Exosome for overexpressing miR-141-3p as well as preparation method and application of exosome

Abstract

The invention belongs to the technical field of biomedicine, and particularly relates to an overexpression miR-141-3p exosome as well as a preparation method and application thereof. The exosome is derived from mesenchymal stem cells; the nucleotide sequence of the miR-141-3p is as shown in SEQ ID NO: 1 (Sequence Identity Number 1). According to the overexpression miR-141-3p exosome provided by the invention, the exosome can be produced on a large scale, the difference between batches is small, the targeting property is strong, and the overexpression miR-141-3p immortalized umbilical cord mesenchymal stem cell exosome provides a new scheme for clinical treatment of hepatocellular carcinoma.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to an exosome overexpressing miR-141-3p, its preparation method, and its application. Background Technology

[0002] Liver cancer is the sixth most common cancer and the third leading cause of cancer death worldwide. Hepatocellular carcinoma (HCC) accounts for 90% of primary liver cancers, with over 900,000 new cases globally each year and a 5-year survival rate of less than 20%. Early detection of HCC allows for local treatment, including surgical resection, radiofrequency ablation, and transarterial chemoembolization. However, most patients are diagnosed at an advanced stage, making radical treatment with these local therapies impossible. For patients with unresectable advanced HCC, current treatments such as tyrosine kinase inhibitors (Sorafenib, Lenvatinib, etc.) have a median progression-free survival of only 3-6 months, an objective response rate of less than 30%, and widespread off-target toxicities. Although targeted therapies against driver genes such as TERT and CTNNB1 have made progress, no clinically accessible breakthrough therapies have yet been developed. In this context, identifying suitable gene targets and specific gene delivery methods holds promise for providing safer and more effective gene and immunotherapy for treating HCC, such as oncolytic virus vectors and nanoparticle-delivered drugs, CAR-T cell therapy, and immunotherapy.

[0003] MicroRNAs (miRNAs) are a class of non-coding RNAs that play a central role in cell differentiation, proliferation, and survival. The initial concept of miRNAs as developmental regulators has been greatly expanded, as they are dysregulated in many diseases, such as cancer, hepatitis, and cardiovascular disease. In recent years, numerous studies have shown a correlation between abnormal miRNA levels and cancer, providing new avenues for diagnosis, prognosis, and treatment strategies for cancer patients. Traditional miRNA therapy involves the delivery of miRNA mimics or viral vectors into the body via local injection into target organs or intravenous infusion. However, the low bioavailability, instability, RNase degradation, renal excretion, and inefficient permeation and absorption due to their charge and size prevent miRNAs from exerting their full effect. Corresponding solutions include methylation modification of miRNAs or encapsulation of miRNAs in nanoparticles. However, using chemically modified miRNA mimics to enhance their stability has limitations, namely the loss of mRNA silencing ability. Therefore, using nanoparticles to load miRNAs is currently an effective means to overcome the limitations of miRNA application in vivo. Summary of the Invention

[0004] Based on this, the purpose of the present invention is to provide an exosome that overexpresses miR-141-3p, thereby solving the problems in the prior art.

[0005] To achieve the above objectives, the present invention adopts the following technical solution.

[0006] This invention provides an exosome overexpressing miR-141-3p, wherein the exosome overexpressing miR-141-3p is derived from immortalized human umbilical cord mesenchymal stem cells overexpressing miR-141-3p;

[0007] The nucleotide sequence of miR-141-3p is shown in SEQ ID NO: 1.

[0008] Exosomes are extracellular vesicles released by all cells, ranging in size from 30 to 150 nm. They possess a lipid bilayer and are released into the extracellular environment during fusion with the plasma membrane. Their low immunogenicity and organ tropism have made them a hot research topic. Exosomes contain DNA, RNA, and proteins, and can efficiently transport loaded proteins and nucleic acids to recipient cells, thus playing a central role in cell-cell communication. They exhibit high delivery efficiency and high biocompatibility, protecting miRNAs from degradation and serving as natural carriers for miRNAs. Compared to other nanoparticles, intravenously injected exosomes tend to accumulate in the kidneys, liver, and spleen.

[0009] Human umbilical cord mesenchymal stem cells (UC-MSCs) derived from exosomes highly express CD47 and integrin α6β4, which can specifically accumulate in the liver tumor microenvironment. However, primary UC-MSCs suffer from limited proliferation capacity (≤10 passages) and batch-to-batch heterogeneity (exosome miRNA content varies by >50% among different donors), severely restricting their industrial application. Based on this, we constructed an immortalized human umbilical cord mesenchymal stem cell (TMSC) that highly expresses the telomerase gene (TERT). While achieving cell immortalization, it also produces exosomes highly expressing miR-141-3p. Comparison of exosome products from early, intermediate, and late-stage batches showed consistent composition, similar gross morphology, and negligible differences in particle size, concentration, and surface markers. This ensures that the quality and quantity of exosome products are not affected by TMSC passage number, enabling large-scale production for further clinical application in liver cancer treatment.

[0010] The present invention also discloses a method for preparing the exosomes, comprising: transfecting immortalized human umbilical cord mesenchymal stem cells with a vector overexpressing miR-141-3p, and separating the exosomes overexpressing miR-141-3p from the supernatant; wherein the particle size range of the exosomes overexpressing miR-141-3p is 30nm~150nm.

[0011] In some embodiments of the present invention, the supernatant is filtered, initially concentrated and finely purified to obtain exosomes overexpressing miR-141-3p.

[0012] In some embodiments of the present invention, the process after fine purification further includes secondary concentration.

[0013] In some embodiments of the present invention, the secondary concentration includes: after the exosomes are collected, they are centrifuged at 5000 rpm at 4°C to 100 μL~200 μL using a 100 KD ultrafiltration tube to obtain exosomes overexpressing miR-141-3p.

[0014] In some embodiments of the present invention, the vector overexpressing miR-141-3p includes at least one of the following: plasmid vector, lentiviral vector, adenovirus vector, adeno-associated virus vector, and retroviral vector.

[0015] In some embodiments of the present invention, the method includes: transfecting immortalized human umbilical cord mesenchymal stem cells with a recombinant lentivirus overexpressing miR-141-3p to obtain immortalized human umbilical cord mesenchymal stem cells overexpressing miR-141-3p.

[0016] Immortalized human umbilical cord mesenchymal stem cells overexpressing miR-141-3p were collected and cultured for 36-50 hours, after which the cell supernatant was collected.

[0017] The cell supernatant was concentrated and purified to obtain exosomes overexpressing miR-141-3p.

[0018] In some embodiments of the present invention, when the cell fusion rate reaches 80%, the culture medium is replaced with fresh mesenchymal stem cell culture medium, and after culturing for 36-50 hours, the cell supernatant is collected.

[0019] In some embodiments of the present invention, the method for preparing the recombinant lentivirus overexpressing miR-141-3p includes: using one of the pLVX series vectors, pLenti series vectors, pHIV-1 series vectors or pCMV-CMV series vectors as the base vector, constructing a recombinant plasmid overexpressing miR-141-3p, and using the recombinant plasmid to transfect the 293T cell line to obtain the recombinant lentivirus.

[0020] In some specific embodiments of this invention, the miR-141-3p sequence shown in SEQ ID NO: 1 is cloned into the multiple cloning site (MCS) of a lentiviral vector (base vector: GV621, purchased from Jikai Biotechnology). To ensure efficient gene expression, a Ubc promoter was designed to drive the expression of miR-141-3p. SV40 is used to start mCherry, and IRES is used to link mCherry and the puro resistance gene, achieving their simultaneous expression, ultimately constructing a lentiviral expression vector carrying miR-141-3p.

[0021] In some specific embodiments of the present invention, a lentiviral vector overexpressing miR-141-3p is used, and HEK293T cells are co-transfected with VSVG-envelope plasmid and Gag / pol / rev plasmid. After transfection, the cell supernatant is collected, filtered, centrifuged, and the precipitate is collected to obtain lentiviral particles overexpressing miR-141-3p.

[0022] In some specific embodiments of the present invention, the lentiviral particles overexpressing miR-141-3p are used to transfect immortalized human umbilical cord mesenchymal stem cells with an MOI value of 100 at the time of transfection, thereby obtaining immortalized human umbilical cord mesenchymal stem cells overexpressing miR-141-3p; the immortalized human umbilical cord mesenchymal stem cells overexpressing miR-141-3p are used to extract exosomes overexpressing miR-141-3p.

[0023] In some specific embodiments of the present invention, the method for extracting exosomes overexpressing miR-141-3p includes: when the immortalized human umbilical cord mesenchymal stem cells overexpressing miR-141-3p grow to 80%, continue culturing for 36-50 hours, and collect the cell supernatant; centrifuge at 300g for 10 min to remove dead cells, centrifuge at 3000g for 10 min to remove cell debris, filter through a 0.22μm microporous membrane, and retain the filtrate; then perform volume concentration in a 100kD ultrafiltration tube, retaining the primary concentrated exosomes in the centrifuge tube;

[0024] The exosomes after primary concentration were further extracted and purified using an Exosupur® size exclusion column (ES911) in centrifuge tubes. The primary concentrated exosomes were added to the top of the size exclusion column, allowing the sample to enter the column bed naturally under gravity, with a loading volume of 1 mL. Then, using PBS as the elution buffer, five exosome fractions (fractions 4, 5, 6, 7, and 8) were collected at a flow rate of 0.52 mL / min to 0.60 mL / min, with each fraction being 500 μL. Due to the large volume of exosomes after fraction collection, a 100 KD ultrafiltration tube was used, and the fractions were centrifuged at 5000 rpm at 4°C to a final volume of 100 μL to 200 μL for secondary concentration, yielding exosomes overexpressing miR-141-3p. This invention also discloses the application of these exosomes overexpressing miR-141-3p in the preparation of drugs for treating liver cancer.

[0025] The present invention also discloses a drug for treating liver cancer, wherein the exosomes overexpressing miR-141-3p are the active ingredient of the drug.

[0026] In some embodiments of the present invention, the drug further includes other pharmaceutically acceptable excipients.

[0027] Based on the technical solution of the present invention, the present invention has the following beneficial effects compared with the prior art:

[0028] (1) Stable and not easily degraded: This product uses exosomes of immortalized mesenchymal stem cells to overexpress miRNA, which solves the problem that miRNA is easily degraded by RNases in the blood and cells after entering the body and cannot fully exert its function. Exosomes are nanoparticles with a size between 30-150 nm and have a lipid bilayer membrane. They are released into the extracellular environment during the process of fusing with the plasma membrane. Exosomes contain DNA, RNA and proteins, and can effectively transport the loaded proteins and nucleic acids to recipient cells, thus playing a core role in cell-cell communication. This shows that exosomes are natural carriers of miRNA and can serve as miRNA drug delivery systems. Due to the delivery efficiency and high biocompatibility of exosomes, miRNA is easily protected by exosomes in vivo.

[0029] (2) Strong targeting: Most cell-secreted exosomes do not have specific targeting, but the exosomes secreted by the immortalized umbilical cord mesenchymal stem cells used in this product tend to accumulate in the liver when administered intravenously. In addition, umbilical cord mesenchymal stem cells have natural tumor homing characteristics, and the exosomes they secrete also have this characteristic, enabling targeted tumor delivery of drugs. Therefore, the immortalized umbilical cord mesenchymal stem cell exosomes used in this product overexpress miR-141-3p, utilizing their natural tumor homing characteristics and tendency to accumulate in the liver, can achieve precise treatment of HCC.

[0030] (3) High safety: This product uses exosomes secreted by mesenchymal stem cells, not the stem cells themselves. Traditional stem cell therapy carries risks such as vascular embolism, tumorigenesis, and immune rejection. Exosome-loaded drugs are a new cell-free therapy. They are 30-150 nm in size, 100 times smaller than stem cells, and have no risk of embolism. Because they are cell-free, exosomes have no risk of tumorigenesis and no immune rejection.

[0031] (4) Scalable production with low batch-to-batch variation and lower cost: Primary umbilical cord mesenchymal stem cells suffer from cell aging, and a single cell line can only be passaged 10 times before large-scale production of exosomes becomes impossible. Furthermore, due to the susceptibility of primary cells to aging, new cell lines need to be continuously extracted to obtain exosomes, resulting in inconsistent sources and significant batch-to-batch variations in exosome production. This product performs immortalization reprogramming on umbilical cord mesenchymal stem cells, enabling unlimited cell passage and large-scale exosome production with a consistent source. Because it eliminates the need for repeated stem cell extraction, this product has lower production costs.

[0032] (5) High yield and high purity: This invention extracts exosomes using ultrafiltration combined with size exclusion chromatography. Compared with the traditional ultracentrifugation method, this method yields the highest purity, particle number, and protein content of the harvested exosomes. The removal efficiency of impurities is as high as 99%, and the recovery rate is as high as 90% or more, ensuring both purity and yield. The miRNA quantification value is higher, while the free miRNA quantification value is very low, enabling more accurate analysis of exosome-derived miRNAs. Only extracellular vesicles within a fixed size range are recovered, and there is no need to use an ultracentrifuge, resulting in minimal damage to the exosome structure. The sample loading time is only 30 minutes to harvest exosomes, making the process faster. Therefore, the advantages of exosomes harvested using this method are: high purity, high yield, good particle uniformity, intact structure, simple operation, and short processing time.

[0033] (6) Tumor treatment: The exosomes of this product that overexpress miR-141-3p can be targeted and enriched in the liver and tumor sites in vivo, inhibiting the proliferation, migration and growth of liver cancer cells and promoting apoptosis of liver cancer cells, thereby achieving liver cancer treatment.

[0034] In summary, we have constructed an immortalized umbilical cord mesenchymal stem cell exosome that can be produced on a large scale, exhibits minimal batch-to-batch variability, strong targeting, and overexpresses miR-141-3p. This provides a new approach for the clinical treatment of HCC. Attached Figure Description

[0035] Figure 1 This is a schematic diagram of a lentivirus vector.

[0036] Figure 2This is a statistical result of the expression level of miR-141-3p in the selected cell lines after lentiviral vector transfection.

[0037] Figure 3 The fluorescence image of the successfully constructed immortalized umbilical cord mesenchymal stem cells (with green fluorescence) and the fluorescence image of the immortalized umbilical cord mesenchymal stem cells overexpressing miR-141-3p (with red and green fluorescence).

[0038] Figure 4 Figure showing the identification results of exosome surface markers for overexpression of miR-141-3p.

[0039] Figure 5 Figure 1 shows the results of mouse targeting identification at different time points after exosome injection via tail vein; Figure 5 In the figure, A represents the distribution map in the mouse body after injection and the fluorescence expression of each organ after sacrifice 24 hours later; Figure 5 In the figure, B represents the results of fluorescence expression in the kidneys, heart, lungs, liver, tumors, and skin of mice at 24 hours.

[0040] Figure 6 This is a diagram illustrating the in vitro functional validation of exosomes; among them, Figure 6 In the figure, A represents the CCK8 activity test results of liver cancer organoids in different treatment groups; Figure 6 In the figure, B represents the bar chart of Ki67 fluorescence intensity statistics for different treatment groups; Figure 6 In the image, C represents the fluorescence microscope images of different treatment groups.

[0041] Figure 7 This is a diagram showing the results of in vivo functional validation of exosomes; among them, Figure 7 In the image, A represents the tumor images of mice in different treatment groups; Figure 7 In the figure, B represents the statistical results of tumor weight in mice of different treatment groups; Figure 7 In the figure, C represents the statistical results of tumor volume in mice of different treatment groups.

[0042] Figure 8 The images show the immunohistochemical results of mice in different treatment groups; among them, Figure 8 In the figure, A represents the results of Ki67 staining in immunohistochemistry of tumors in mice of different treatment groups; Figure 8 In the figure, B represents the bar chart of statistical results of Ki67 fluorescence intensity in tumors of mice in different treatment groups. Detailed Implementation

[0043] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the embodiments thereof. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the protection scope of the present invention.

[0044] The following description is based on specific embodiments.

[0045] I. Experimental Materials:

[0046] Human umbilical cord mesenchymal stem cells and immortalized human umbilical cord mesenchymal stem cells were disclosed in Chen Q, Jin M, Wang S, Wang K, Chen L, Zhu X, Zhang Y, Wang Y, Li Y, Li S, Zeng Y, Feng L, Yang W, Gao Y, Zhou S, Peng Q. Establishing an hTERT-driven immortalized umbilicalcord-derived mesenchymal stem cell line and its therapeutic application in mice with liver failure. J Tissue Eng. 2023 Sep 19;14:20417314231200328. doi:10.1177 / 20417314231200328IF: 6.7 Q1 . PMID: 37736245; PMCID: PMC10510347.

[0047] Example 1

[0048] A method for preparing exosomes overexpressing miR-141-3p specifically includes the following steps:

[0049] 1. Construction of lentiviral vector carrying miR-141-3p and cell transfection

[0050] The lentiviral vector overexpressing miR-141-3p involved in this embodiment was obtained and delivered by Jikai Gene (order number: GOSL0405669) using its professional vector construction platform.

[0051] Lentiviral expression vectors carrying miR-141-3p (e.g.) Figure 1Construction: First, miR-141-3p (sequence shown in SEQ ID NO: 1) was cloned into the multiple cloning site (MCS) of a lentiviral vector (base vector: GV621, purchased from Jikai Biotechnology). To ensure efficient gene expression, a Ubc promoter was designed to drive miR-141-3p expression. SV40 was used to promote mCherry expression, and IRES was used to link mCherry with the puro resistance gene, achieving simultaneous expression. This results in cells exhibiting red fluorescence after infection and allowing for selection via the puromycin resistance gene. The lentiviral expression vector and helper packaging plasmids (VSVG-envelope plasmid and Gag / pol / rev plasmid) were co-transfected into 293T cells to complete lentiviral particle packaging and production.

[0052] The sequence of miR-141-3p is as SEQ ID NO: 1 shows: CTGGCCGTTTTTGGCTTTTTTGTTAGACGAAGCTTGGGCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGGTCTTGAGCTTGGGGTTGGCTCGCCCCCTCTCAAGAGACCTCACCTGGCCTGTGGCCAGG GTCCCCTGTAGCAACTGGTGAGCGCGCACCGTAGTTCTCTGTCGGCCGGCCCTGGGTCCATCTTCCAGTACAGTGTTGGATGGTCTAATTGTGAAGCTCCTAACACTGTCTGGTAAAGATGGCTCCCGGGTGGGTTC TCCTCGGCAGTAACCTTCAGGGAGCCCTGAAGACCATGGAGGACTACTGACCAACAACCTCTGACCTTCACCCCTCTGGCTAGCCTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGG CAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCA

[0053] HEK293T cells were co-transfected with three plasmids (a lentiviral vector overexpressing miR-141-3p, a VSVG-envelope plasmid, and a Gag / pol / rev plasmid) at 37°C and 5% CO2 using transfection buffer (purchased from Jikai Biotechnology). The transfection buffer contained 20 μg of the lentiviral vector overexpressing miR-141-3p, 15 μg of the VSVG-envelope plasmid, and 10 μg of the Gag / pol / rev plasmid. Forty-eight hours after transfection, the cell supernatant was harvested and filtered through a 0.45 μm filter into a 40 mL ultracentrifuge tube. The supernatant was centrifuged at 25,000 rpm for 2 hours. The supernatant was discarded, and the corresponding volume of virus preservation solution was added and the cells were centrifuged at 10,000 rpm for 5 minutes. The supernatant was subjected to physical, safety, and titer assays to obtain lentiviral particles overexpressing miR-141-3p. The collected viral particles were used for subsequent cell transfection. The results are shown in Tables 1 and 2.

[0054] Table 1. Titer Detection

[0055] ID titer LV-gene(100159-2) 4E+8

[0056] Table 2 Safety Testing:

[0057] Testing items Detection methods Target 1 unit Reference range Mycoplasma Nest PCR Negative - Negative Chlamydia Cultivation method Negative - Negative bacteria Cultivation method Negative - Negative fungi Cultivation method Negative - Negative endotoxin LAL qualified EU / mL ＜50

[0058] Note: "-" indicates that the item is not available.

[0059] 2. Cell transfection: Prepare 7.5×10⁻⁶ cells. 3 Immortalized human umbilical cord mesenchymal stem cell (UC-MSC) suspension was administered at a concentration of 2 mL / well to seed UC-MSCs into six-well plates. The plates were incubated at 37°C in a 5% CO2 incubator. After 16–20 hours, when the cells were in the logarithmic growth phase, the immortalized UC-MSCs were transfected using transfection buffer. A transfection efficiency of 100 was achieved without affecting normal cell growth and proliferation.

[0060] Transfection solution preparation: Add 6 μL of lentiviral particles overexpressing TERT / miR-141-3p and 80 μL of HiTransGP to 2 mL of serum-free mesenchymal stem cell culture medium (purchased from TBD, catalog number SC-2013G). Incubate at 37°C in a 5% CO2 incubator, observing cell status under a microscope every hour. After 8 hours, remove the transfection solution, wash cells twice with PBS, and add fresh serum-free mesenchymal stem cell culture medium. Continue culturing for 48–72 hours, then add 1 µg / mL of puromycin to begin antibiotic selection.

[0061] During the resistance selection process, the culture medium was replaced with fresh medium every 2 to 3 days, and the screening drug puromycin was continuously added. After 7 to 14 days of selection, the surviving cells after resistance selection were diluted and plated using a single-cell cloning method for further purification of stable lines.

[0062] 3. Further identification of the screened cell lines was performed, and qPCR was used to verify the integration and expression of the target gene.

[0063] The verification results are as follows Figure 2 and Figure 3 As shown, further identification of the screened cell lines revealed that the obtained cells highly expressed miR-141-3p.

[0064] 4. Large-scale production of exosomes overexpressing miR-141-3p

[0065] High-purity exosomes were obtained by using ultrafiltration (UF) combined with size exclusion chromatography (SEC) to separate large quantities of high-concentration exosomes, and the separated exosomes were identified.

[0066] (1) Cell culture and supernatant collection:

[0067] Human umbilical cord mesenchymal stem cells overexpressing miR-141-3p, selected from puromycin, were seeded in cell culture flasks. When the cells reached 80% confluence, the culture medium was replaced with fresh serum-free mesenchymal stem cell culture medium, and the cells were cultured for another 36-50 hours. The cell supernatant was then collected.

[0068] (2) Exosome purification:

[0069] 1) Pretreatment of cell supernatant: Collect cell supernatant, centrifuge at 300g for 10min to remove dead cells, centrifuge at 3000g for 10min to remove cell debris, filter through a 0.22μm microporous membrane, and retain the filtrate.

[0070] 2) Primary Concentration: The filtrate from step 1) is further concentrated by passing it through a 100kD ultrafiltration tube (4000g centrifugation for 10-20 times concentration). The exosomes after primary concentration are retained in the centrifuge tube. During centrifugation, water and small molecules pass through the ultrafiltration membrane, while the exosomes are retained in the ultrafiltration centrifuge tube, thus achieving concentration.

[0071] 3) Fine purification: The exosomes retained in the centrifuge tubes from step 2) were further extracted and purified using an Exosupur® size exclusion column (ES911). The exosomes, after initial concentration from step 2), were added to the top of the size exclusion column, allowing the sample to enter the column bed naturally under gravity, with a loading volume of 1 mL. Elution was then performed using PBS as the elution buffer at a flow rate of 0.52 mL / min to 0.60 mL / min (specifically, a flow rate of 0.55 mL / min was used in this embodiment). The eluent was collected, and five exosome fractions (fractions 4, 5, 6, 7, and 8) were collected after collecting the void volume, with each fraction being 500 μL.

[0072] 4) Secondary concentration: After collection, the exosomes are relatively large in volume. They can be centrifuged at 5000 rpm at 4°C to 100 μL~200 μL (specifically, in this example, to 150 μL) using a 100 KD ultrafiltration tube to obtain exosomes overexpressing miR-141-3p.

[0073] 5. Identification of exosomes overexpressing miR-141-3p:

[0074] The harvested exosomes were subjected to concentration measurement, particle size identification, morphological identification, surface marker identification, batch consistency identification, and targeting identification in order to conduct quality control on exosomes overexpressing miR-141-3p.

[0075] (1) Concentration measurement and particle size identification: Nanoflow cytometry (NanoFCM) was used for analysis. Particle concentration and particle size distribution were quantified according to the protocol. The flow rate and side scattering intensity were converted into corresponding vesicle concentration and size using NanoFCM software (NanoFCM Professional). The average particle size of exosomes was 78.27 nm, with particles ranging from 30 nm to 150 nm accounting for 99.02% of the total number of particles, and a concentration of 1.74E+10 particles / mL.

[0076] (2) Morphological identification: TEM showed that the exosomes were enriched in a vesicle-like structure with a lipid bilayer, i.e., a biconcave bilayer membrane structure, and were cup-shaped.

[0077] (3) Identification of surface markers: Exosomal marker proteins CD9, TSG101, and CD81 were identified by Western blotting, while calnexin and β-actin were used as internal controls for negative markers; the identification results are as follows: Figure 4 As shown, the extracted substance is an exosome, and markers expressing exosomes are also presented.

[0078] 4) Inter-batch consistency assessment: To verify whether the exosome content produced by overexpressing miR-141-3p TMSCs at different passages (early, middle, and late) was consistent, exosomes of overexpressing miR-141-3p TMSCs from P3, P10, P25, and P50 were extracted, and RNA was extracted for qPCR to detect the relative expression level of miR-141-3p in each group. The results showed no statistically significant difference, indicating that the growth passage does not affect the content of miR-141-3p in exosomes.

[0079] 5) Targeting identification: In vivo exosome tracing was performed using DIR staining of exosomes. The exosomes were injected into the tail vein of male severely immunodeficient mice (M-NSG) weighing about 22g at 4 weeks of age. The fluorescence expression in mice was captured by a small animal in vivo imaging device at 0h, 6h, 12h and 24h. At 24h, the tumor and key organs were removed and the fluorescence expression was captured.

[0080] like Figure 5 As shown in A and B, exosomes were found to accumulate in large quantities in the liver 6 hours after injection, and fluorescent expression was also observed in the tumor site (right back of the mouse). The tumor and important organs were removed 24 hours later and exosomes were also observed to show high fluorescence intensity in the liver and tumor, slightly lower expression in the lungs, and almost no expression in the heart and kidneys.

[0081] In summary, the exosomes overexpressing miR-141-3p prepared by the above method can be rapidly and targeted to accumulate in the liver and tumor sites in vivo via intravenous injection.

[0082] Example 2: Validation of the in vitro therapeutic efficacy of exosomes overexpressing miR-141-3p

[0083] 1. Construction of patient-derived organoids (PDOs)

[0084] Human hepatocellular carcinoma tissue fragments (from the Department of Hepatobiliary Surgery II, Zhujiang Hospital) were collected in primary tissue preservation solution at 4°C. Non-epithelial tissue was removed, and the tissue was rinsed with PBS and then cut into 1-3 mm pieces. 3 Short snippets;

[0085] The tissue fragments were then digested for 15-45 minutes using a tumor tissue digestion solution at 37°C. Digestion was stopped when most of the tissue fragments could pass through the tip of a 1 mL pipette.

[0086] The cells were filtered through a 100 μm cell filter and the precipitate was resuspended in a red blood cell lysis solution and the red blood cells were lysed at room temperature.

[0087] The sieved and lysed cell pellet was resuspended in hepatocellular carcinoma organoid culture medium to prepare a cell suspension. An equal volume of matrix gel was added and mixed well. The matrix gel containing organoids was then spread in the center of a 24-well cell culture plate. The plate was placed in a humidified incubator at 37°C and 5% CO2 for 30 minutes to allow the matrix gel to harden. After the matrix gel hardened, the plate was opened, and 750 μL of hepatocellular carcinoma organoid culture medium (manufacturer: Jikai Biotechnology, catalog number: K2105-HCC) was carefully added to each well. The plate was then placed in a humidified incubator at 37°C and 5% CO2. The culture medium was changed every 3-4 days, and organoid formation was closely monitored for in vitro exosome functional validation. Ideally, patient-derived hepatocellular carcinoma organoids should be passaged for the first time after 7 to 10 days.

[0088] 2. In vitro functional validation of exosomes: After multiple passages to remove contaminating cells, 7.5 μg / mL of exosomes were added to the culture medium of P3 generation organoids (organoids after the third passage). The organoids were divided into three groups: a high miR-141-3p expression exosome group, a negative control (NC) exosome group, and a blank (CON) group. The organoid status was observed under an inverted phase-contrast microscope every 1-2 days. After one week of continuous treatment, the miR-141-3p group of liver cancer organoids showed significant decomposition, deformation, fragmentation, and loose connections. This was validated using a CCK8 activity assay and Ki67 immunofluorescence staining.

[0089] The CCK8 results show that... Figure 6 As shown in A, the OD value of the miR-141-3p group was 15% lower than that of the NC group; the immunofluorescence experiment results are as follows. Figure 6 As shown in B and C, the Ki67 fluorescence intensity in the miR-141-3p group was significantly weaker than that in the other two groups. These experiments confirm that exosomes overexpressing miR-141-3p can indeed reduce the activity of liver cancer organoids and inhibit their proliferation.

[0090] Example 3: Validation of the in vivo therapeutic efficacy of exosomes overexpressing miR-141-3p

[0091] 1. Construction of patient-derived seed transplantation model (PDX)

[0092] Human hepatocellular carcinoma tissue fragments (from the Department of Hepatobiliary Surgery II, Zhujiang Hospital) were collected in primary tissue preservation solution at 4°C. Non-epithelial tissue was removed, and the tissue was rinsed with PBS and then cut into 1-3 mm pieces. 3 A small fragment was mixed with 100 μL of matrix gel and injected into the right axilla of a 4-week-old male severely immunodeficient mouse (purchased from Shanghai Southern Model Biotechnology Co., Ltd.).

[0093] After inoculation, an observation period begins. After 3 to 5 months, first-generation xenografts will grow at the inoculation site. The xenografts are then passaged, and the tumor tissue is transplanted into new immunodeficient mice of the same type using a standardized procedure. This process is repeated to obtain xenografts of different generations.

[0094] 2. In vivo functional verification of exosomes

[0095] After the transplanted tumor has been passaged to the F generation, changes in tumor volume are closely monitored. Tumor size is measured according to the formula: Tumor volume = 0.5 × (W) 2 ×(L) calculation (L represents length, W represents width). When the tumor volume reaches 100mm... 3 Then, grouping and processing began. The third-generation mice were ultimately selected for subsequent functional validation experiments.

[0096] Tumors formed approximately one week later, and grew to 100 mm in size. 3 The treatment was initiated by grouping patients, with each dose of 100 μg / 100 μL administered twice a week via tail vein injection. The groupings were as follows: a. miR-141-3p group: 100 μg of miR-141-3p overexpressing exosomes was injected as the experimental group; b. NC group: 100 μg of NC exosomes was injected as the negative control; c. Doxorubicin treatment group: 2.5 mg / kg of doxorubicin hydrochloride was administered as the positive control; d. CON group: PBS was injected as the blank control.

[0097] The tumors in mice were measured 2-3 times per week. After 4 weeks of injection, the tumors in the miR-141-3p group were significantly smaller than those in the NC group. The experiment was terminated, and the subcutaneous tumors of the mice were removed, photographed, weighed, and fixed with 4% paraformaldehyde for subsequent immunohistochemical experiments.

[0098] 3. Results of in vivo functional verification of exosomes

[0099] (1) After the experiment is terminated, as follows Figure 7 As shown in Figures A through C, after the tumor was removed, photographs were taken, and the tumor volume was calculated. The results showed that the average tumor volume in the miR-141-3p group was 674.07 mm². 3 The average tumor volume was 803.15 mm. 3 The doxorubicin treatment group showed a significantly lower tumor volume than the mean tumor volume of 1253.23 mm. 3 The mean tumor volume in the NC group was 1150.78 mm. 3 The tumors in the CON group were weighed. The results showed that the tumor weights in the miR-141-3p group, doxorubicin treatment group, NC group, and CON group were 0.44g, 0.64g, 1.08g, and 1.05g, respectively.

[0100] (2) Tumor tissues from each group were fixed and subjected to immunohistochemical staining. The results are as follows: Figure 8 As shown in Figures A and B, the Ki67 value in the miR-141-3p group was 19.7%, and in the doxorubicin treatment group it was 20.01%, similar to the miR-141-3p group, with no statistically significant difference. The Ki67 values ​​in the NC group and CON group were 31.21% and 30.96%, respectively. It is evident that the tumor tissue growth rate after treatment with exosomes overexpressing miR-141-3p was significantly lower than that in the CON and NC groups. These results strongly suggest that exosomes overexpressing miR-141-3p can inhibit liver cancer proliferation in vivo.

[0101] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0102] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.

Claims

1. An exosome overexpressing miR-141-3p, characterized in that, The exosomes overexpressing miR-141-3p were derived from immortalized human umbilical cord mesenchymal stem cells overexpressing miR-141-3p. The nucleotide sequence of miR-141-3p is shown in SEQ ID NO:

1.

2. The method for preparing exosomes as described in claim 1, characterized in that, include: Immortalized human umbilical cord mesenchymal stem cells were transfected with a vector overexpressing miR-141-3p, and exosomes overexpressing miR-141-3p were obtained by separating the supernatant. The particle size range of the exosomes overexpressing miR-141-3p was 30 nm to 150 nm.

3. The method for preparing exosomes as described in claim 2, characterized in that, After filtration, initial concentration, and fine purification, the supernatant yielded exosomes overexpressing miR-141-3p.

4. The method for preparing exosomes as described in claim 3, characterized in that, The process after the fine purification also includes secondary concentration.

5. The method for preparing exosomes as described in claim 2, characterized in that, The vectors that overexpress miR-141-3p include at least one of the following: plasmid vectors, lentiviral vectors, adenovirus vectors, adeno-associated virus vectors, and retroviral vectors.

6. The preparation method according to claim 5, characterized in that, include: Immortalized human umbilical cord mesenchymal stem cells were obtained by transfecting them with a recombinant lentivirus that overexpressed miR-141-3p. Immortalized human umbilical cord mesenchymal stem cells overexpressing miR-141-3p were collected and cultured for 36-50 hours, after which the cell supernatant was collected. The cell supernatant was concentrated and purified to obtain exosomes overexpressing miR-141-3p.

7. The preparation method according to claim 6, characterized in that, The method for preparing the recombinant lentivirus overexpressing miR-141-3p includes: using one of the pLVX series vectors, pLenti series vectors, pHIV-1 series vectors, or pCMV-CMV series vectors as the base vector, constructing a recombinant plasmid overexpressing miR-141-3p, and transfecting the 293T cell line with the recombinant plasmid to obtain the recombinant lentivirus.

8. The use of the exosomes overexpressing miR-141-3p as described in claim 1 or the exosomes overexpressing miR-141-3p prepared by any one of claims 2 to 7 in the preparation of a drug for treating liver cancer.

9. A drug for treating liver cancer, characterized in that, The drug uses the exosomes overexpressing miR-141-3p as described in claim 1 as its sole active ingredient.

10. The medicament as claimed in claim 9, characterized in that, The drug also includes other pharmaceutically acceptable excipients.

Images