DsRNA for targeted regulation of freshwater shrimp PKA-R1 gene as well as acquisition method and application of dsRNA

Abstract

The invention discloses dsRNA for targeted regulation of a freshwater shrimp PKA-R1 gene and an obtaining method and application of the dsRNA, and belongs to the technical field of biology.Firstly, the freshwater shrimp PKA-R1 gene is obtained, then a gene segment with the sequence of SEQ ID NO: 3 is obtained through RNA interference and other technologies, dsPKA-R1 is synthesized through the gene segment, and after the synthesized dsPKA-R1 is injected into the pericardial cavity of a freshwater shrimp, it is proved that the dsPKA-R1 can slow down growth of the freshwater shrimp through growth parameter comparison.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to dsRNA for targeted regulation of the PKA-R1 gene of Macrobrachium Nipponense and its obtaining method and application. BACKGROUND

[0002] Macrobrachium Nipponense is an important freshwater economic shrimp, widely distributed in major freshwater rivers and lakes, with the characteristics of short reproductive cycle, fast growth rate, high economic benefit, delicious meat, high nutritional value and so on. However, long-term artificial propagation and non-systematic selection have led to a decrease in genetic diversity, and the breeding efficiency needs to be improved. Therefore, it is of great theoretical and practical significance to study the growth traits of Macrobrachium Nipponense.

[0003] The body weight and body length of Macrobrachium Nipponense directly determine the production efficiency and market value. Larger body weight and longer body length usually result in higher market demand and price, so studying growth traits can help optimize production management and improve production efficiency. Especially for fast-growing Macrobrachium Nipponense, they can reach the required size in a relatively short time, thereby significantly increasing the yield per unit area. By studying the change rule of body weight and body length, breeders can select individuals with faster growth for breeding, further improving the production efficiency of the entire breeding population.

[0004] RNAi (RNA interference, RNAi) technology is to use double-stranded RNA (dsRNA) to form a large number of small RNA fragments under the action of Dicer enzyme, ultimately causing the degradation of the mRNA of the targeted gene, resulting in the inability of the cell or individual to synthesize the corresponding amino acid, causing the individual to exhibit a lack of function, and achieving the purpose of interference knockout. Previous studies have shown that RNAi on the molting hormone gene of Macrobrachium Nipponense can effectively accelerate the molting and promote growth of Macrobrachium Nipponense (Qiao et al, 2018). Unlike promoting growth, CN112852846 A discloses using RNAi to interfere with the Cathepsin L gene of Macrobrachium Nipponense to slow down the development speed of the ovary of Macrobrachium Nipponense; however, this technology is not suitable for male Macrobrachium Nipponense. Moreover, the growth and development of Macrobrachium Nipponense is regulated by a multi-gene system, and if the major gene is interfered and regulated, the growth and development of Macrobrachium Nipponense will be excessively inhibited, leading to growth arrest or even death of Macrobrachium Nipponense, which is extremely detrimental to production. Therefore, finding non-major genes that regulate the growth and development of Macrobrachium Nipponense and establishing a technology for moderately regulating the growth speed of Macrobrachium Nipponense are of great significance to solve the problem of excessively fast growth and development of Macrobrachium Nipponense. SUMMARY

[0005] The technical problem solved by the present application is that the present application provides dsRNA for targeted regulation of the PKA-R1 gene of Macrobrachium Nipponense and its obtaining method and application, and provides a technology suitable for regulating the growth speed of Macrobrachium Nipponense to slow down the growth speed of Macrobrachium Nipponense, in order to solve the technical problems of fast growth and development of Macrobrachium Nipponense in the prior art.

[0006] Technical solution: dsRNA for targeted regulation of the PKA-R1 gene of Macrobrachium Nipponense, the nucleotide sequence of the dsRNA for targeted regulation of the PKA-R1 gene of Macrobrachium Nipponense is shown in SEQ ID NO: 4.

[0007] A primer for preparing the dsRNA for targeted regulation of the PKA-R1 gene of Macrobrachium Nipponense, the sequence of the upstream primer is shown in SEQ ID NO: 5, and the sequence of the downstream primer is shown in SEQ ID NO: 6.

[0008] As preferred, the nucleotide sequence of the PKA-R1 gene of Macrobrachium Nipponense is shown in SEQ ID NO: 1.

[0009] As preferred, the amino acid sequence of the PKA-R1 gene of Macrobrachium Nipponense is shown in SEQ ID NO: 2.

[0010] The method for obtaining the dsRNA for targeted regulation of the PKA-R1 gene of Macrobrachium Nipponense comprises the following steps: Step one: after analyzing the amino acid sequence of the PKA-R1 gene of Macrobrachium Nipponense, the specific region of the PKA-R1 gene is selected; Step two, design interference primer pair for the specific coding gene: upstream primer SEQ ID NO: 5 and downstream primer SEQ ID NO: 6; Step three: using the primers obtained in step two, and using total cDNA of Macrobrachium Nipponense as a template, the DNA fragment shown in SEQ ID NO: 3 is obtained by PCR amplification; Step four: using the DNA fragment shown in SEQ ID NO: 3 as a template, the dsRNA for targeted regulation of the PKA-R1 gene of Macrobrachium Nipponense is synthesized.

[0011] The application also discloses the application of the above-mentioned dsRNA for targeted regulation of the PKA-R1 gene of Macrobrachium Nipponense in a product for slowing down the growth speed of Macrobrachium Nipponense.

[0012] As preferred, the product for slowing down the growth speed of Macrobrachium Nipponense is injected into the pericardial cavity of Macrobrachium Nipponense, and the injection concentration of the dsRNA for targeted regulation of the PKA-R1 gene of Macrobrachium Nipponense is 4 μg / g.

[0013] As preferred, the Macrobrachium Nipponense is female or male.

[0014] The application of the above-mentioned dsRNA for targeted regulation of the PKA-R1 gene of Macrobrachium Nipponense, the above-mentioned primer or the above-mentioned PKA-R1 gene of Macrobrachium Nipponense in preparing a product for slowing down the growth speed of Macrobrachium Nipponense.

[0015] Explanation of Principle: This invention provides a dsRNA that targets and regulates the PKA-R1 gene in freshwater shrimp. This dsRNA can silence the PKA-R1 gene in freshwater shrimp, thereby slowing down the growth rate of the shrimp. Silencing the PKA-R1 gene refers to degrading the mRNA of the PKA-R1 gene, achieving a silencing efficiency between 79.19% and 82.39%. The freshwater shrimp PKA-R1 gene encodes protein kinase A regulatory subunit 1 (PKA-R1). The nucleotide sequence of the PKA-R1 gene is shown in SEQ ID NO: 1, and the corresponding amino acid sequence is shown in SEQ ID NO: 2. The dsRNA targeting and regulating the freshwater shrimp PKA-R1 gene is obtained by transcription using a fragment with the nucleotide sequence shown in SEQ ID NO: 3 as a template. The nucleotide sequence of the dsRNA targeting and regulating the freshwater shrimp PKA-R1 gene is shown in SEQ ID NO: 3. NO:4; a product for slowing down the growth of freshwater shrimp, the product containing dsRNA that targets and regulates the freshwater shrimp PKA-R1 gene, which can be used to silence the freshwater shrimp PKA-R1 gene, thereby slowing down the growth rate of freshwater shrimp.

[0016] Beneficial effects: Injection of dsPKA-R1 synthesized using SEQ ID NO: 3 as a template can effectively reduce the expression of PKA-R1 gene mRNA in freshwater shrimp, slowing down the growth and development rate of freshwater shrimp; among them, the average weight gain rate of the control group on day 21 was 19.32%, while the average weight gain rate of the dsPKA-R1 group was 9.63%. p <0.05); Exogenous injection of dsPKA-R1 can effectively slow down the growth and development of freshwater shrimp without excessively inhibiting their growth. It can be used to regulate the rapid growth and development of freshwater shrimp during the peak breeding season. It is of great significance for solving problems in the freshwater shrimp industry caused by excessively rapid growth and development, such as multiple generations living together, miniaturization, excessively high stocking density, significantly increased risk of hypoxia, and increased feed consumption. Attached Figure Description

[0017] Figure 1 This is a graph showing the PKA-R1 gene silencing efficiency of this application. The horizontal axis represents day 1, day 4, and day 7 after injection (n=4). **** represents... p <0.0001, the control group used the green fluorescent protein (GFP) gene as a reporter gene, and the control group was injected with the same dose of dsGFP; Figure 2The average weight change graph of the application is the average weight change graph of the freshwater shrimp after injection of dsGFP and dsPKA-R1 at different sampling time points; the abscissa represents the 0th day, the 7th day after injection, the 14th day, the 21st day, the 28th day, the 35th day and the 42nd day, and **** represents p <0.0001, * represents p <0.05. DETAILED DESCRIPTION

[0018] The specific embodiments of the application illustrate the technical solutions of the application, which aims to help the skilled in the art better understand and implement. Unless otherwise specified, the chemical reagents and experimental materials used in the examples can be obtained through commercial channels.

[0019] The nucleotide sequence of the dsRNA for targeting and regulating the PKA-R1 gene of the freshwater shrimp is shown in SEQ ID NO: 4; the primer for preparing the dsRNA for targeting and regulating the PKA-R1 gene of the freshwater shrimp, the sequence of the upstream primer is shown in SEQ ID NO: 5, the sequence of the downstream primer is shown in SEQ ID NO: 6, the nucleotide sequence of the PKA-R1 gene of the freshwater shrimp is shown in SEQ ID NO: 1, the amino acid sequence of the PKA-R1 gene of the freshwater shrimp is shown in SEQ ID NO: 2, and the method for obtaining the dsRNA for targeting and regulating the PKA-R1 gene of the freshwater shrimp comprises the following steps: Step one: after analyzing the amino acid sequence of the freshwater shrimp PKA-R1, the specific region of PKA-R1 is selected; Step two, design interference primer pair for specific coding genes: upstream primer SEQ ID NO: 5 and downstream primer SEQ ID NO: 6; Step three: using the primer obtained in step two, using total cDNA of the freshwater shrimp as a template for PCR amplification to obtain the DNA fragment shown in SEQ ID NO: 3; Step four: using the DNA fragment shown in SEQ ID NO: 3 as a template, synthesize the dsRNA for targeting and regulating the PKA-R1 gene of the freshwater shrimp.

[0020] The application of the dsRNA for targeting and regulating the PKA-R1 gene of the freshwater shrimp in the product for slowing down the growth rate of the freshwater shrimp, the freshwater shrimp is female or male, the product for slowing down the growth rate of the freshwater shrimp is injected into the pericardial cavity of the freshwater shrimp, and the injection concentration of the dsRNA for targeting and regulating the PKA-R1 gene of the freshwater shrimp is 4 μg / g.

[0021] SEQ ID NO: 1 SEQ ID NO: 2 SEQ ID NO: 3 ACGTGGAGAGGTACCACCAGTCGGTGAAGTCCCTATCGCTTCACGGGTGGAGACTGTCAAGTATCTCCTCCGAGAGCGAGGGTTTTCGCAGAAAGCAGCAACTCAGATGGCAGTGAAGGGGTACAGGGCTGCTCTAGCCTCAGTCTTACGAATGAAAGGAGTGGACATATCGTCTTCATGGGAGTTGGCCATGCTGATGAGGAGCTTTGAACAGTCATGCCCACCAAAGGAGCTAAAAGCCCCAGATTGGGATCTGACCAAGGTTGTTCCTAAGGATTACAAAACCATGGCTGCCCTTCAGAAAGCCATTGGTAAAAATGTGTTGTTCGCCCACTTGGATGAGAATGAACGGTCTGACATCTTTGATGCCATGTTCCCCGTGAATGCACTCCCAGGAGAAGTGATCATCCAACAGGGAGACGAAGGAGATAATTTCTACATCATAGATCAAGGAGAAGTGGAGATTTTTGTCAACGGTGAACATGTGACAAGCATTAGTGATGGTGGAAGCTTTGGTGAGCTGGCACTCATTTATGGAACACCAAGGCAAGCTACAGTCAAGGCCAAGACAGACACCAAACTCTGGGG SEQ ID NO: 4 ACGUGGAGAGGUACCACCAGUCGGUGAAGUCCCUAUCGCUUCACGGGUGGAGACUGUCAAGUAUCUCCUCCGAGAGCGAGGGUUUUCGCAGAAAGCAGCAACUCAGAUGGCAGUGAAGGGGUACAGGGCUGCUCUAGCCUCAGUCUUACGAAUGAAAGGAGUGGACAUAUCGUCUUCAUGGGAGUUGGCCAUGCUGAUGAGGAGCUUUGAACAGUCAUGCCCACCAAAGGAGCUAAAAGCCCCAGAUUGGGAUCUGACCAAGGUUGUUCCUAAGGAUUACAAAACCAUGGCUGCCCUUCAGAAAGCCAUUGGUAAAAAUGUGUUGUUCGCCCACUUGGAUGAGAAUGAACGGUCUGACAUCUUUGAUGCCAUGUUCCCCGUGAAUGCACUCCCAGGAGAAGUGAUCAUCCAACAGGGAGACGAAGGAGAUAAUUUCUACAUCAUAGAUCAAGGAGAAGUGGAGAUUUUUGUCAACGGUGAACAUGUGACAAGCAUUAGUGAUGGUGGAAGCUUUGGUGAGCUGGCACUCAUUUAUGGAACACCAAGGCAAGCUACAGUCAAGGCCAAGACAGACACCAAACUCUGGGG SEQ ID NO: 5 TAATACGACTCACTATAGGGACGTGGAGAGGTACCACCAG SEQ ID NO: 6 TAATACGACTCACTATAGGGCCCCAGAGTTTGGTGTCTGT SEQ ID NO: 7 TAATACGACTCACTATAGGG.

[0022] Example 1, Acquisition of Freshwater Shrimp PKA-R1 Gene Fragment and dsRNA Thereof: (1) Acquisition of Freshwater Shrimp PKA-R1 Gene Full-length Sequence: Protein Kinase A Regulatory subunit 1 (PKA-R1) belongs to the PRKAR family. The cAMP signaling pathway is a core component of the intracellular second messenger mechanism, mainly mediating the response of cells to external signals such as hormones, neurotransmitters, light, etc. Its main functions include regulating gene expression, metabolism, heart rate, nerve conduction, cell growth and differentiation, etc. When the intracellular cAMP concentration increases, cAMP binds to the regulatory subunit, causing the regulatory subunit to separate from the catalytic subunit, thereby activating the catalytic subunit. Activated PKA can regulate various functions of cells such as metabolism, gene expression, cell division, etc. by phosphorylating other proteins.

[0023] Based on the transcriptome of Dendrobaena and GWAS analysis, the full-length PKA-R1 gene was screened and the sequence is shown as SEQ ID NO: 1.

[0024] (2) Acquisition of Dendrobaena PKA-R1 gene fragment and its dsRNA Based on the nucleotide sequence of Dendrobaena PKA-R1 gene SEQ ID NO: 1, the specific primer pair (SEQ ID NO: 5 / SEQ ID NO: 6) for RNA interference was designed in the open reading frame thereof using the NCBI online dsRNA primer design software (https: / / www.flyrnai.org / cgi-bin / RNAi_find_primers.pl). The T7 promoter sequence TAATACGACTCACTATAGGG (SEQ ID NO: 7) was added before the primer. The PCR product (the sequence is shown as SEQ ID NO: 3) was obtained by PCR amplification using the upstream primer SEQ ID NO: 5 and the downstream primer SEQ ID NO: 6 containing the T7 promoter. After purification of the PCR product by a PCR product purification kit, according to the manufacturer's instructions, dsPKA-R1 (SEQ ID NO: 4) was synthesized by in vitro transcription using Transcript AidTM T7 High Yield Transcription kit (Fermentas, Inc., USA). Then the purity and integrity of dsPKA-R1 were detected by 1.2% agarose gel electrophoresis, and the concentration of dsPKA-R1 was measured by ultraviolet spectrophotometer (Eppendorf, Hamburg, Germany) at 260 nm. Then it was kept at -80°C for standby.

[0025] Example 2, injection of dsPKA-R1 synthesized by PKA-R1 gene fragment inhibits the growth of Dendrobaena: (1) Injection of dsPKA-R1 of PKA-R1 gene: A number of juvenile freshwater shrimps were randomly selected from the breeding ponds, and the largest and smallest individuals were eliminated to ensure uniform size of the test population.

[0026] Gene silencing efficiency test: 30 males and 30 females were randomly selected, and a control (dsGFP) group and a dsPKA-R1 experimental group were set up, with 10 males and 10 females in each group, 3 parallel repeats (n=20), and an injection dose of 4 μg / g. The in vitro synthesized dsRNA was injected into the pericardial cavity of the freshwater shrimps using a microsyringe. Before injection, the shrimps were temporarily raised in a glass tank for three days, and the breeding environment (water temperature 27±1℃) was maintained. Fresh snails were fed to the shrimps twice a day.

[0027] Functional verification test: 200 males and 200 females were randomly selected, and a control group injected with control (dsRNA of green fluorescent protein (GFP) gene) and a dsPKA-R1 experimental group were set up, with 100 shrimps in each group, 3 parallel repeats (n=33). The in vitro synthesized dsRNA was injected into the pericardial cavity of the freshwater shrimps using a microsyringe, with an injection dose of 4 μg / g, and injections were performed every 7 days. Before injection, the shrimps were temporarily raised in a glass tank for three days, and the breeding environment (water temperature 27±1℃) was maintained. Fresh snails were fed to the shrimps twice a day. The weight of each shrimp was measured before the experiment.

[0028] (2) Detection of PKA-R1 gene silencing efficiency On the 1st, 4th, and 7th days after injection, 4 shrimps were randomly collected from each group, and the muscles of the shrimps were dissected. Total RNA was extracted using RNAiso Plus (TaKaRa, Japan) reagent, and cDNA was reverse transcribed using Primer ScriptII1st Strand cDNA Synthesis reverse transcription kit (Bio-Rad) and M-MLV Kit (TaKaRa, Japan). The relative expression of PKA-R1 was detected using Real Time PCR with the template cDNA, and the reference gene was EIF (eukaryotic translation initiation factor 5A), which was used to calculate the silencing efficiency of the target gene (interference efficiency = (1-experimental group target gene expression / control group target gene expression) x 100%).

[0029] The results showed that the silencing efficiency of the dsPKA-R1 group at several time points after injection was between 79.19% and 82.39%, which was significantly different from the control group (P<0.05). p<0.05). The interference efficiency results show that dsPKA-R1 can significantly induce the degradation of PKA-R1 gene mRNA, resulting in the shrimp's inability to synthesize the corresponding amino acids, thus achieving the purpose of interference knockout.

[0030] (3) Changes in the average weight gain rate of freshwater shrimp after injection of dsGFP and dsPKA-R1 According to the average weight gain rate (WGR) = W n+1 -W n / W n χ100%, calculate the average weight gain rate of shrimp in the dsGFP and dsPKA-R1 groups.

[0031] Among them, the average weight gain rate on day 7 was 17.33% in the control group and 8.88% in the dsPKA-R1 group. p <0.05. On day 14, the average weight gain rate in the control group was 11.49%, and the average weight gain rate in the dsPKA-R1 group was 0.89%. p <0.05. On day 21, the average weight gain rate in the control group was 19.32%, and the average weight gain rate in the dsPKA-R1 group was 9.63%. p <0.05). On day 28, the average weight gain rate in the control group was 6.40%, and the average weight gain rate in the dsPKA-R1 group was 0.91% (p<0.05). On day 35, the average weight gain rate in the control group was 8.48%, and the average weight gain rate in the dsPKA-R1 group was 0.60% (p<0.05). On day 42, the average weight gain rate in the control group was 2.87%, and the average weight gain rate in the dsPKA-R1 group was -0.20% (p<0.05).

[0032] The above interference results show that, compared with the control group, exogenous injection of dsPKA-R1 PKA-R1 can effectively slow down the growth and development of freshwater shrimp. The dsPKA-R1 PKA-R1 interference gene fragment in freshwater shrimp can be applied to regulate the rapid growth and development of freshwater shrimp during the peak breeding season. This is of great significance for solving problems in the freshwater shrimp industry caused by excessively rapid growth and development, such as multiple generations living together, miniaturization, excessively high stocking density, significantly increased risk of hypoxia, and increased feed consumption.

[0033] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A dsRNA targeting the regulation of the gene of the PKA-R1 of the Macrobrachium Nipponense, characterized in that: The nucleotide sequence of the dsRNA targeting and regulating the PKA-R1 gene of the Chinese shrimp is shown as SEQ ID NO:

4.

2. A primer for preparing the dsRNA for targeting and regulating the gene of PKA-R1 of the Macrobrachium Nipponense according to claim 1, characterized in that, The sequence of the upstream primer is shown as SEQ ID NO: 5, and the sequence of the downstream primer is shown as SEQ ID NO:

6.

3. The dsRNA targeting and regulating the gene of PKA-R1 of Macrobrachium Nipponense according to claim 1, characterized in that, The nucleotide sequence of the Chinese shrimp PKA-R1 gene is shown as SEQ ID NO:

1.

4. The dsRNA targeting and regulating the gene of PKA-R1 of Marsupenaeus japonicus according to claim 1, characterized in that, The amino acid sequence of the Chinese shrimp PKA-R1 gene is shown as SEQ ID NO:

2.

5. A method for obtaining the dsRNA of claim 1 for targeted regulation of the gene of PKA-R1 of the Chinese shrimp, characterized by, The method comprises the following steps: Step one: after analyzing the amino acid sequence of the Chinese shrimp PKA-R1, a specific region of the PKA-R1 is selected; Step two: interference primer pairs are designed for the coding gene of the specific region: the upstream primer SEQ ID NO: 5 and the downstream primer SEQ ID NO: 6; Step three: the primers obtained in step two are used for PCR amplification with the total cDNA of the Chinese shrimp as the template to obtain the DNA fragment shown as SEQ ID NO: 3; Step four: the DNA fragment shown as SEQ ID NO: 3 is used as the template to synthesize the dsRNA targeting and regulating the Chinese shrimp PKA-R1 gene.

6. The dsRNA targeting and regulating the Chinese shrimp PKA-R1 gene of claim 1 in a product for slowing down the growth speed of the Chinese shrimp.

7. Use according to claim 6, characterized in that, The product for slowing down the growth speed of the Chinese shrimp is injected into the pericardial cavity of the Chinese shrimp, and the injection concentration of the dsRNA targeting and regulating the Chinese shrimp PKA-R1 gene is 4 μg / g.

8. Use according to claim 6, characterized in that, The Chinese shrimp is female or male.

9. The use of the dsRNA targeting and regulating the Chinese shrimp PKA-R1 gene of claim 1, the primer of claim 2, or the Chinese shrimp PKA-R1 gene of claim 3 or claim 4 in the preparation of a product for slowing down the growth speed of the Chinese shrimp.

Images