Molecular marker and primer for identifying gender of Nibea dispinosa and application of molecular marker and primer
By designing specific primers to amplify and detect the genomic DNA of *Prorocentrum dispinipes* by PCR, the problems of complex operation and limited accuracy in existing technologies have been solved. This enables rapid and accurate identification of the sex of *Prorocentrum dispinipes*, supporting sex-controlled breeding and germplasm resource protection.
Patent Information
- Application Number
- CN202511825084.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-05
- Publication Date
- 2026-01-09
AI Technical Summary
In existing technologies, sex determination methods for the yellow croaker are complex, time-consuming, and have limited accuracy. They often rely on tissue sections or dissections and cannot accurately determine sex in the early stages.
Specific primers were designed to amplify the genomic DNA of the yellow croaker (Prorocentrum dispinipes) by PCR. Males were identified by detecting double bands of 174bp and 181bp by electrophoresis, and females by detecting a single band of 174bp, thus achieving rapid and accurate sex identification.
This study provides a simple and non-destructive method for sex determination, which can accurately determine the sex of the yellow croaker at an early stage, supporting sex-controlled breeding and germplasm resource protection.
Smart Images

Figure CN121294634A_ABST
Abstract
Description
Technical Field
[0001] This invention pertains to molecular breeding and sex identification of fish, and particularly relates to a molecular marker, primer, and its application for identifying the sex of the yellow croaker. Background Technology
[0002] Fish are among the most complex vertebrate groups in terms of sex determination mechanisms. Understanding these mechanisms is crucial for rapid early sex identification using molecular markers, thereby advancing sex-controlled breeding. Due to significant differences among different fish species, sex-specific molecular markers for a single species are typically not universally applicable, necessitating the development of individual markers for each species. Currently, no publicly reported molecular markers for sex determination in the yellow croaker (Procambarus spp.) are available. Developing a stable and reliable molecular marker is of great importance for its sex identification and sex-controlled breeding.
[0003] The red-mouthed croaker, also known as the croaker, belongs to the Sciaenidae family and is widely distributed along the southeastern coast of my country. It is a rapidly developing new species in marine aquaculture and has become an important economic fish in the Sciaenidae family. Its swim bladder, known as "red-mouthed croaker glue," is one of the five famous glues. The swim bladder of males is particularly thick and commands a higher price, representing its main economic value, and it has significant aquaculture potential in the South my country Sea and other areas. However, it takes 3-4 years for it to reach sexual maturity. Sex cannot be determined by appearance during the juvenile stage. Current sex determination relies on gonadal morphology observation, which can only be performed after gonadal differentiation and maturity, making the process complex, time-consuming, and with limited accuracy. Therefore, developing molecular markers for sex in the red-mouthed croaker is not only helpful for early sex identification and sex-controlled breeding but also provides theoretical support and technical assurance for its germplasm resource protection and utilization. Summary of the Invention
[0004] In view of this, the purpose of this invention is to provide a molecular marker, primer and its application for identifying the sex of the yellow croaker, in order to overcome the problems of existing identification methods, such as complex operation, long cycle, limited accuracy and reliance on highly invasive means such as tissue sectioning or dissection, so as to achieve a more efficient, accurate and non-destructive sex identification method.
[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a molecular marker for identifying the sex of the yellow croaker, the nucleotide sequence of which is shown in SEQ ID NO:1.
[0006] The present invention also provides primers for amplifying the molecular marker, the nucleotide sequences of which are shown in SEQ ID NO:2 and SEQ ID NO:3.
[0007] This invention also provides a method for identifying the sex of the yellow croaker, comprising the following steps: 1) Extract genomic DNA from *Procambarus spp.* (a type of yellow croaker); 2) Using the genomic DNA extracted in step 1) as a template, perform PCR amplification using the primers described above, and detect the PCR amplification products by electrophoresis; 3) Determine the sex based on the electrophoresis band results from step 2).
[0008] Preferably, when the PCR amplification yields two bands of 174bp and 181bp, the *Prorocentrum diochocarpa* is male, and when the PCR amplification yields a single band of 174bp, the *Prorocentrum diochocarpa* is female.
[0009] This invention also provides the application of the molecular markers or primers described herein in sex identification of the yellow croaker.
[0010] The present invention also provides a kit for identifying the sex of the yellow croaker, including the primers mentioned above.
[0011] Compared with the prior art, the present invention has the following beneficial effects: This invention utilizes whole-genome resequencing and population association analysis of male and female *Procambarus scoparia* to screen for male-specific DNA fragments and design corresponding specific primers. Using these primers, PCR amplification of the individual genomic DNA resulted in specific double bands (174 bp and 181 bp) amplified in males, while females only showed a single band (174 bp), thus enabling rapid and accurate determination of the genetic sex of *Procambarus scoparia*. The molecular markers and primers provided by this invention are simple to operate, cause minimal damage to the fish, and can be used for early sex identification, sex-controlled breeding, and germplasm resource protection of *Procambarus scoparia*. Attached Figure Description
[0012] Figure 1 This is an agarose gel electrophoresis image of the genomic DNA of the yellow croaker (Procambarus spp.) after PCR amplification. Detailed Implementation
[0013] This invention provides a molecular marker for identifying the sex of the yellow croaker, the nucleotide sequence of which is shown in SEQ ID NO:1, specifically AATGGAGG.
[0014] The present invention also provides primers for amplifying the molecular marker, the nucleotide sequences of which are shown in SEQ ID NO:2 and SEQ ID NO:3, specifically TTGGCAGGCAGATACTCACC and CTATGGCAAGGTGGGTGCTT, and the primers are located on both sides of the male-specific sequence on chromosome 2.
[0015] This invention also provides a method for identifying the sex of the yellow croaker, comprising the following steps: 1) Extract genomic DNA from *Procambarus spp.* (a type of yellow croaker); 2) Using the genomic DNA extracted in step 1) as a template, perform PCR amplification using the primers described above, and detect the PCR amplification products by electrophoresis; 3) Determine the sex based on the electrophoresis band results from step 2).
[0016] In this invention, genomic DNA is extracted from *Protoplasma scoparia*. The genomic DNA is derived from the fin tissue of *Protoplasma scoparia*, and its concentration is 50–200 ng / μL, with a purity of OD260 / OD280 value of 1.70–1.90.
[0017] In this invention, the genomic DNA extracted in step 1) is used as a template, and PCR amplification is performed using the primers described above. The PCR amplification products are then detected by electrophoresis. The PCR amplification reaction system consists of 12.5 μL of 2×Premix Taq, 1 μL each of 10 μM forward and reverse primers, 1 μL of template DNA, and ddH2O added to a total volume of 25 μL. The PCR amplification reaction conditions are: 94℃ pre-denaturation for 30 s, 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 1 min, for 35 cycles; and a final extension at 72℃ for 5 min.
[0018] In this invention, sex is determined based on the electrophoresis band results of step 2). When the PCR amplification yields two bands of 174bp and 181bp, the *Prorocentrum diochocarpa* is male; when the PCR amplification yields a single band of 174bp, the *Prorocentrum diochocarpa* is female.
[0019] When the PCR amplification yields two bands of 174bp and 181bp, the *Prorocentrum diplodocus* is male; when the PCR amplification yields a single band of 174bp, the *Prorocentrum diplodocus* is female.
[0020] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0021] Example 1
[0022] (1) Sample collection: 50 male and 50 female *Procambarus hyraxe* were collected, and DNA was extracted from their fin tissues. The concentration of genomic DNA was 50-200 ng / μL, and the purity requirement for genomic DNA was an OD260 / OD280 value of 1.7-1.90.
[0023] (2) Whole-genome resequencing and genome-wide association analysis were performed to screen for SNP / Indel loci that were significantly associated with sex. The molecular marker was obtained as follows: Based on the genome sequence of *Protopterus spicata* in our laboratory, 50 female and 50 male *Protopterus spicata* were resequently sequenced, and genome-wide association analysis was performed to identify regions that were significantly associated with sex in *Protopterus spicata*, which were located on chromosome 2 of *Protopterus spicata*; further analysis of the genome resequencing data, such as sex-to-sex depth comparison, revealed a male-specific sequence on chromosome 2; primers were designed on the flanking sequences of these two sequences, and the difference in the length of the amplified fragments was used to identify whether *Protopterus spicata* carried a male-specific sequence; individuals with the nucleotide sequence SEQ ID NO:1 (AATGGAGG) were genetically male *Protopterus spicata*.
[0024] (3) Design specific primers and perform PCR amplification.
[0025] The PCR reaction system was as follows: using genomic DNA from *Prorocentrum dispinipes* of known sex as a template, PCR amplification was performed using primers SEQ ID NO:2-3 (TTGGCAGGCAGATACTCACC and CTATGGCAAGGTGGGTGCTT). The labeled primers were purified using HAP at a concentration of 10 μM. The PCR reaction system was prepared using a PCR premix kit (brand: TAKARA, catalog number: RR903A): 12.5 μL of 2×Premix Taq, 1 μL each of 10 μM forward and reverse primers, 1 μL of template DNA, and ddH2O to a total volume of 25 μL (as shown in Table 1 below). The reaction conditions for primers SEQ ID NO:2-3 were: 94℃ pre-denaturation for 30 s, 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 5 min.
[0026] Table 1. Reaction system for PCR amplification
[0027] (4) The PCR amplification products were genotyped using agarose gel electrophoresis. The genetic sex of the target yellow croaker was determined based on the amplification of the target band. The specific steps were as follows: 3% agarose gel was prepared, nucleic acid dye (product number: 345D0101) was added, 6 μL of PCR product was loaded onto the gel, and 2000 bp DNA ladder was used for labeling. Electrophoresis was performed at 120V for 90 min. The bands were photographed using a gel imaging device. The genotype of each sample was recorded based on the bands amplified by the primers. The genetic sex of the target yellow croaker was determined based on the differences in the amplification of the target band.
[0028] Experimental results: such as Figure 1 As shown. If the *Prorocentrum diplodocus* amplifies a specific double band (174 bp and 181 bp), then this individual is genetically male. If the *Prorocentrum diplodocus* amplifies only a single band (174 bp), then this individual is genetically female.
[0029] Population validation: PCR validation was performed in another independent population (50 females and 50 males), and the results showed that the marker could achieve 100% accuracy in genetic sex identification.
[0030] As demonstrated in the above embodiments, this invention screens male-specific DNA fragments by performing whole-genome resequencing and genome-wide association analysis on male and female individuals of the *Procambarus scoparia*, and designs corresponding specific primers. Using these primers, PCR amplification of the individual's genomic DNA reveals specific double bands (174 bp and 181 bp) in male individuals, while female individuals only show a single band (174 bp), thus achieving rapid and accurate determination of the genetic sex of the *Procambarus scoparia*.
[0031] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A molecular marker for identifying the sex of *Prorocentrum dispinipes*, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO:
1.
2. The primers for amplifying the molecular marker of claim 1, characterized in that, The nucleotide sequences of the primers are shown in SEQ ID NO:2 and SEQ ID NO:
3.
3. A method for identifying the sex of the yellow croaker, characterized in that, Includes the following steps: 1) Extract genomic DNA from *Procambarus spp.* (a type of yellow croaker); 2) Using the genomic DNA extracted in step 1) as a template, PCR amplification is performed using the primers described in claim 2, and the PCR amplification products are detected by electrophoresis; 3) Determine the sex based on the electrophoresis band results from step 2).
4. The method according to claim 2, characterized in that, When the PCR amplification yields two bands of 174bp and 181bp, the *Prorocentrum diplodocus* is male; when the PCR amplification yields a single band of 174bp, the *Prorocentrum diplodocus* is female.
5. The application of the molecular marker of claim 1 or the primer of claim 2 in sex identification of *Prorocentrum dispinipes*.
6. A kit for identifying the sex of *Prorocentrum dispinipes*, characterized in that, Includes the primers described in claim 2.