with standard laboratory feed (product number 1010001, Jiangsu Synergy Pharmaceutical Biotechnology Co., Ltd.), and are raised for one week before the experiment.
[0047] 2 Experimental drug
[0048] Compound essential oil 1: 0.6 parts of radix morindae officinalis essential oil, 1 part of coptis chinensis essential oil, and 1 part of saussurea lappa essential oil
[0049] Compound essential oil 2: 0.3 parts of radix morindae officinalis essential oil, 1 part of coptis chinensis essential oil, and 1 part of saussurea lappa essential oil
[0050] Compound essential oil 3: 1 part of coptis chinensis essential oil and 1 part of saussurea lappa essential oil
[0051] Compound essential oil 4: 0.6 parts of epimedium essential oil, 1 part of coptis chinensis essential oil, and 1 part of saussurea lappa essential oil
[0052] Compound essential oil 5: 0.6 parts of radix morindae officinalis essential oil, 1 part of phellodendron essential oil, and 1 part of citrus essential oil
[0053] The above single essential oils are obtained by supercritical carbon dioxide extraction method using radix morindae officinalis, coptis chinensis, saussurea lappa, epimedium, phellodendron, and citrus as raw materials, and the purity of each single essential oil is above 99%. The single essential oils are mixed according to the above volume parts to obtain compound essential oils 1-5, which are stored in a refrigerator.
[0054] 3 Animal modeling and grouping treatment
[0055] Forty-two C57 / Bl6J mice were randomly assigned to cages, 6 mice per cage, and then randomly divided into 7 groups, namely, control diet group (NC group), high-fat diet group (HFD group), and high-fat diet + compound essential oil 1 group (experimental group 1, F1), high-fat diet + compound essential oil 2 group (experimental group 2, F2), high-fat diet + compound essential oil 3 group (experimental group 3, F3), high-fat diet + compound essential oil 4 group (experimental group 4, F4), and high-fat diet + compound essential oil 5 group (experimental group 5, F5). The essential oil group was given sniffing 10 μL of corresponding compound essential oil per mouse per day, which was applied to the sides of the nose once a day; the HFD group was replaced with normal saline. The HFD group and the essential oil group continued to be fed with high-fat diet (D12492, Research diets) during the experiment, and free drinking water was provided for 8 weeks.
[0056] 4 Observation index
[0057] The body weight gain of mice in each group was recorded during the experiment, and the body weight gain rate of mice in each group was calculated. Blood was collected by eyeball blood collection method, and total cholesterol (TC) and triglyceride (TG) in blood were measured.
[0058] Body weight gain rate = final body weight / initial body weight × 100%
[0059] 5 Statistical method
[0060] The data was processed and statistically analyzed using prism software, and the mean ± standard error (x ± sem) was used. One-Way ANOVA was used for significant analysis between groups. P<0.05 was considered statistically significant, and P<0.01 was considered significantly statistically different.
[0061] 6 Results
[0062] 6.1 Effect on body weight of hyperlipidemia mouse model
[0063] As shown in Figure 1 A, compared with the NC group, the body weight gain rate of the HFD group was significantly increased (P<0.01), indicating that the obesity and hyperlipidemia model was successfully constructed. Compared with the HFD group, the body weight gain rate of the F1-F5 group was significantly lower than that of the HFD group (P<0.01). Among them, the body weight gain rate of the F1 group was significantly lower than that of the F2-F5 group (P<0.05).
[0064] 6.2 Effect on blood lipid index of hyperlipidemia mouse model
[0065] The results of TC and TG in blood of mice in each group at the end of the experiment are shown in Figure 1B, C. Compared with the NC group, the TC and TG contents of the HFD group mice were significantly increased (P<0.01), further confirming the success of the construction of the obesity and hyperlipidemia model. Compared with the HFD group, the TC and TG levels of the F1-F5 group mice were reduced to varying degrees, the TC level of the F1-F3 and F5 groups was significantly lower than that of the HFD group (P<0.05 or P<0.01), the TG level of the F1-F2 and F5 groups was significantly lower than that of the HFD group (P<0.05 or P<0.01), the TG level of the F3 group was slightly lower than that of the HFD group but had no significant difference (P>0.05), and the TC and TG levels of the F4 group were slightly lower than those of the HFD group but had no significant difference (P>0.05); among them, the TC level of the F1 group was significantly lower than that of the F2-F5 group (P<0.05).
[0066] 7CONCLUSION
[0067] The present experiment successfully constructed a hyperlipidemia mouse model, and the effects of essential oils of different formulations on the hyperlipidemia mouse model were explored. First of all, according to the results of the F1-F3 group, the compound essential oil obtained by adding the essential oil of Radix Morindae Officinalis to the essential oils of Coptis chinensis and Radix Aucklandiae has a significant advantage in reducing the body weight of the hyperlipidemia mouse model and reducing the TC and TG levels in the serum of the hyperlipidemia mouse model, and the effect is more significant as the content of the essential oil of Radix Morindae Officinalis increases. Further, according to the results of the F1, F3-F5 groups, the essential oil of Radix Morindae Officinalis, the essential oil of Coptis chinensis and the essential oil of Radix Aucklandiae provided by the present application have a synergistic effect, and after replacing any one of them, the technical effect of reducing the body weight of the hyperlipidemia mouse and improving the blood lipid indicators of the hyperlipidemia mouse cannot be achieved, and each component is indispensable.
[0068] Test Example 2
[0069] The following animal experiment data is provided to further illustrate the application prospect of the traditional Chinese medicine compound essential oil in the prevention and treatment of hyperlipidemia in the present application.
[0070] 1Experimental animals
[0071] 7-week-old, standard strain C57 / Bl6J mice with a body weight of (20±1) g were raised in a room with suitable temperature and humidity control, and were allowed to freely drink and eat, with a 12-hour light / dark cycle. Standard laboratory feed (product number 1010001, Jiangsu Synergy Pharmaceutical Biological Engineering Co., Ltd.) was used for feeding, and the mice were adapted for one week before being raised for experiments.
[0072] 2Compound essential oil
[0073] 0.6 parts of Radix Morindae Officinalis essential oil is added to 1 part of Rhizoma Coptidis essential oil and 1 part of Radix Aucklandiae essential oil, and each single essential oil is mixed uniformly according to the above volume fraction, and refrigerated for standby; the essential oil solution is stored in an essential oil bottle with good sealing performance, and refrigerated for standby. The above single essential oils are respectively obtained by carbon dioxide extraction method with Radix Morindae Officinalis, Rhizoma Coptidis and Radix Aucklandiae as raw materials, and the purity is above 99%.
[0074] 3Animal grouping and treatment
[0075] Twenty C57 / Bl6J mice after one week of adaptive feeding were randomly allocated into cages, 5 mice per cage, and then the mice were randomly divided into 4 groups, namely control diet group (NC group), high-fat diet group (HFD group) and high-fat diet + compound essential oil low-dose group (BHM-L group, low-dose group, 5 μL per mouse), high-fat diet + compound essential oil high-dose group (BHM-H group, high-dose group, 10 μL per mouse). Among them, the essential oil group was given by sniffing every day, which was smeared on both sides of the alae nasi, once a day; the HFD group was replaced with normal saline. The HFD group, the essential oil group and the positive control group continued to be fed with high-fat diet (D12492, Research diets) during the experiment, and the mice were free to drink water for 11 weeks.
[0076] Two days before the end of the experiment, fresh feces of each mouse were collected and immediately frozen at-80°C. After the experiment, the mice were sacrificed by cervical dislocation, and the serum was obtained by centrifugation of blood. The liver and epididymal fat were immediately placed in liquid nitrogen and stored at-80°C for further analysis. After weighing the liver, it was divided into three parts the size of a soybean for subsequent Qpcr verification of the expression of fat metabolism related genes. Part of the fat and liver was used for HE section to observe pathological changes.
[0077] 4Detection index
[0078] 4.1Detection of mouse body weight and liver weight
[0079] During the experiment, the food intake and body weight of mice in each group were observed and recorded. After the experiment, the mice were sacrificed, and the liver weight was measured to calculate the liver index.
[0080] 4.2Detection of serum and liver lipid
[0081] The contents of TC, TG, HDL and LDL in the serum and liver of mice in each group were detected.
[0082] 4.3Pathological examination of mouse liver and fat tissue
[0083] The mouse liver and epididymal tissue were fixed in formalin for 24 h, dehydrated, embedded and stained, and finally imaged under a microscope.
[0084] 4.4Detection of the expression amount of liver fat metabolism related genes of mice
[0085] The liver stored in the ultra-low temperature refrigerator at -80 ℃ was taken out, 20 mg of tissue was weighed, total RNA was extracted, reverse transcription was performed into cDNA by using a reverse transcription kit, and fluorescent quantitative PCR amplification was performed by using the cDNA as a template. GAPDH was used as an internal reference to calculate the mNRA expression of related genes by using 2 -ΔΔCT method.
[0086] The primer sequences are as follows
[0087] Gene Upstream primer Downstream primer Ppara TTTCACAAGTGCCTGTCTGTCG TCTTCAGGTAGGCTTCGTGGAT Cyp7a1 GCTAAGGAGGACTTCACTCTACACC TGGTCTTTGCTTTCCCACTTTC Cpt1a GCCTCTATGTGGTGTCCAAGTATC CACCATAGCCGTCATCAGCAA SCD-1 GTTAGCACCTTCTTGCGATACACT GTGAAGTTGATGTGCCAGCG FAS CTGCCTCTGGTGCTTGCT ACCCGCCTCCTCAGCTTT PPAR-gamma GACCACTCGCATTCCTTTGA CCACAGACTCGGCACTCAAT GAPDH CCTCGTCCCGTAGACAAAATG TGAGGTCAATGAAGGGGTCGT AHDH5 GGTTAAGTCTAGTGCAGCGTTTG GTACTCTGTCACCGTGTCATCTT ATGL CCAACATTATTGAGGTGTCCAAGG AGTGGGATATGATGACGTTCTCTC HSL GGAAGGACAGGACAGCAAGGTA GAGGTAGGGCTCGTGGGATTTA
[0088] Note: AHDH5, autolysis domain 5; ATGL, triacylglycerol lipase; HSL, hormone-sensitive lipase; PPAR-α: peroxisome proliferator-activated receptor alpha; PPAR-γ: peroxisome proliferator-activated receptor gama; CYP7A1: cholesterol 7-alpha hydroxylase; CPT-1: carnitine palmitoyltransferase 1; FAS: fatty acid synthase; SCD-1: stearoyl-CoA desaturase-1; GAPDH: 3-phosphoglycerate dehydrogenase.
[0089] 5. Statistical method
[0090] The data were arranged and statistically analyzed by using the prism software, and the mean ± standard error (x ± sem) was used. One-Way ANOVA was used for significant analysis between groups. P<0.05 indicates that the difference is statistically significant, and P<0.01 indicates that the difference is significantly statistically significant. For quantitative experiments, if not specified, three repeated experiments were set, and the average value was taken.
[0091] 6. Results
[0092] 6.1 Effect of the traditional Chinese medicine compound essential oil in the application on the body weight of the hyperlipidemia model mice
[0093] As shown in Figure 2 A, compared with the NC group, the body weight of the HFD group mice was significantly increased, and the difference was extremely significant (P<0.001); compared with the HFD group, the body weight of the BHM-H and BHM-L group mice was significantly decreased (P<0.05).
[0094] 6.2 Effect of the traditional Chinese medicine compound essential oil in the application on the serum and liver biochemical indexes of the hyperlipidemia model mice
[0095] As shown in Figure 2As shown in B-G, compared with the NC group, the contents of TC and TG in the serum and liver of the HFD group of mice were significantly increased (P<0.01), the content of LDL in the serum was significantly increased (P<0.01), and the content of HDL was significantly decreased (P<0.01), indicating that the high blood lipid model was successful. Compared with the HFD group, the contents of TC and TG in the serum and liver of the BHM-H group of mice were significantly decreased (P<0.01), the content of HDL in the serum was significantly increased (P<0.01), and the content of LDL in the serum was decreased, but there was no significant difference (P>0.05); the contents of TC and TG in the serum and liver of the BHM-L group of mice were significantly decreased (P<0.05), the content of HDL in the serum was increased, and the content of LDL in the serum was decreased, but there was no significant difference (P>0.05).
[0096] 6.3 The effect of the traditional Chinese medicine compound essential oil on the pathology of the liver and adipose tissue of the high blood lipid model mice
[0097] As shown in the results, Figure 3 After HE and oil red staining of the liver and adipose tissue of the mice, it was found that, compared with the NC group, the degree of fatty degeneration in the liver of the HFD group of mice was greatly increased, the vacuoles were obvious, and the diameter of the fat droplets was increased; compared with the HFD group, the fatty degeneration in the liver of the BHM-H and BHM-L groups of mice was significantly reduced, and the diameter of the fat droplets was significantly reduced.
[0098] 6.4 The effect of the traditional Chinese medicine compound essential oil on the fat metabolism related factors of the high blood lipid model mice
[0099] As shown in the results, Figure 4 Compared with the NC group, the lipolysis genes AHDH5, ATGL, and HSL in the liver of the HFD group of mice were significantly down-regulated (P<0.05), and the lipoxidation genes CPT-1 and CYP7A1 were significantly down-regulated (P<0.05), and the PPAR-γ, SCD-1, and FAS fat synthesis genes were significantly up-regulated (P<0.05 or P<0.01). Compared with the HFD group, the fat oxidation decomposition related genes ATGL, HSL, PPAR-α, and CPT-1 in the BHM-H and BHM-L groups of mice were significantly up-regulated (P<0.01), and the PPAR-γ, SCD-1, FAS, and Cidea fat synthesis genes had a significant down-regulation trend.
[0100] 7 Conclusion
[0101] The above results further show that the traditional Chinese medicine compound essential oil can significantly reduce the weight growth trend of the hyperlipidemia model mice, reduce the TC, TG and LDL contents in the serum and liver of the hyperlipidemia model mice, increase the HDL content, improve the pathological conditions of the liver and adipose tissue of the hyperlipidemia model mice, reduce the fatty degeneration inside the liver, and reduce the fat droplet diameter. The traditional Chinese medicine compound essential oil may realize the therapeutic effect on the hyperlipidemia model mice by up-regulating the fat oxidation decomposition related genes ATGL, HSL, PPAR-α and CPT-1, and inhibiting the PPAR-γ, SCD-1, FAS and Cidea fat synthesis genes.
[0102] The above examples are only used to illustrate the technical solutions of the present application, but not to limit it; although the present application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that the technical solutions recorded in the foregoing examples can be modified, or some technical features can be replaced by equivalents; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application.
Claims
1. An external use traditional Chinese medicine compound essential oil for preventing and / or improving and / or treating hyperlipidemia, characterized in that, The traditional Chinese medicine compound essential oil is composed of the following volume parts of traditional Chinese medicine plant essential oils: 0.1-2 parts of Radix Morindae Officinalis essential oil, 0.5-3 parts of Rhizoma Coptidis essential oil and 0.5-3 parts of Radix Aucklandiae essential oil.
2. The external-use traditional Chinese medicine compound essential oil for preventing and / or improving and / or treating hyperlipidemia according to claim 1, characterized in that, The traditional Chinese medicine compound essential oil is composed of the following volume parts of traditional Chinese medicine plant essential oils: 0.3-1.2 parts of Radix Morindae Officinalis essential oil, 0.8-2 parts of Rhizoma Coptidis essential oil and 0.8-2 parts of Radix Aucklandiae essential oil.
3. The external-use traditional Chinese medicine compound essential oil for preventing and / or improving and / or treating hyperlipidemia according to claim 1, characterized in that, The traditional Chinese medicine compound essential oil is composed of the following volume parts of traditional Chinese medicine plant essential oils: 0.6 parts of Radix Morindae Officinalis essential oil, 1 part of Rhizoma Coptidis essential oil and 1 part of Radix Aucklandiae essential oil. 4.The external-use traditional Chinese medicine compound essential oil for preventing and / or improving and / or treating hyperlipidemia according to any one of claims 1 to 3, characterized in that, The Radix Morindae Officinalis essential oil, the Rhizoma Coptidis essential oil and the Radix Aucklandiae essential oil are respectively extracted from the Chinese herbal medicine Radix Morindae Officinalis, Rhizoma Coptidis and Radix Aucklandiae by using the carbon dioxide supercritical extraction method, and the essential oil purity is kept above 99%.
5. The use of the traditional Chinese medicine compound essential oil according to any one of claims 1 to 3 in the preparation of a product for preventing and / or improving and / or treating hyperlipidemia, characterized in that, The product is a product for aromatherapy, specifically, the Radix Morindae Officinalis essential oil, the Rhizoma Coptidis essential oil and the Radix Aucklandiae essential oil are weighed according to the volume parts, mixed uniformly, and then a medically acceptable excipient is added to prepare an external dosage form for aromatherapy.
6. The product for preventing and / or ameliorating and / or treating hyperlipidemia according to claim 5, wherein The effective content of the traditional Chinese medicine compound essential oil is above 20%.
Citation Information
Patent Citations
Application of Xianglian product or combination of Xianglian product and antibiotics in anti-helicobacter pylori drugs
CN113144015A
Aucklandia-coptis pill, extract thereof, pharmaceutical composition and new application of aucklandia-coptis pill product
CN113730464A