Chicken intramuscular fat deposition related circular RNA, ceRNA regulatory network and application

Abstract

The invention belongs to the technical field of biology, and particularly relates to a circular RNA related to chicken intramuscular fat deposition, a ceRNA regulation network and application. According to the application disclosed by the invention, circSMARCD3 playing a key role in intramuscular fat deposition in a chicken embryonic period and a ceRNA regulation axis of the circSMARCD3 are screened and identified through a high-throughput sequencing technology, the cyclization stability of the circSMARCD3 is verified, the circSMARCD3 can be directly combined with miR-2131-5p, and the miR-2131-5p can directly target 3 'UTR regions of SORT1 and PDE4B genes and inhibit expression of the SORT1 and PDE4B genes, so that proliferation of preadipocytes in chicken embryonic period is inhibited, and the application of the circSMARCD3 in chicken embryonic period intramuscular fat deposition in chicken embryonic period intramuscular fat deposition in chicken embryonic period intramuscular fat deposition is promoted. The chicken feed additive can promote fat droplet aggregation to be remarkably increased, TG and GL contents to be remarkably increased, preadipocyte differentiation in chicken muscles is promoted, fat deposition is promoted, and the chicken quality is improved.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to a circular RNA related to chicken intramuscular fat deposition, a ceRNA regulation network and application. BACKGROUND

[0002] Chicken intramuscular fat (IMF) content is a core index affecting its eating quality (such as tenderness, flavor and juiciness). In the broiler breeding and breeding industry, improving IMF deposition is a key goal to improve meat quality and enhance the market competitiveness of products. However, modern commercial broiler varieties (such as Cobb chicken) tend to fast growth and high meat yield due to long-term genetic selection, and their IMF deposition potential is often severely insufficient. Studies have shown that the chicken embryonic development period is a key window for the determination of intramuscular preadipocyte fate, and the molecular regulation process initiated during this period has a decisive influence on the fat deposition capacity of individuals after birth. Therefore, analyzing the genetic regulation mechanism of IMF deposition during the embryonic period of chicken is the theoretical basis for early intervention and genetic improvement of meat quality.

[0003] At present, there have been many reports on the molecular regulation of IMF deposition, but most of them focus on transcription factors (such as PPARγ, C / EBP family) and classical signaling pathways (such as Wnt, MAPK). In recent years, the regulatory role of non-coding RNA (non-coding RNA) has been increasingly concerned. Among them, circular RNA (circular RNA, circRNA) as a new type of covalently closed circular RNA molecule has become a frontier and hotspot in life science research due to its stable structure, specific expression and unique function as a competitive endogenous RNA (ceRNA) to absorb microRNA (microRNA, miRNA). The ceRNA mechanism refers to the fact that circRNA plays a "molecular sponge" role through its miRNA response elements, absorbs miRNA, thereby relieving the inhibition of miRNA on its downstream target genes, and realizes fine regulation of the gene expression network at the post-transcriptional level. Screening and identifying circRNA and its ceRNA regulation axis that play a key role in chicken intramuscular fat deposition are particularly important for genetic improvement of broiler meat quality traits. SUMMARY

[0004] The purpose of the present application is to screen and identify circRNA and its ceRNA regulation axis that play a key role in chicken intramuscular fat deposition, regulate chicken intramuscular fat deposition, improve broiler meat quality traits, and lay a foundation for the selection of high meat quality chickens.

[0005] The application provides a circular RNA, which is circSMARCD3, and the nucleotide sequence is shown as SEQ ID NO: 1.

[0006] The present application provides a reagent, which comprises a reagent for detecting the expression level of a circular RNA and / or a reagent for detecting the expression level of an interaction gene of the circular RNA; the circular RNA is the circular RNA described in the above technical solution; The interaction gene is miR-2131-5p, and the nucleotide sequence is shown in SEQ ID NO: 2.

[0007] Preferably, the reagent further comprises a reagent for detecting the expression level of a target gene of the miR-2131-5p; The target gene comprises SORT1 a gene and / or PDE4B a gene.

[0008] The present application provides a ceRNA regulatory network, which comprises circSMARCD3, miR-2131-5p, SORT1 a gene and PDE4B a gene; The nucleotide sequence of the circSMARCD3 is shown in SEQ ID NO: 1; The nucleotide sequence of the miR-2131-5p is shown in SEQ ID NO: 2.

[0009] The present application provides a product for detecting the ceRNA regulatory network described in the above technical solution, which comprises a primer, a probe or a kit.

[0010] The present application provides the application of the circular RNA described in the above technical solution, the reagent described in the above technical solution, the ceRNA regulatory network described in the above technical solution or the product described in the above technical solution in one or more of the following aspects: (1) improving chicken meat quality; (2) predicting or assisting in predicting chicken meat quality; (3) screening or assisting in screening high meat quality chickens; (4) breeding or assisting in breeding high meat quality chickens; (5) identifying and / or screening candidate molecules for regulating chicken meat quality; (6) promoting chicken intramuscular preadipocyte differentiation.

[0011] Preferably, the chicken meat quality is chicken intramuscular fat deposition.

[0012] Preferably, the high meat quality chicken is a high intramuscular fat content chicken.

[0013] The present application provides a method for detecting chicken intramuscular fat content, comprising the following steps: detecting one or more of the following in chicken intramuscular fat tissue and / or intramuscular preadipocytes; (1) the expression amount of circSMARCD3; (2) the expression amount of circSMARCD3 interaction gene; The nucleotide sequence of the circSMARCD3 is shown as SEQ ID NO: 1; the interaction gene is miR-2131-5p, and the nucleotide sequence is shown as SEQ ID NO: 2.

[0014] The application provides a method for improving the intramuscular fat content of chickens, comprising the following steps: treating the intramuscular fat tissue and / or intramuscular preadipocytes of the chicken by one or more of the following treatments: (1) overexpressing circSMARCD3; (2) interfering with the expression of the circSMARCD3 interaction gene; The nucleotide sequence of the circSMARCD3 is shown as SEQ ID NO: 1; the interaction gene is miR-2131-5p, and the nucleotide sequence is shown as SEQ ID NO: 2.

[0015] Beneficial effects: The application screens and identifies circSMARCD3 and its ceRNA regulatory axis that play a key role in intramuscular fat deposition in chicken embryos by high-throughput sequencing technology, and verifies the ring-forming stability of circSMARCD3. The circSMARCD3 provided by the application can act as a molecular sponge to adsorb miR-2131-5p, thereby relieving the inhibitory effect of miR-2131-5p on SORT1 and PDE4B The activation of this pathway functionally inhibits the proliferation of intramuscular preadipocytes, but promotes cell differentiation and lipid production, ultimately improves the intramuscular fat content to improve the quality of chicken meat. BRIEF DESCRIPTION OF DRAWINGS

[0016] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced below.

[0017] Figure 1 The results of amplifying chicken intramuscular preadipocyte cDNA and gDNA by polymerization / divergent primers; Figure 2 Sanger sequencing results; Figure 3 RNase R enzyme digestion test results; Figure 4 RT-qPCR analysis results of chicken intramuscular preadipocytes treated with actinomycin D for 12h; Figure 5 Expression levels of circSMARCD3 in cytoplasm and nucleus; Figure 6This section presents the target relationship and validation results of circSMARCD3 and miR-2131-5p; where A represents the predicted binding site of circSMARCD3 and miR-2131-5p; B represents the sequencing results of wild-type and mutant circSMARCD3; C represents the double enzyme digestion results of wild-type and mutant circSMARCD3 recombinant plasmids; and D represents the fluorescence intensity of each group detected by the dual-luciferase reporter vector assay. express P <0.01; Figure 7 For miR-2131-5p and SORT1 The target relationship and validation results; where A represents miR-2131-5p and... SORT1 Binding site prediction; B represents wild-type and mutant. SORT1 Sequencing results; C represents wild type and mutant type. SORT1 Double enzyme digestion results of recombinant plasmids; D represents the fluorescence intensity of each group detected by the dual-luciferase reporter vector assay. express P <0.01; Figure 8 For miR-2131-5p and PDE4B The target relationship and validation results; where A represents miR-2131-5p and... PDE4B Binding site prediction; B represents wild-type and mutant. PDE4B Sequencing results; C represents wild type and mutant type. PDE4B Double enzyme digestion results of recombinant plasmids; D represents the fluorescence intensity of each group detected by the dual-luciferase reporter vector assay. express P <0.01; Figure 9 Co-expression of circSMARCD3 and miR-2131-5p SORT1 Genes and PDE4B The influence of gene expression levels; where A represents the statistical results of mRNA expression levels; B represents the Western Blot results of protein expression levels; C represents the statistical results of protein expression levels; where... express P <0.05, express P <0.01; Figure 10 For circSMARCD3 and miR-2131-5p co-interference pair SORT1 Genes and PDE4B The influence of gene expression levels; where A represents the statistical results of mRNA expression levels; B represents the Western Blot results of protein expression levels; and C represents the statistical results of protein expression levels. indicates P <0.05, indicates P <0.01; Figure 11 EdU staining (A) and EdU positive cell statistical results (B); wherein, indicates P <0.01; Figure 12 BODIPY staining (A) and oil red O staining results (B); Figure 13 Statistical results of chicken intramuscular preadipocyte differentiation metabolite content; wherein, indicates P <0.05, indicates P <0.01; Figure 14 Effect of embryo injection of si-circSMARCD3 and miR-2131-5p antagomir on lipogenesis related gene and protein expression; wherein, A is the effect of si-circSMARCD3 on lipogenesis related gene expression detected by qRT-PCR; B and C are the effects of si-circSMARCD3 on lipogenesis related protein expression detected by WB; D is the effect of si-circSMARCD3 and miR-2131-5p antagomir co-injection on lipogenesis related gene expression; E and F are the effects of si-circSMARCD3 and miR-2131-5p antagomir co-injection on lipogenesis related protein expression; indicates P <0.05, indicates P <0.01; Figure 15 Effect of embryo injection of si-circSMARCD3 and miR-2131-5p antagomir on IMF and TG content; wherein, A is the effect of si-circSMARCD3 on IMF content in leg muscle during embryonic period; B is the effect of si-circSMARCD3 and miR-2131-5p antagomir co-injection on IMF content in leg muscle during embryonic period; C is the effect of si-circSMARCD3 on TG content in leg muscle during embryonic period; D is the effect of si-circSMARCD3 and miR-2131-5p antagomir co-injection on TG content in leg muscle during embryonic period; indicates P <0.05, indicates P <0.01; Figure 16 The effect of injecting embryos with si-circSMARCD3 and miR-2131-5p antagomir on IMF deposition; where A is 40× and B is 200×. Detailed Implementation

[0018] The present invention provides a circular RNA, wherein the circular RNA is circSMARCD3, and the nucleotide sequence is shown in SEQ ID NO:1.

[0019] This invention provides a reagent comprising a reagent for detecting the expression level of circular RNA and / or a reagent for detecting the expression level of an interacting gene of the circular RNA; the circular RNA is the circular RNA described in the above technical solution; the interacting gene is miR-2131-5p, and its nucleotide sequence is shown in SEQ ID NO:2.

[0020] As one embodiment, the reagent of the present invention further includes a reagent for detecting the expression level of the target gene of miR-2131-5p; the target gene includes SORT1 Genes and / or PDE4B Genes. Described in this invention. SORT1 The gene's accession number is ENSGALG00010024856. PDE4B The gene's accession number is ENSGALG00010027081.

[0021] As one embodiment, the reagent for detecting the expression level of the circular RNA described above includes an upstream primer circSMARCD3-F and a downstream primer circSMARCD3-R; the upstream primer circSMARCD3-F includes the nucleotide sequence shown in SEQ ID NO:3, and the downstream primer circSMARCD3-R includes the nucleotide sequence shown in SEQ ID NO:4. As one embodiment, the reagent for detecting the expression level of the interacting genes of the circular RNA includes a plasmid overexpressing the circular RNA and / or a reagent interfering with the expression of the circular RNA. As one embodiment, the reagent for detecting the expression level of the circular RNA includes a plasmid overexpressing the circular RNA and / or a reagent interfering with the expression of the circular RNA. SORT1 Gene reagents include upstream primers. SORT1 -F and downstream primers SORT1 -R; the upstream primer SORT1 -F includes the nucleotide sequence shown in SEQ ID NO:5, the downstream primer SORT1 -R includes the nucleotide sequence shown in SEQ ID NO:6. As one embodiment, the present invention detects the... PDE4B Gene reagents include upstream primers. PDE4B-F and a downstream primer PDE4B -R; the upstream primer PDE4B -F comprises a nucleotide sequence as shown in SEQ ID NO: 7, and the downstream primer PDE4B -R comprises a nucleotide sequence as shown in SEQ ID NO: 8.

[0022] The nucleotide sequences of SEQ ID NO: 1 to SEQ ID NO: 8 of the present application are as follows: SEQ ID NO: 1: 5'-CGACCTGGGATGCCATCAGGAGCTCGAATGCCCCACCAGGGGGCTCCCATGGGTCCCCCAGGCCCTCCATATGTTGGAAGCCCCTCGGTGAGACCTGGGATGCCCCAGACTGTGATGGAAACAACAAGAAAACGCACTGCACCACAGCAGGTCCAACAACAGCAGGTGCAGCAGCAAGTGCAGCAGCAGCAGCAAGCTACTCAGAACCGAACTAGGAGCTTACAGGCACTCACCTCTTCCTTCTGCGTGGACGTAGGTATGTCTCTGCACACTTCCACACACGTGCTGTCCTTCGACATGCTCTTTCTGCATCCGCAGACAGCATGTGCACAGTGCCAAGAGGAGGAAGATGGCTGACAAAATTCTCCCTCAGAGG-3'; SEQ ID NO: 2: 5'-AUGCAGAAGUGCACGGAAACAGCU-3'; SEQ ID NO: 3: 5'-ccCTCGAGCACCTCTTCCTTCTGCGTGGACGTA-3'; SEQ ID NO: 4: 5'-atttGCGGCCGCTGCGGAACGTCTTAGAGC-3'; SEQ ID NO: 5: 5'-ccCTCGAGCTGCTTGCATGCGCTTCTGCAGC-3'; SEQ ID NO: 6: 5'-atttGCGGCCGCACGTGTGATAACTTTATACG-3'; SEQ ID NO: 7: 5'-ccCTCGAGATTCCCTCCGTTTCTGCATTA-3'; SEQ ID NO: 8: 5'-atttGCGGCCGCAGTGTATTTATTACGTAATG-3'.

[0023] The application provides a ceRNA regulatory network, which comprises circSMARCD3, miR-2131-5p, SORT1 a gene and PDE4B a gene; the nucleotide sequence of the circSMARCD3 is shown as SEQ ID NO: 1; the nucleotide sequence of the miR-2131-5p is shown as SEQ ID NO: 2; the nucleotide sequence of the SORT1 gene is shown as SEQ ID NO: 3; and the nucleotide sequence of the PDE4B gene is shown as SEQ ID NO: 4.

[0024] The application provides a product for detecting the ceRNA regulatory network described in the above technical solution, and the product comprises primers, probes or a kit.

[0025] The application screens and identifies the circSMARCD3 and the ceRNA regulatory axis thereof which play a key role in chicken embryonic intramuscular fat deposition through high-throughput sequencing technology. SORT1 and PDE4B The circSMARCD3 can directly bind to miR-2131-5p, and the miR-2131-5p can directly target the 3'UTR region of the SORT1 and PDE4B gene, inhibit the expression of the and

[0026] gene, thereby inhibiting chicken intramuscular preadipocyte proliferation, significantly increasing the aggregation of lipid droplets in chicken intramuscular preadipocytes, significantly increasing the TG and GL contents, promoting the differentiation of chicken intramuscular preadipocytes, promoting fat deposition, and improving chicken meat quality.

[0027] In view of the advantages of the application, the application of the circular RNA described in the above technical solution, the reagent described in the above technical solution, the ceRNA regulatory network described in the above technical solution or the product described in the above technical solution in one or more of the following applications also belongs to the protection scope of the application: (1) improving chicken meat quality; (2) predicting or assisting in predicting chicken meat quality; (3) screening or assisting in screening high meat quality chickens; (4) breeding or assisting in breeding high meat quality chickens; (5) identifying and / or screening candidate molecules for regulating chicken meat quality; and (6) promoting the differentiation of chicken intramuscular preadipocytes.

[0028] The application provides a method for detecting chicken intramuscular fat content, comprising the following steps: detecting one or more of the following in chicken intramuscular adipose tissue and / or intramuscular preadipocytes; (1) the expression amount of circSMARCD3; (2) the expression amount of a circSMARCD3 interacting gene; the nucleotide sequence of the circSMARCD3 is shown as SEQ ID NO: 1; the interacting gene is miR-2131-5p, and the nucleotide sequence is shown as SEQ ID NO: 2. The application does not have strict requirements for the detection method, and conventional methods in the art can be used, such as PCR-based detection methods, Southern hybridization methods, Northern hybridization methods, dot hybridization methods, fluorescence in situ hybridization methods, DNA microarray methods, ASO methods or high-throughput sequencing platform methods.

[0029] The application provides a method for increasing chicken intramuscular fat content, comprising the following steps: one or more of the following treatments are performed on chicken intramuscular adipose tissue and / or intramuscular preadipocytes; (1) overexpression of circSMARCD3; (2) interference with the expression of a circSMARCD3 interacting gene; the nucleotide sequence of the circSMARCD3 is shown as SEQ ID NO: 1; the interacting gene is miR-2131-5p, and the nucleotide sequence is shown as SEQ ID NO: 2. The application does not have strict requirements for the overexpression method, and conventional methods in the art can be used, such as constructing an overexpression vector and introducing it into chicken intramuscular adipose tissue and / or intramuscular preadipocytes. As an embodiment, the chicken intramuscular adipocytes in the application are chicken intramuscular preadipocytes.

[0030] In order to further illustrate the application, the application provides a circular RNA related to chicken intramuscular fat deposition, a ceRNA regulatory network and applications in combination with the drawings and examples, but they cannot be understood as limiting the scope of protection of the application.

[0031] Example 1 1. Identification and ring formation verification of circSMARCD3 Based on the leg muscle transcriptome sequencing of Meishan chicken and Kobold chicken at 8 days of embryonic period (E8), a differential expression circRNA was screened, and a RNA molecule was screened through functional enrichment and qRT-PCR verification. The cDNA and gDNA of chicken intramuscular preadipocytes were amplified by polymerization / divergent primer, and the circular characteristics were verified by Sanger sequencing and RNase R digestion experiment. The results show that the RNA molecule is a circular RNA, the circularization site sequence is AGGCGA, and it is resistant to RNase R digestion. The RNA molecule is recorded as circSMARCD3 (circSMARCD3), and the nucleotide sequence is shown as SEQ ID NO: 1. Figures 1-3 ​

[0032] 2. Identification of stability of circSMARCD3 (1) The chicken intramuscular preadipocytes were treated with actinomycin D, and PT-PCR detection was performed, and the results showed that circSMARCD3 had stronger stability. Figure 4 ).

[0033] (2) When circSMARCD3 was subjected to subcellular localization, the chicken intramuscular preadipocyte RNA separated from cytoplasm and nucleus was used as a template, and the expression level of circSMARCD3 in cytoplasm and nucleus was detected by RT-qPCR, and the results showed that circSMARCD3 was mainly expressed in cytoplasm, which implied that circSMARCD3 might play a role as a miRNA molecular sponge. Figure 5 ).

[0034] Example 2 Verification of molecular interaction relationship by dual luciferase reporter experiment 1. Binding site prediction It was found by miRanda and TargetScan software that miR-2131-5p was combined with circSMARCD3 (Example 1, A), and it was found by miRanda that miR-2131-5p was combined with SMARCA1 (Example 1, A) and SMARCA4 (Example 1, A). Figure 6 SORT1 Figure 7 PDE4B Figure 8

[0035] 2. Verification of molecular interaction relationship by dual luciferase reporter experiment ​​​​​(1) Construct a luciferase reporter vector containing the wild-type circSMARCD3 sequence and a luciferase reporter vector containing the mutant circSMARCD3 sequence; co-transfect the luciferase reporter vector with miR-2131-5p mimics or a negative control into HEK-293T cells and detect luciferase activity; wherein, the nucleotide sequence of the mutant circSMARCD3 is: 5'-CGACCTGGGATGCCATCAGGAGCTCGAATGCCCCACCAGGGGGCTCCCATGGGTCCCCCAGGCCCTCCATATGTTGGAAGCCCCTCGGTGAGACCTGGGATGCCCCAGACTGTGA TGGAAACAACAAGAAAACGCACTGCACCACAGCAGGTCCAACAACAGCAGGTGCAGCAGCAAGTGCAGCAGCAGCAGCACTACTCAGAACCGAACTAGGAGCTTACAGGCACTCACCTCTTCCTTCTGCGTGGACGTAGGTATGTCTCTGCACACTTCCACACACGTGCTGTCCTTCGACATGCTCTAAGACGTTCCGCAGACAGCATGTGCACAGTGCCAAGAGGAGGAAGATGGCTGACAAAATTCTCCCTCAGAGG-3' (SEQ ID NO:9), where the bolded portion represents the mutation site relative to the wild-type circSMARCD3 sequence (SEQ ID NO:1); the nucleotide sequence of miR-2131-5p mimics is shown in SEQ ID NO:2; the nucleotide sequence of the negative control is: 5'-UUCUCCGAACGUGUCACGU-3' (SEQ ID NO:10). The results showed that, compared with the control group, co-transfection with miR-2131-5p mimics significantly inhibited the activity of reporter genes containing wild-type circSMARCD3. P <0.01), while having no significant effect on mutant vectors ( Figure 6 ).

[0036] (2) Construct a system containing wild-type SORT1 Luciferase reporter vectors containing the 3'UTR sequence of the gene, and those containing mutants. SORT1 A luciferase reporter vector containing the 3'UTR sequence of the gene was developed. The luciferase reporter vector, along with miR-2131-5p mimics or a negative control, was co-transfected into HEK-293T cells, and luciferase activity was detected. Wild-type cells were included in the transfection. SORT1The base AAGTTAT in the 3' UTR of the gene is mutated to AAGTCGGT to obtain a mutant SORT1 The 3' UTR of the gene. The results show that, compared with the control group, co-transfection of miR-2131-5p mimics can significantly inhibit the reporter gene activity containing SORT1 The 3' UTR sequence of the gene P <0.01), but has no significant effect on the mutant vector Figure 7 .

[0037] (3) Construct a luciferase reporter vector containing the wild-type PDE4B 3' UTR sequence of the gene, and a luciferase reporter vector containing the mutant PDE4B 3' UTR sequence of the gene; co-transfect the luciferase reporter vector into HEK-293T cells with miR-2131-5p mimics (mimics) or negative control, and detect the luciferase activity; wherein the wild-type PDE4B The base ACGTAAT in the 3' UTR of the gene is mutated to AAGTCTT to obtain a mutant PDE4B 3' UTR of the gene. The results show that, compared with the control group, co-transfection of miR-2131-5p mimics can significantly inhibit the reporter gene activity containing PDE4B The 3' UTR sequence of the gene P <0.01), but has no significant effect on the mutant vector Figure 8 .

[0038] The conclusion of (1)~(3) can be seen that there is a direct targeting relationship between miR-2131-5p and circSMARCD3, SORT1 and PDE4B .

[0039] Example 3 Effect of co-expression / co-interference of circSMARCD3 and miR-2131-5p on SORT1 and PDE4B mRNA and protein expression levels 1. Overexpression rescue experiment: (1) Take pcDNA3.1(+) as the basic vector, insert circSMARCD3 between the BamHI(929) site and the EcoRI(1311) site of pcDNA3.1(+), and construct a circSMARCD3 overexpression vector; randomly divide the chicken intramuscular preadipocytes into 3 treatment groups, and co-transfect them as follows: The first treatment group (MNC): co-transfect the empty vector pcDNA3.1(+) and the negative control of miR-2131-5p mimics in Example 2; Group 2 (pcDNA3.1 (+) + miR-2131-5p mimics): co-transfected empty vector pcDNA3.1 (+) and miR-2131-5p mimics in Example 2; Group 3 (pcDNA3.1 (+) + circSMARCD3 + miR-2131-5p mimics): co-transfected circSMARCD3 overexpression vector and miR-2131-5p mimics in Example 2.

[0040] (2) After 48 h of co-transfection in step (1), the expression of SORT1 genes and PDE4B genes were detected by qRT-PCR and Western Blot, and the results showed that overexpression of miR-2131-5p significantly inhibited SORT1 and PDE4B expression; while overexpression of circSMARCD3 could reverse this inhibitory effect, making SORT1 and PDE4B expression back up. The changes in protein levels were consistent with mRNA ( Figure 9 ).

[0041] 2. Interference rescue experiment: (1) The chicken intramuscular preadipocytes were randomly divided into 3 treatment groups, and co-transfected according to the following methods: Group 1 (INC): co-transfected negative control siRNA and negative control inhibitor; Group 2 (si-NC + miR-2131-5p inhibitor): co-transfected negative control siRNA and miR-2131-5p inhibitor; Group 3 (si-circSMARCD3 + miR-2131-5p inhibitor): co-transfected si-circSMARCD3 and miR-2131-5p inhibitor; The nucleotide sequence of the negative control inhibitor is 5'-UUCUCCGAACGUGUCAGGU-3' (SEQ ID NO: 11), the nucleotide sequence of the miR-2131-5p inhibitor is 5'-CAGUACUUUUGUGUAGUACAA-3' (SEQ ID NO: 12), the nucleotide sequence of the negative control siRNA is 5'-UUCUCCGAACGUGUCAGGU-3' (SEQ ID NO: 13), and the nucleotide sequence of si-circSMARCD3 is 5'-AUUCUCCCUCAGAGGCGAC-3' (SEQ ID NO: 14).

[0042] (2) After 48 h of co-transfection in step (1), the expression of genes and SORT1 genes was detected by qRT-PCR and Western Blot, and the results showed that the inhibition of miR-2131-5p significantly promoted PDE4B and SORT1 expression; meanwhile, the knockdown of circSMARCD3 significantly weakened this promotion. The protein level change was consistent with the mRNA (P < 0.01). PDE4B Figure 10

[0043] Example 4 Cell level function verification CircSMARCD3 was overexpressed and interfered in chicken intramuscular preadipocytes, respectively, cell proliferation was detected by EdU staining, cell differentiation was detected by oil red O staining and BODIPY staining, and triglyceride (TG), total cholesterol (TC) and glycerol (GL) content determination, and the results are shown in Figures 11-13 .

[0044] As can be seen from Figures 11-13 , after overexpression of circSMARCD3, the number of EdU positive cells was extremely significantly reduced, indicating that proliferation was inhibited; at the same time, lipid droplet aggregation significantly increased, and TG and GL content significantly increased. After interference of circSMARCD3, the results were just the opposite. It is proved that circSMARCD3 has the function of inhibiting chicken intramuscular preadipocyte proliferation and promoting differentiation.

[0045] Example 5 Animal level function verification In the early stage of chicken embryos (7 days old), they were randomly divided into 5 treatment groups, and the following treatments were performed through the amniotic cavity: The si-NC (Con) group: 6.5 μg of negative control siRNA in Example 3 was injected; ​​si-circSMARCD3 group: injected with 6.5 μg si-circSMARCD3 of Example 3; si-NC+antagomir NC group: injected with 3.25 μg negative control siRNA of Example 3 and 3.25 μg negative control inhibitor of Example 3; si-NC+miR-2131-5p antagomir group: injected with 3.25 μg negative control siRNA of Example 3 and 3.25 μg miR-2131-5p inhibitor of Example 3; si-circSMARCD3+miR-2131-5p antagomir group: injected with 3.25 μg si-circSMARCD3 of Example 3 and 3.25 μg miR-2131-5p inhibitor of Example 3.

[0046] After 14-15 days of injection in each treatment group, i.e. within 2 hours after hatching, samples were taken, and oil red O staining was performed by frozen section to determine the content of triglyceride (TG), total cholesterol (TC) and glycerol (GL), and qRT-PCR and Western Blot were used to detect the expression of related genes and proteins. The results are shown in Figures 14-16 As shown, knocking down circSMARCD3 down-regulated key genes for lipogenesis in the early stage of chicken embryos, which eventually significantly reduced the lipid droplet area, TG and IMF content in muscle. On the contrary, inhibiting miR-2131-5p had the opposite effect, and co-injection of circSMARCD3 interference fragments could rescue these changes to varying degrees. The experiment showed that the circRNA regulates IMF deposition in the embryonic period through this pathway.

[0047] Although the above examples have made a detailed description of the present application, it is only a part of the embodiments of the present application, but not all the embodiments, and people can also obtain other embodiments according to the present embodiments without creativity, which all belong to the protection scope of the present application.

Claims

1. A circular RNA, characterized in that, The circular RNA is circSMARCD3, and the nucleotide sequence is shown as SEQ ID NO:

1.

2. An agent, characterized in that, The reagent comprises a reagent for detecting the expression level of the circular RNA and / or a reagent for detecting the expression level of an interaction gene of the circular RNA; and the circular RNA is the circular RNA in claim 1. The interaction gene is miR-2131-5p, and the nucleotide sequence is shown as SEQ ID NO:

2.

3. The agent of claim 2, wherein The reagent further comprises a reagent for detecting the expression level of a target gene of the miR-2131-5p. The targeted genes include SORT1 genes and / or PDE4B genes.

4. A ceRNA regulatory network, characterized in that, The ceRNA regulatory network comprises circSMARCD3, miR-2131-5p, SORT1 gene and PDE4B gene; The nucleotide sequence of the circSMARCD3 is shown as SEQ ID NO:

1. The nucleotide sequence of the miR-2131-5p is shown as SEQ ID NO:

2.

5. A product of the ceRNA regulatory network in claim 4, wherein the product comprises a primer, a probe or a kit.

6. Use of the circular RNA in claim 1 or the reagent in claim 2 or 3 or the ceRNA regulatory network in claim 4 or the product in claim 5 in one or more of the following; (1) improving chicken meat quality; (2) predicting or assisting in predicting chicken meat quality; (3) screening or assisting in screening high meat quality chickens; (4) breeding or assisting in breeding high meat quality chickens; (5) identifying and / or screening candidate molecules for regulating chicken meat quality; and (6) promoting chicken intramuscular preadipocyte differentiation.

7. Use according to claim 6, characterized in that, The chicken meat quality is chicken intramuscular fat deposition.

8. Use according to claim 6, characterized in that, The high meat quality chicken is a chicken with high intramuscular fat content.

9. A method of detecting chicken intramuscular fat content, characterized by, The method comprises the following steps: detecting one or more of the following in chicken intramuscular fat tissue and / or intramuscular preadipocytes; (1) the expression amount of circSMARCD3; and (2) the expression amount of an interaction gene of circSMARCD3. The nucleotide sequence of the circSMARCD3 is shown as SEQ ID NO: 1; and the interaction gene is miR-2131-5p, and the nucleotide sequence is shown as SEQ ID NO:

2.

10. A method of increasing intramuscular fat content in a chicken, characterized by, The method comprises the following steps: performing one or more of the following treatments on chicken intramuscular fat tissue and / or intramuscular preadipocytes; (1) overexpressing circSMARCD3; and (2) interfering with the expression of an interaction gene of circSMARCD3. The nucleotide sequence of the circSMARCD3 is shown as SEQ ID NO: 1; and the interaction gene is miR-2131-5p, and the nucleotide sequence is shown as SEQ ID NO: 2.

Images