Method for detecting activity of skin flap endonuclease 1 based on double cascade signal amplification

Abstract

The invention discloses a method for detecting the activity of skin flap endonuclease 1 based on double cascade signal amplification. Belongs to the technical field of enzyme activity detection. According to the invention, the specific dumbbell probe is designed; when the skin flap endonuclease 1 exists in the sample to be detected, the skin flap endonuclease 1 can be detected; a flap endonuclease 1 specifically recognizes and cuts off a 5'overhanging flap in the dumbbell probe to generate a single-stranded DNA with a 3 '-OH terminal and a dumbbell-shaped DNA with a notch, two products generated by cutting respectively trigger rolling circle amplification and strand displacement amplification reactions, specific signals are amplified, the purpose of sensitive detection is achieved, the substrate utilization rate is 100%, no probe is wasted, and the detection cost is reduced. The method is carried out under isothermal and homogeneous conditions, does not need high-precision thermal circulation and separation steps, does not need to prepare a functional nano material, does not relate to a biological coupling procedure, effectively reduces the analysis cost and complexity, and provides a technical support for the detection of the activity of the skin flap endonuclease 1.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of enzyme activity detection, and more particularly to a method for detecting flap endonuclease 1 activity based on double cascade signal amplification. BACKGROUND

[0002] DNA damage is the result of various internal and environmental factors, which can cause DNA mutations and replication errors, and further trigger cancer. Base excision repair (BER) is an important DNA repair pathway involved in maintaining genome stability. According to the length of the repair patch generated in the reaction, two BER sub-pathways have been defined in vitro: short patch (replacement of one nucleotide) and long patch (replacement of more than one nucleotide). Flap endonuclease 1 (FEN1) is an important DNA repair enzyme that plays a crucial role in long patch BER and DNA replication in prokaryotes and eukaryotes. FEN1 participates in the long patch DNA base excision repair pathway by catalyzing the removal of 5' overhanging flap on branched DNA, and plays an important role in Okazaki fragment maturation, covalently closed circular DNA formation, telomere stability maintenance, stalled replication fork restart and other physiological processes. In addition, abnormal expression of FEN1 is closely related to autoimmune system diseases, chronic inflammation and cancer. For example, high expression of FEN1 is associated with tumor progression and prognosis of various types of tumors such as hepatocellular carcinoma, breast cancer, prostate cancer, testicular cancer, lung cancer and brain cancer. Therefore, accurate measurement of FEN1 activity is crucial for DNA repair-related biological research, cancer diagnosis and treatment.

[0003] Currently, traditional methods for detecting FEN1, such as Western blot, gel electrophoresis, immunohistochemical analysis, enzyme-linked immunosorbent assay (ELISA), etc., have problems such as complicated procedures, long analysis time, qualitative / semi-quantitative results, expensive antibodies and poor specificity, which greatly hinder their wide application. In order to solve these problems, a series of new FEN1 detection methods based on colorimetric method, electrochemiluminescence method and fluorescence detection have been developed in recent years. Among them, fluorescence method has become a research hotspot due to its stability, rapidness, convenience, high sensitivity and other advantages. However, many fluorescence methods for detecting FEN1 require complex procedures to synthesize functional nanomaterials such as graphene oxide, gold nanostar, metal-organic framework and silver nanocluster. Some methods for detecting FEN1 based on antigen-antibody interaction involve expensive antibody proteins and complex procedures, with low sensitivity and specificity. Some methods for detecting FEN1 activity using magnetic separation strategy not only use expensive and complex materials, but also involve separation steps, increasing the difficulty of operation.

[0004] Therefore, how to develop a simple, selective and high sensitivity FEN1 detection method is a technical problem to be solved by those skilled in the art. SUMMARY

[0005] Therefore, the application develops a method for detecting flap endonuclease 1 activity based on double cascade signal amplification, which uses simultaneous specific signal amplification of strand displacement amplification (SDA) and rolling circle amplification (RCA) to produce G4 dimers to light up thioflavin T (ThT), and indicates the content of target FEN1 through the fluorescence signal of ThT, so as to achieve the purpose of sensitive detection.

[0006] In order to solve the above technical problems, the application adopts the following technical solutions:

[0007] The first purpose of the application is to provide a dumbbell probe for detecting flap endonuclease 1 activity or inhibitor screening, which comprises a stem and a loop, the stem is a double-stranded DNA with a 5' overhanging flap branch structure, which is a recognition region of flap endonuclease 1; the loop is a G4 sequence with two repeated ends, and two endonuclease recognition sequences are designed at the two ends of the loop.

[0008] As a preferred technical solution, the nucleotide sequence of the dumbbell probe is shown as SEQ ID NO. 1.

[0009] Another purpose of the application is to provide the application of the dumbbell probe, which is any of the following directions:

[0010] (1) application in detecting flap endonuclease 1 activity;

[0011] (2) application in preparing a product for detecting flap endonuclease 1 activity;

[0012] (3) application in screening flap endonuclease 1 inhibitor / antagonist;

[0013] (4) application in preparing a product for screening flap endonuclease 1 inhibitor / antagonist.

[0014] Another purpose of the application is to provide a method for detecting flap endonuclease 1 activity, comprising the following steps:

[0015] When endonuclease 1 exists in the sample to be tested, the endonuclease 1 specifically recognizes and cuts the 5' overhang of the dumbbell probe, generating a single-stranded DNA with a 3' -OH end and a dumbbell-shaped DNA with a gap, and the two products generated by cutting are respectively initiated to SDA amplification and RCA amplification, both of which generate long-chain DNA containing repeated G4 sequences, which further generates short-chain DNA composed of two tandem G4 sequences under the action of endonuclease, and after incubation, G4 dimer structure is formed, which interacts with dye to obtain enhanced fluorescence signal, and the activity of endonuclease is judged by the intensity of the fluorescence signal.

[0016] As a preferred technical scheme, the method for detecting the activity of endonuclease 1 specifically comprises the following processes:

[0017] (1) The dumbbell probe is added to the sample to be tested, and when endonuclease 1 exists in the sample to be tested, the endonuclease 1 specifically recognizes and cuts the 5' overhang of the dumbbell probe, generating a single-stranded DNA with a 3' -OH end and a dumbbell-shaped DNA with a gap;

[0018] (2) The single-stranded DNA with a 3' -OH end specifically pairs with a linear template, and under the action of DNA polymerase, SDA amplification is started to generate long-chain DNA containing repeated G4 sequences;

[0019] (3) The dumbbell-shaped DNA with a gap forms a complete dumbbell structure under the action of T4 DNA ligase, and is specifically combined with an RCA primer, and under the action of DNA polymerase, RCA amplification is started to generate long-chain DNA containing repeated G4 sequences;

[0020] (4) The long-chain DNA containing repeated G4 sequences generated in steps (2) and (3) generates short-chain DNA composed of two tandem G4 sequences under the action of endonuclease, and after incubation at a certain temperature, G4 dimer is formed, and G4 dimer is combined with thioflavin T to generate a fluorescence signal.

[0021] As a preferred technical scheme, the nucleotide sequence of the linear template in step (2) is as follows:

[0022] CCCAACCCGCCCTACCCCCCAACCCGCCCTACCCCCATAGACTCTTTTTATCGCGTCGAAGGATCCTCAG, SEQ ID NO. 2;

[0023] As a preferred technical scheme, the nucleotide sequence of the RCA primer in step (3) is as follows:

[0024] AAATTTAGCTAAATTTCGGGGGTCTTTTTGAGGTAGT, SEQ ID NO. 3;

[0025] As a preferred technical solution, the nucleotide sequence of the G4 dimer in step (4) is as follows:

[0026] GGGTAGGGCGGGTTGGGGGGTAGGGCGGGTTGGG, SEQ ID NO. 4.

[0027] Still another object of the present application is to provide a reagent for detecting skinase 1 activity, which comprises the dumbbell probe.

[0028] Still another object of the present application is to provide a method for screening skinase 1 inhibitors / antagonists, which detects skinase 1 activity by using the method for detecting skinase 1 activity, and determines whether the sample to be tested is a skinase 1 inhibitor / antagonist by determining the skinase 1 activity.

[0029] Still another object of the present application is to provide a reagent for screening skinase 1 inhibitors / antagonists, which comprises the dumbbell probe.

[0030] Still another object of the present application is to provide a biosensor for detecting skinase 1 activity or screening skinase 1 inhibitors / antagonists, which comprises the dumbbell probe and a fluorescent reporter system.

[0031] Through the above technical solutions, compared with the prior art, the present application has the following beneficial effects:

[0032] (1) The present application uses a double cascade signal amplification method to detect skinase 1 activity. Skinase 1 specifically recognizes and removes the 5' overhang flap in the dumbbell probe, producing a single-stranded DNA with a 3' -OH end and a dumbbell-shaped DNA with a nick. The two products produced by cutting initiate rolling circle amplification and strand displacement amplification reactions, respectively, achieving 100% substrate utilization and no probe waste. The RCA reaction has high sensitivity and strong amplification capacity, and the efficiency of linear RCA can reach 10 5 times. The SDA reaction has mild conditions and can realize the cycle of amplification-cleavage-amplification, with high amplification efficiency. This method is carried out under isothermal and homogeneous conditions, without the need for high-precision thermal cycling and separation steps, and without the need for the preparation of functional nanomaterials, and does not involve biological coupling procedures, which effectively reduces the analysis cost and complexity.

[0033] (2) The method of the present application does not need to synthesize signal probes with fluorescent labels, and uses the fluorescence signal generated by DNA G4 dimer / ThT complex as the output strategy, thereby eliminating the cumbersome chemical labeling and avoiding the inherent photobleaching problem of traditional fluorescent molecules. At the same time, the fluorescence intensity of G4 dimer / ThT is about 9 times that of traditional G4 monomer / ThT. At the same time, compared with the common G4 monomer / ThT system, G4 dimer / ThT exhibits more stable fluorescence emission performance in different concentrations of Na + and K + media.

[0034] (3) The method of the present application has excellent selectivity and ultra-high sensitivity (detection limit of 2.33 x 10 -5 U / μL), compared with the fluorescence nanoprobe method based on DNA-silver nanoclusters (0.4 U / μL, Fluorometric detection of cancer marker FEN1 based on double-flapped dumbbell DNA nanoprobe functionalized with silver nanoclusters, Bingzhi Li) and the nanocomposite material method composed of graphene oxide and dye-labeled DNA (0.015 U / μL, Versatile Types of DNA-Based Nanobiosensors for Specific Detection of Cancer Biomarker FEN1 in Living Cells and Cell-Free Systems, Hao Zhang). The sensitivity of the method is improved by three to four orders of magnitude. And it can be used for screening FEN1 inhibitors to detect intracellular FEN1 activity with single cell sensitivity. For the detection of actual samples, the method is consistent with the detection results of the commercial ELISA kit, and the detection limit is only 1 / 6 of the commercial ELISA kit, fully proving the accuracy of the detection results of the invention and its ability to detect in low-abundance, low-sample actual samples. BRIEF DESCRIPTION OF DRAWINGS

[0035] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or prior art description will be briefly introduced below. Obviously, the drawings in the following description are only embodiments of the present application, and those skilled in the art can obtain other drawings according to the provided drawings without creative labor.

[0036] Figure 1Figure 1. Schematic diagram of the experimental principle of detecting FEN1 activity in skin flaps by the dumbbell probe of Example 1.

[0037] Figure 2 Figure 2. Detection results of Example 2.

[0038] Figure 3 Figure 3. Gel electrophoresis experimental results of Example 3.

[0039] Figure 4 Figure 4. Results of experimental condition optimization of Example 4.

[0040] Figure 5 Figure 5. (A) Response of fluorescence emission spectrum to different concentrations of FEN1; (B) Change of fluorescence intensity with FEN1 concentration in the range of 0 ~ 1 U U / μL; error bars represent the standard deviation of three experiments.

[0041] Figure 6 Figure 6. Specific detection results.

[0042] Figure 7 Figure 7. Cell kinetics analysis results.

[0043] Figure 8 Figure 8. (A) Inhibitory effect of different inhibitors on FEN1; (B) Effect of different concentrations of FEN1-in-1 on the relative activity of FEN1; error bars represent the standard deviation of three experiments.

[0044] Figure 9 Figure 9. (A) Activity determination of FEN1 in different cells; (B) Determination of FEN1 activity produced by different numbers of A549 cells; error bars represent the standard deviation of three experiments.

[0045] Figure 10 Figure 10. (A) Expression levels of FEN1 in A549 cells, HeLa cells and MCF-7 cells measured by the present method (blue column) and ELISA (red column), respectively; (B) Linear relationship between OD value and logarithm of the number of A549 cells; error bars represent the standard deviation of three experiments. DETAILED DESCRIPTION

[0046] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor fall within the scope of protection of the present application.

[0047] Example 1

[0048] Design of dumbbell probe, linear template and RCA primer for detecting FEN1 activity or screening FEN1 inhibitor

[0049] The dumbbell probe comprises a stem and a loop, the stem is double-stranded DNA with 5' overhang flap branch structure as the recognition region of FEN1; the loop is G4 sequence with two repeated ends, and two endonuclease recognition sequences are designed at the two ends of the loop.

[0050] The principle of the above dumbbell probe for detecting FEN1 activity is as follows:

[0051] When FEN1 exists, FEN1 can recognize the 5' overhang flap in the dumbbell probe, and cut off the 5' overhang flap from the dumbbell-shaped DNA substrate to produce a single-stranded DNA (overhang flap) and a dumbbell-shaped DNA with a one-base gap. Then, the adjacent ends are connected by DNA ligase to circularize the dumbbell-shaped DNA. Subsequently, the RCA primer and the linear template are added to respectively pair with the circularized dumbbell-shaped DNA and the cut off overhang flap, and the RCA and SDA processes are simultaneously started under the action of DNA polymerase. In the RCA and SDA products, the black part can be recognized and cleaved by endonuclease, thereby generating a large number of short oligonucleotides (G-quadruplex). The G-quadruplex can fold into a dimer structure and bind with ThT, so that the fluorescence signal can be detected, and the specific process is shown in Figure 1 .

[0052] The nucleotide sequence of the dumbbell probe is 5'-CTGAGGATCCTTCGACGCGATAAAAATTTC GGGGCCATAACTACCTCAAAAAGACCCCCGAAATTTATGCAAGTTCCCCCATAGACTCCCCAACCCGCCCTACCCCCAACCCGCCCTACCCCCATAGACTCGGGAACTTGCATA-3', SEQ ID NO. 1.

[0053] The nucleotide sequence of the linear template is 5'-CCCAACCCGCCCTACCCC

[0054] CCCAACCCGCCCTACCCCCATAGACTCTTTTTATCGCGTCGAAGGATCCTCAG-3', SEQ ID NO. 2.

[0055] The nucleotide sequence of the RCA primer is 5'-AAATTTAGCTAAATTTCGGGGG

[0056] TCTTTTTGAGGTAGT-3', SEQ ID NO. 3.

[0057] Nucleotide sequence of G4 dimer: 5'-GGGTAGGGCGGGTTGGGGGGTAGGGCGGGTTGGG-3', SEQ ID NO. 4.

[0058] Example 2

[0059] A method for detecting flap endonuclease 1 activity, comprising the following processes:

[0060] (1) Preparation of probe: 10 μΜ dumbbell probe was added into buffer (1.5 mM MgCl2+10 mM Tris-HCl (pH 8.0)), incubated at 95 °C for 10 min, and then slowly cooled to room temperature to prepare dumbbell DNA substrate with flap structure.

[0061] (2) Reaction of dumbbell DNA substrate with FEN1: 1 μL dumbbell DNA substrate with flap structure was reacted with FEN1 of certain concentration in 1 × Thermo Pol reaction buffer at 37 °C for 60 min, then 200 U Hi-T4™ DNA Ligase, 1 μL 1 nM ATP and 1 μL 10 mM Tris-HCl were added and reacted at 25 °C for 180 min to form complete dumbbell structure, then 1 μL 10 nM linear template and 1 μL 10 nM RCA primer were added and hybridized at 75 °C for 30 s and at 65 °C for 1 min.

[0062] (3) Then 1.6 U Bst 3.0 DNA Polymerase, 4U Nt.BstNBI and 100 μΜ dNTPs were added in 1 × NEBuffer™ r3.1 and 0.4 × Isothermal Amplification Buffer II Pack and reacted at 61 °C for 60 min to amplify a large amount of G4 dimer, 1 μL 1 nM ThT was added and incubated at room temperature for 60 min, and the reaction solution was obtained, and the fluorescence signal was detected by a fluorescence instrument with excitation wavelength of 425 nm and detection range of 450 nm to 580 nm, and the peak value at 488 nm was recorded for analysis of fluorescence experiment, and the experimental results are shown in Figure 2

[0063] Result analysis: In the presence of FEN1, a strong fluorescence signal was generated at the emission wavelength of 488 nm (Figure 2). Figure 2 ​(red line), but no obvious signal was observed in the control group without FEN1 ( Figure 2 (blue line). These results clearly demonstrate the feasibility of using the proposed dumbbell probe to detect FEN1 activity.

[0064] Example 3

[0065] Gel electrophoresis experiment

[0066] Using 4S GelRed fluorescent dye as a fluorescent indicator, the fragmentation of the dumbbell probe by FEN1 was studied by 14% PAGE. The specific experimental procedure is as follows:

[0067] (1) Gel preparation: 14% polyacrylamide gel was pre-cast and polymerized;

[0068] (2) Sample preparation: Take a PCR tube or microcentrifuge tube, add 10 μL of reaction solution (the reaction solution obtained in step (3) of Example 2), 1 μL of 6× loading buffer and 0.2 μL of 4S GelRed in sequence, gently pipette to mix, or briefly centrifuge to collect to the bottom of the tube;

[0069] (3) Spotting: Use a pipette to draw up all or part of the mixed sample (~11.2 μL) and carefully add it into the sample well of the gel;

[0070] (4) Electrophoresis: Turn on the power and run at a constant voltage of 120V for 45 minutes in 1×TBE buffer.

[0071] (5) Observation: After electrophoresis, observe the DNA bands under a UV gel imaging system.

[0072] Results analysis:

[0073] A: FEN1 cutting verification

[0074] When FEN1 is present (Fig. 3A, lane 2), two bands can be observed generated by FEN1 cleaving the dumbbell-shaped substrate, indicating that FEN1 successfully recognized the branched structure of the dumbbell-shaped probe and cut off the 5' branch. When FEN1 is absent ( Figure 3 A, lane 1) shows only the uncut dumbbell substrate stripe.

[0075] B: Verification of cyclization and amplification reactions

[0076] When FEN1 exists ( Figure 3 Lane B, lane 1, still showed a bright band after the addition of Hi-T4 DNA ligase and treatment with Exo I and Exo III, indicating that a complete dumbbell-shaped structure had been formed. In the absence of FEN1 (Figure 3 Lane B (lane 2), after the addition of Hi-T4 DNA ligase and treatment with Exo I and Exo III, no bands were observed in lane 2, indicating that the dumbbell-shaped substrate was completely cleaved. When FEN1 is present ( Figure 3 In lane B (lane 3), large bright bands appeared after the addition of Bst 3.0 DNA polymerase, indicating that the amplification reaction was complete.

[0077] Example 4

[0078] Optimization of experimental conditions

[0079] To obtain the best detection performance, we evaluated the effects of Isothermal Amplification Buffer II Pack concentration, Bst 3.0 DNA polymerase concentration, Nt.BstNBI concentration and reaction temperature on detection performance by measuring the change in F / F0 (F is the fluorescence intensity measured in the presence of FEN1, and F0 is the fluorescence intensity in the absence of FEN1) (Figure 4).

[0080] Isothermal Amplification Buffer II Pack Concentration Optimization:

[0081] like Figure 4 As shown in Figure A, as the concentration of Isothermal Amplification Buffer II Pack increases from 0.2 × to 0.4 ×, the F / F0 ratio also increases, and decreases when the concentration of Isothermal Amplification Buffer II Pack exceeds 0.4 ×. This may be because excessively high concentrations of Isothermal Amplification Buffer II Pack inhibit the reaction activity of Bst 3.0 DNA polymerase. Therefore, the optimal concentration of Isothermal Amplification Buffer II Pack is 0.4 ×.

[0082] Optimization of Nt.BstNBI usage:

[0083] like Figure 4 As shown in B, as the amount of Nt.BstNBI increased from 2 U / μL to 4 U / μL, the F / F0 also increased. However, when the amount exceeded 4 U, the F / F0 decreased slightly. This may be because when the concentration of Nt.BstNBI is too high, the cleavage activity is too high, resulting in incomplete amplification of the product. Therefore, the optimal amount of Nt.BstNBI is 4 U / μL.

[0084] Optimization of Bst 3.0 DNA polymerase dosage:

[0085] like Figure 4 As shown in C, although the absorbance peak intensity of the FEN1 sample gradually increased with the increase of Bst 3.0 DNA polymerase dosage, it also led to non-specific amplification during the RCA process, resulting in an increase in background signal. Therefore, F / F0 showed a trend of first increasing and then decreasing, reaching its maximum value at 0.32 U / μL. Thus, the optimal dosage of Bst 3.0 DNA polymerase is 0.32 U / μL.

[0086] Optimization of reaction temperature:

[0087] like Figure 4 As shown in D, the F / F0 ratio decreases significantly when the temperature is below 50℃ or above 65℃. This is because the specificity of Bst 3.0 DNA polymerase is not strong enough when the temperature is below 60℃, and the enzyme activity is affected when the temperature is above 65℃. The F / F0 reaches its maximum value at 61℃, so the optimal reaction temperature is 61℃.

[0088] Example 5

[0089] Sensitivity testing:

[0090] Under the optimal experimental conditions determined in Example 3, we further verified the detection sensitivity, and the experimental results are as follows: Figure 5 As shown.

[0091] Results analysis: The fluorescence signal monotonically increased with FEN1 concentration in the range of 0 ~ 3.2 U / μL. The linear relationship between fluorescence signal (F) and FEN1 concentration (U / μL) was F = 1463.68 + 418.68 lgC (R 2 = 0.992). Based on the 3σ method, the detection limit for FEN1 is calculated to be 2.33 × 10⁻⁶. -5 U / μL.

[0092] Compared with fluorescent nanoprobes based on DNA-silver nanoclusters (0.4 U / μL) and nanocomposites composed of graphene oxide and dye-labeled DNA (0.015 U / μL), this method improves sensitivity by three to four orders of magnitude. The high sensitivity of this method may be attributed to two factors: (1) high amplification efficiency induced by dual-signal amplification; and (2) higher binding efficiency of G4 dimer to ThT, resulting in a higher fluorescence signal that can be detected.

[0093] Specific detection:

[0094] Other DNA repair enzymes, such as human alkyladenine DNA glycosylation enzyme (hAAG), uracil-DNA glycosylation enzyme (UDG), formamide-purine DNA glycosylation enzyme (FPG), and human exonuclease I (Exo I), were selected as interfering enzymes for specificity experiments. The experimental results are as follows: Figure 6 As shown.

[0095] Results analysis: FEN1 produces a high fluorescence signal ( Figure 6 (Black column). In contrast, hAAG ( Figure 6 (red pillar), UDG ( Figure 6 (green pillar), FPG ( Figure 6 (blue column), Exo I ( Figure 6 The light blue column (the control) produced only negligible fluorescence signal. Furthermore, the control results were compared with the experimental results using a P-test, and the P-value was less than 0.001, indicating a significant difference. These results demonstrate the high selectivity of the proposed biosensor for FEN1.

[0096] Dynamics Experiment

[0097] 15.36 fM (0.64 U) FEN1 was incubated with dumbbell probes of different concentrations at 37°C for 5 minutes. Fluorescence signal values ​​were recorded at different time points to construct enzyme kinetic curves. The maximum reaction rate (Vmax) and Michaelis constant (Km) of the enzyme were then calculated. The experimental results are as follows: Figure 7 As shown.

[0098] Results analysis: such as Figure 7 As shown, the initial velocity of FEN1 increases with increasing dumbbell probe concentration. The experimental data are fitted to the Michaelis-Menten equation:

[0099] V=V max [S] / (Km+[S])

[0100] Where V max The initial velocity is given by [S], where [S] is the dumbbell probe concentration, and Km is the Michaelis-Menten constant. The initial velocity increases with increasing substrate concentration from 0 to 600 nM. The calculated Vmax value is 125 min. -1 The Km value is 46.8 nM, indicating that the sensor can be used for dynamic analysis of FEN1.

[0101] Example 6

[0102] Inhibitor experiment

[0103] To verify the application capability of the constructed biosensor in FEN1 inhibitor screening, an enzyme activity inhibition experiment was conducted. The experiment was divided into three groups: a positive control group, an inhibitor experimental group, and a cell extract experimental group. The experimental procedures for each group are as follows:

[0104] Positive Control: The commercially available FEN1 enzyme was incubated with the dumbbell probe in the sensor for fluorescence assay only;

[0105] Inhibitor Test Groups: Commercially available FEN1 enzyme was pre-incubated with two inhibitors (FEN1-IN-1 or ATA) for 30 minutes, and then a dumbbell probe was added for fluorescence experiments. Cell Lysate Groups: Whole-cell extracts of A549 cancer cells were pre-incubated with two inhibitors (FEN1-IN-1 or ATA) for 30 minutes, and then a dumbbell probe was added for fluorescence experiments. The experimental results are as follows: Figure 8 As shown.

[0106] Results analysis: such as Figure 8 As shown in A, a high fluorescence signal can be detected in the presence of only FEN1 or A549 cell extracts. Figure 8 (A) Red and orange columns: When commercially available FEN1 and its inhibitor FEN1-in-1 or ATA were incubated, only a weak fluorescence signal was detected during fluorescence detection. Figure 8 (A yellow column, green column) When whole-cell extracts of A549 cells were incubated with FEN1-in-1 or ATA and fluorescence detection was performed, a weak fluorescence signal was also detected. Figure 8 A blue column, light blue column). This indicates that ATA and FEN1-in-1 strongly inhibit FEN1 activity, thereby blocking the entire reaction chain by blocking cleavage-induced linkages. In contrast, strong fluorescence was observed in the absence of inhibitors. The relative activity of FEN1 decreased linearly with the concentration of FEN1-in-1 ( Figure 8 B). The IC50 value was 1.78 pM, indicating that this method can be used to screen FEN1 inhibitors.

[0107] Cell experiments

[0108] Lung cancer cells (A549), breast cancer cells (MCF-7), cervical cancer cells (HeLa), liver cancer cells (HepG2), and normal human epithelial breast cells (MCF-10A) were cultured in a 37℃ incubator. When the cells covered approximately 90% of the culture flask area, they were digested, counted, and the cell pellet was washed with 3 ml of PBS / Phosphatase Inhibitors. The supernatant was removed, and the cell pellet was placed on ice. The cell pellet was resuspended in 300 μl of Complete Lysis Buffer and gently pipetted. The sample was placed on a horizontal mixer at 150 rpm and incubated on ice for 10–30 min. Vortexing was performed at the highest setting for 30 s. The sample was centrifuged at 14,000 × g at 4℃ for 20 min, and the supernatant was extracted as the complete cell extract. The activity of endogenous FEN1 was measured using the above-mentioned biosensor. The experimental results are as follows: Figure 9 As shown.

[0109] Results analysis: Significant fluorescence signals were detected in MCF-7 cells, HeLa cells, A549 cells, and HepG2 cells due to FEN1 overexpression. Figure 9 A); a weak fluorescent signal was also detected in the whole-cell extract of MCF-10A, because FEN1 is expressed in small amounts in normal cells, which is consistent with previous reports.

[0110] Furthermore, using A549 cells as a model, we conducted a linear experiment on the concentration of FEN1 in the whole-cell extract. As the number of A549 cells increased from 1 to 1000, the fluorescence concentration increased in a concentration-dependent manner. Figure 9 (B) The fluorescence of FEN1 showed a linear correlation with the number of A549 cells in the range of 1-1000 cells, with the regression equation being F = 106.5X + 667.5. Where F represents the fluorescence signal value, X is the number of A549 cells, and R... 2 The value was 0.994, and the detection limit was calculated to be 0.3 cells using the 3σ method. These results clearly demonstrate that our system can accurately and sensitively quantify FEN1 activity in complex real-world samples, even at the single-cell level, showing immense potential for clinical analysis.

[0111] Finally, we compared the performance of this method with that of the standard method (ELISA) in detecting actual samples. We measured the FEN1 activity in whole-cell extracts using both our developed method and a commercially available ELISA kit. We measured the signal values ​​produced by nuclear extracts from 1000 lung cancer cells (A549), breast cancer cells (MCF-7), and cervical cancer cells (HeLa), and calculated the FEN1 content in each cell type measured by both methods. The comparison results are shown below. Figure 10 As shown in Figure A, the expression levels of FEN1 in three different cells measured by this biosensor method (blue column) are almost consistent with the results detected by ELISA (red column), indicating that this biosensor method is highly reliable for the quantitative detection of FEN1 activity in different cancer cells.

[0112] We further used ELISA to detect the optical density (OD) produced by different numbers of A549 cells. Figure 10 As shown in Figure B, as the number of A549 cells increases from 1 cell to 1000 cells, the OD value also increases linearly with the number of A549 cells. The regression equation is Y = 0.15 N + 0.64 (R²). 2 = 0.950), where Y is the measured fluorescence intensity, N is the number of A459 cells, and the detection limit is calculated to be 1.68 cells according to the 3σ method.

[0113] In summary, we have developed a novel fluorescent biosensor for the determination of FEN1 activity. This biosensor employs a dual-signal amplification strategy, enabling simultaneous specific amplification of SDA and RCA to generate G-quadruplex dimers that illuminate ThT. This method is performed under isothermal and homogeneous conditions, eliminating the need for high-precision thermal cycling and separation steps, as well as the preparation of functional nanomaterials and bioconjugation procedures, effectively reducing analytical costs and complexity. Furthermore, this method eliminates the need for synthesizing fluorescently labeled signal probes, innovatively utilizing the fluorescence-enhancing system G4 dimer / ThT as the detection signal, thus eliminating the high background caused by non-specific dyes (such as SYBR Green I and SYBR Gold). Moreover, this method exhibits excellent selectivity and ultra-high sensitivity, with a detection limit of 2.33 × 10⁻⁶. -5 It has a U / μL capacity and can be used to screen FEN1 inhibitors and measure intracellular FEN1 activity with single-cell sensitivity, which has great application value in clinical diagnosis and molecular biology research.

[0114] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0115] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A dumbbell probe for detecting endopeptidase 1 activity in skin flaps or for screening inhibitory drugs, characterized in that, The dumbbell probe comprises a stem and a loop. The stem is a double-stranded DNA with a 5' drooping valve branch structure, serving as the recognition region for flap endonuclease 1. The loop consists of a G4 sequence with repeats at both ends, and two endonuclease recognition sequences are designed at both ends of the loop.

2. The dumbbell probe for detecting endonuclease 1 activity in skin flaps or for screening inhibitory drugs according to claim 1, characterized in that, The nucleotide sequence of the dumbbell probe is shown in SEQ ID NO.

1.

3. The application of the dumbbell probe according to claim 1 or 2, characterized in that, The application is in any of the following directions: (1) Application in detecting endopeptidase 1 activity in skin flaps; (2) Application in the preparation of products for detecting the activity of endopeptidase 1 in skin flaps; (3) Application in screening flap endopeptidase 1 inhibitors / antagonists; (4) Application in the preparation of screening products for endopeptidase 1 inhibitors / antagonists in skin flaps.

4. A method for detecting the activity of endopeptidase 1 in skin flaps, characterized in that, Includes the following steps: When flap endonuclease 1 is present in the sample to be tested, flap endonuclease 1 specifically recognizes and removes the 5' dangling flap in any of the dumbbell probes described in claims 1-2, producing a single-stranded DNA with a 3'-OH end and a dumbbell-shaped DNA with a notch. The two products generated by the cleavage trigger SDA amplification and RCA amplification, respectively. Both amplification reactions produce long-chain DNA containing repeating G4 sequences. Under the action of the endonuclease, short-chain DNA composed of two tandem G4 sequences is further generated. After incubation, a G4 dimer structure is formed, which interacts with the dye to obtain an enhanced fluorescence signal. The activity of the endonuclease is judged by the intensity of the fluorescence signal.

5. The method for detecting endopeptidase 1 activity in skin flaps according to claim 4, characterized in that, Specifically, the process includes the following steps: (1) Add the dumbbell probe according to any one of claims 1-2 to the sample to be tested. When the flap endonuclease 1 is present in the sample to be tested, the flap endonuclease 1 specifically recognizes and removes the 5' dangling flap in the dumbbell probe, producing a single-stranded DNA with a 3' -OH end and a dumbbell-shaped DNA with a notch. (2) Single-stranded DNA with a 3'-OH end specifically pairs complementary with a linear template, and under the action of DNA polymerase, SDA amplification is initiated, producing long-stranded DNA containing repeating G4 sequences; (3) After the dumbbell-shaped DNA with a notch forms a complete dumbbell structure under the action of T4 DNA ligase, it specifically binds to the RCA primer and initiates RCA amplification under the action of DNA polymerase, producing long-chain DNA containing repeating G4 sequences. (4) The long-chain DNA containing repeating G4 sequences generated in steps (2) and (3) is converted into short-chain DNA composed of two tandem G4 sequences under the action of endonuclease. After incubation at a certain temperature, G4 dimers are formed. The G4 dimers bind to thioflavin T and generate a fluorescent signal.

6. The method for detecting endopeptidase 1 activity in skin flaps according to claim 5, characterized in that, The nucleotide sequence of the linear template mentioned in step (2) is as follows: CCCAACCCGCCCTACCCCCCAACCCGCCCTACCCCCATAGACTCTTTTTAT CGCGTCGAAGGATCCTCAG, SEQ ID NO.2; The nucleotide sequence of the RCA primer described in step (3) is as follows: AAATTTAGCTAAATTTCGGGGGTCTTTTTGAGGTAGT, SEQ ID NO.3; The nucleotide sequence of the G4 dimer described in step (4) is as follows: GGGTAGGGCGGGTTGGGGGGTAGGGCGGGTTGGG, SEQ ID NO.

4.

7. A reagent for detecting the activity of endopeptidase 1 in skin flaps, characterized in that, The reagent includes the dumbbell probe as described in any one of claims 1-2.

8. A method for screening flap endonuclease 1 inhibitors / antagonists, characterized in that, The activity of endopeptidase 1 in the skin flap is detected by any of the methods described in claims 4-6. The activity of endopeptidase 1 in the skin flap is then determined to determine whether the sample to be tested is an inhibitor / antagonist of endopeptidase 1 in the skin flap.

9. A reagent for screening flap endonuclease 1 inhibitors / antagonists, characterized in that, The reagent includes the dumbbell probe as described in any one of claims 1-2.

10. A biosensor for detecting or screening flap endonuclease 1 activity, characterized in that, The biosensor includes the dumbbell probe as described in any one of claims 1-2, and further includes a fluorescence reporting system.

Images