Method for catalytic synthesis of l-cysteine by whole cell, recombinant escherichia coli and application

By constructing recombinant Escherichia coli, knocking out the sdaA and tdcG genes, and performing site-directed mutations in the trpB gene, whole-cell catalytic synthesis of L-cysteine ​​was achieved. This solved many problems in the existing enzymatic conversion method for L-cysteine ​​production, improved the conversion rate and yield, and is suitable for industrial application.

CN121406557BActive Publication Date: 2026-04-17TIANJIN UNIV OF SCI & TECH +1
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202512015089.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-30
Publication Date
2026-04-17
Estimated Expiration
2045-12-30

AI Technical Summary

Technical Problem

Existing enzymatic conversion methods for L-cysteine ​​production suffer from problems such as high substrate costs, poor enzyme stability, product feedback inhibition of the reaction, toxicity of thiodonates to enzymes and cells, easy oxidation of substrates and products, numerous side reactions, limited yield and final concentration, insufficient whole-cell catalytic permeability, complex construction of engineered bacteria, and difficulty in achieving continuous production, making it difficult to meet the needs of large-scale industrial production.

Method used

Recombinant Escherichia coli was constructed by knocking out the sdaA and tdcG genes, site-directed mutation of the tryptophan synthase β subunit trpB, and constructing a recombinant plasmid that efficiently overexpressed the mutant β and α subunit genes in the strain, achieving whole-cell catalytic synthesis of L-cysteine.

Benefits of technology

It significantly improves the conversion rate and yield of L-cysteine, simplifies the process, reduces production costs, has a short reaction time and high conversion efficiency, is suitable for industrial-scale production, and has a green and environmentally friendly catalytic effect.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121406557B_ABST
    Figure CN121406557B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of genetic engineering technology and discloses a method for whole-cell catalytic synthesis of L-cysteine, a recombinant Escherichia coli, and its applications. The recombinant Escherichia coli is constructed by the following method: knocking out the enzyme encoding L-serine dehydratase. sdaA and tdcG Genes; obtaining mutant β subunit genes; constructing recombinant plasmids; efficient overexpression of mutant genes and genes in strains. wait Recombinant Escherichia coli was obtained. The method of this invention utilizes enzymatic reactions under mild conditions, low energy consumption, and is environmentally friendly, resulting in high substrate utilization and significantly reduced overall costs. The catalytic system can react efficiently under neutral to weakly alkaline conditions at 25-35°C, without requiring high temperatures, high pressures, or toxic chemical reagents, significantly reducing energy consumption and environmental impact. Simultaneously, the reaction system of this invention exhibits high substrate conversion and few side reactions, resulting in a substantial increase in raw material utilization and significant economic advantages.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and in particular to a method for whole-cell catalytic synthesis of L-cysteine, recombinant Escherichia coli, and its application. Background Technology

[0002] L-cysteine ​​is an important sulfur-containing amino acid that makes up proteins. Its molecule contains an active sulfhydryl group (-SH), which has strong reducing power and can effectively maintain protein stability and many important physiological functions. L-cysteine ​​is found in keratin, the main protein that makes up nails, toenails, skin, and hair. L-cysteine ​​helps in collagen production, maintaining skin elasticity and texture. L-cysteine ​​is mainly used in cosmetics, pharmaceuticals, and food. In cosmetics, it is used to prepare hair perming solutions, sunscreens, hair growth perfumes, and hair care products. In the pharmaceutical field, it is used to prepare drugs containing methylcysteine, ethylcysteine, acetylcysteine, cysteine ​​methyl ester, cysteine ​​ethyl ester, and complex amino acid preparations. In medicine, it is widely used to treat hepatitis, liver poisoning, radioactive drug poisoning, acrylonitrile and antimony poisoning, and allergic diseases. It is also used in biochemical and nutritional research. In the food industry, L-cysteine ​​is used as a leavening aid (ripening agent) for bread, a stabilizer for antioxidants in milk powder and fruit juice, and a nutrient in pet food.

[0003] The existing production processes for L-cysteine ​​mainly include the following four categories: protein hydrolysis, chemical synthesis, fermentation, and enzymatic synthesis. Protein hydrolysis uses keratin-rich raw materials such as animal hair and feathers, which are acid-hydrolyzed to obtain L-cysteine. However, animal hair sources are complex, with significant quality variations and high impurity content, easily introducing pathogenic microorganisms, heavy metals, or exogenous chemical residues, posing a high risk for food-grade applications and not conforming to the modern biomanufacturing trend of "animal-free." Chemical synthesis typically generates racemic DL-cysteine, which is then separated with a resolving agent (such as benzoyl tartaric acid). This method usually results in low yields, expensive resolving agents, and complex processes. Solvents such as ethanol, methanol, and isopropanol are commonly used, generating large amounts of waste liquid containing organic impurities, numerous degradation byproducts, and significant environmental pressure. Fermentation for L-cysteine ​​production involves tightly restricted intracellular metabolism, making it easily degraded rapidly by itself or regulated as a sulfur metabolism node, exhibiting feedback inhibition (e.g., to...). SerA , CysE The inhibition is difficult to completely eliminate, resulting in a heavy metabolic burden, often inhibiting cell growth and low yield.

[0004] Chinese patent publication CN102517352A discloses a method for preparing L-cysteine ​​by enzymatic conversion. 19g of wet tryptophan synthase cells obtained by centrifugation of 1000mL fermentation broth are added to 500mL of conversion solution. The conversion solution contains 120g / L of reaction solution for L-serine synthesis (total amino acid content 50%), 39g of NaHS, 0.2g / L of pyridoxal phosphate, and 0.5g / L of Tween-80. The reaction is carried out at pH 8 and 37℃ for 45h. After the reaction, the concentration of L-cysteine ​​in the conversion solution is 118g / L, and the molar conversion rate of L-serine is 85.3%.

[0005] Chinese patent publication CN105177076A discloses a method for synthesizing L-cysteine ​​by converting DL-2-amino-Δ2-thiazoline-4-carboxylic acid using an immobilized enzyme. A 1L conversion reaction system was established, containing 15g of reactant DL-ATC, 1.5g of KH₂PO₄, and 100g of sorbitol. The pH of the reaction system was 7.5; the reaction temperature was 30℃, the stirring speed was 150 rpm, and the reaction time was 1 h. After the reaction was completed, the conversion rate was calculated based on the molar ratio of L-cysteine ​​to DL-ATC, showing a conversion rate of 90% for DL-ATC to L-cysteine.

[0006] Chinese patent publication CN117683760A discloses a method for producing L-cysteine ​​using a tryptophan synthase mutant. The reaction system consists of 0.95 M L-serine, 1.1 M sodium hydrosulfide, 0.4 mM pyridoxal phosphate, 50 mM disodium hydrogen phosphate, and 20 g / L of wet bacterial cell lysate. The reaction conditions are: 40 °C, with pH adjusted to 8.0 using 2 M H₂SO₄. HPLC was used to detect the production of L-cysteine ​​or L-cysteine ​​and the remaining amount of the substrate serine over 4 hours. When wild-type TrpS catalyzed the reaction for 4 hours, the yield was 868 mM (781 mM cysteine ​​and 43.5 mM cysteine), with a serine conversion rate of 91.4%. When the mutant TrpS QKDPE36-40AAAPA is used, the yield can reach 949.5mM (878.5mM cysteine ​​and 35.5mM cysteine) in just 3 hours. Serine is almost completely converted into cysteine, with a conversion rate of 99.9%.

[0007] Chinese patent publication CN115261365A discloses a method for using a tryptophan synthase mutant to catalyze the synthesis of L-cysteine. Specifically, in a 1L system: 53g of L-serine is completely dissolved in 200mM PBK buffer, followed by the addition of 10g / L TtsMUT3 enzyme solution, 1g of pyridoxal phosphate, and 16% ammonium sulfide. The mixture is stirred at 100rpm, and ammonium sulfide is added using a pH electrode to maintain the pH at 8.0–9.5. The reaction is carried out at 37℃ for 2 hours. After the reaction, the resulting solution is subjected to a colorimetric reaction detection. The results show that the L-cysteine ​​content is 60.70g / L, and the L-cysteine ​​production rate is greater than 98%.

[0008] Chinese patent publication CN120026015A discloses a catalytic method using a tryptophan synthase mutant. In a 100 mL Tris-HCl buffer system, 75 g / L of serine substrate, 0.8-1.0 mol / L of sodium hydrosulfide substrate, 20-30 g / L of induced recombinant Corynebacterium glutamicum (based on expression vector pXMJ19), and 0.20-0.4 g / L of pyridoxal phosphate are added. The reaction speed is controlled at 200-300 r / min, the pH is 6-8, the temperature is 30-40℃, and the reaction time is 12-24 h. The conversion rate of wild-type tryptophan synthase from *E. coli* is only 31.8%, while the tryptophan synthase combination mutant T69A / S143A / R219E / F280H exhibits excellent L-cysteine ​​production capacity, ultimately yielding 85.6 g / L L-cysteine, with a conversion rate exceeding 99%.

[0009] Recent studies have shown that tryptophan synthase (TrpAB) can catalyze the reaction of L-serine with sulfide donors (such as sodium sulfide, thioacetate, or thiosulfate) to produce L-cysteine. This method offers mild reaction conditions, high selectivity, and excellent optical purity, showing great promise for industrial application and representing an important direction for achieving efficient and controllable L-cysteine ​​synthesis. However, existing enzymatic conversion methods for cysteine ​​production still suffer from a series of problems, including high substrate costs, poor enzyme stability, product feedback inhibition, significant toxicity of sulfide donors to both the enzyme and the cell, easy oxidation of substrates and products, numerous side reactions, limited yield and final concentration, insufficient whole-cell catalytic permeability, complex construction of engineered bacteria, and difficulty in achieving continuous production. Therefore, these methods are not well-suited to the needs of large-scale industrial production. Summary of the Invention

[0010] The purpose of this invention is to overcome the shortcomings of the prior art and provide a method for whole-cell catalytic synthesis of L-cysteine, recombinant Escherichia coli, and its application.

[0011] The technical solution adopted by this invention to solve its technical problem is:

[0012] A recombinant *E. coli* strain capable of whole-cell catalytic synthesis of L-cysteine, wherein the recombinant *E. coli* strain is constructed by the following method:

[0013] First of all, Escherichia coli Knockout of L-serine dehydratase in BL21 (DE3) sdaA and tdcG Genes; subsequently, on Escherichia coli K-12-derived tryptophan synthase β subunit gene trpB Site-directed mutagenesis was performed to obtain a mutant β subunit gene with higher enzyme activity. Then, the recombinant plasmid was constructed to efficiently overexpress the mutant β subunit gene in the strain. and tryptophan synthase α subunit gene trpA Recombinant Escherichia coli was obtained;

[0014] Among them, the sdaA The nucleotide sequence of the gene is SEQ ID No. 1. tdcG The nucleotide sequence of the gene is SEQ ID No. 2, tryptophan synthase α subunit gene. trpA The nucleotide sequence is SEQ ID No. 3, tryptophan synthase β subunit gene. trpB The nucleotide sequence is SEQ ID No. 4, and it is the result of a site-directed mutation in the tryptophan synthase β subunit gene. The nucleotide sequence is SEQ ID No. 5.

[0015] Furthermore, the aforementioned sdaA Genes originate from Escherichia coli BL2 1 (DE3), tdcG Genes originate from Escherichia coli BL21 (DE3);

[0016] Or, the trpA Genes originate from Genes originate from Escherichia coli K-12, trpB Genes originate from Escherichia coli K-12.

[0017] Furthermore, the specific steps are as follows:

[0018] (1) Knockout via homologous recombination technology Escherichia coli BL21 (DE3) sdaA Genes and tdcG Genes were used to reduce the conversion of L-serine to pyruvate, and recombinant strains were constructed. E. coli Cys-1;

[0019] (2) Amplify separately from Escherichia coli K-12 trpA Genes and mutations The gene was ligated into the vector pET-28a to construct the recombinant plasmid pET28a- trpAB -1, and transform the plasmid to E. coli Cys-1, obtaining recombinant strains capable of expressing tryptophan synthase mutants. E. coli Cys-2 was used to obtain recombinant Escherichia coli.

[0020] The application of recombinant Escherichia coli as described above in the catalytic synthesis of L-cysteine.

[0021] The method for synthesizing L-cysteine ​​using whole-cell catalysis of recombinant Escherichia coli as described above includes the following steps:

[0022] Recombinant Escherichia coli was induced and cultured, and the bacterial cells were collected for whole-cell catalysis to achieve efficient synthesis of L-cysteine.

[0023] Furthermore, the specific steps are as follows:

[0024] (1) Culture recombinant Escherichia coli to express intracellular tryptophan synthase TrpAB under induction conditions. The bacterial cells were collected by centrifugation.

[0025] (2) The collected bacterial cells, substrate L-serine, and sulfur source are combined to form a reaction system, and an enzyme-catalyzed reaction is carried out under alkaline conditions to generate L-cysteine.

[0026] Furthermore, the specific culture steps for culturing the recombinant strain in step (1) are as follows:

[0027] 1) Resuscitation of recombinant Escherichia coli from glycerol storage tubes: First, five loops of bacteria were picked using a sterile inoculation loop and streaked onto LB agar slant tubes containing 100 mg / L kanamycin, and incubated overnight at 37 ℃; then, all colonies on the slant tubes were streaked again onto LB agar slant tubes containing 100 mg / L kanamycin, and incubated overnight at 37 ℃ to obtain sufficient healthy bacteria as seed source;

[0028] 2) Inoculate all the bacterial cells from the solid slant of the eggplant-shaped flask into TB liquid fermentation medium containing 100 mg / L kanamycin, and add it to the fermenter at a filling factor of 60% for fermentation. During fermentation, the aeration rate is maintained at 3 L / min, the dissolved oxygen is controlled at 20% to 40%, and the pH is stabilized at 7.0 by automatically adding ammonia water. The culture temperature is set at 37 ℃.

[0029] 3) When the bacterial cells grow to OD 600 When the temperature reaches 40-60°C, IPTG with a final concentration of 0.1 mM is added to the fermenter to induce the expression of the recombinant protein. During the induction phase, the temperature is lowered to 25 °C, and the culture is continued for 20 h. After induction, the cells are collected by centrifugation at 8000 r / min for 15 min for subsequent enzyme preparation and catalytic reactions.

[0030] Further, the formulation of LB solid medium in step 1) is as follows: glucose 5g / L, peptone 10g / L, beef extract 10g / L, yeast powder 5g / L, agar 25g / L, NaCl 2.5g / L, kanamycin 100 mg / L; sterilize at 115℃ for 15 min.

[0031] Alternatively, each 2L of the TB liquid fermentation medium described in step 2) contains: 10g peptone, 10g yeast powder, 30g glycerol, 26g potassium dihydrogen phosphate, 20g dipotassium hydrogen phosphate, 3.4g citric acid, 8g ammonium sulfate, and 2mL of defoamer.

[0032] Further, in step (2), each 50 mL reaction system consists of: 1 M L-serine, 1.1 M sulfur donor, 0.5 mmol / L pyridoxal phosphate, 50 g / L cell concentration, water as solvent, pH adjusted to 8.5 with HCl during the reaction, reaction temperature of 40℃, and reaction time of 2 h.

[0033] Furthermore, the sulfide donor is sodium hydrosulfide or sodium sulfide.

[0034] The advantages and positive effects of this invention are as follows:

[0035] 1. The method of this invention features a clear construction route for engineered strains, simple operation, and high recombinant expression levels, making it suitable for industrial-scale production. It utilizes mature... Escherichia coli The BL21 (DE3) expression system, combined with key gene knockout, site-directed mutagenesis, and optimized expression vector construction, ensures high expression levels and good stability of the TrpAB enzyme. The strain construction process is simple and controllable, with a clearly defined genetic background, making it suitable for fermenter scale-up and continuous production, providing a reliable technical foundation for industrial-grade L-cysteine ​​enzyme manufacturing.

[0036] 2. In the method of this invention, knockout is used. sdaA and tdcG This invention effectively blocks the degradation pathway of L-serine, improving substrate utilization from the source. Traditional strains often experience rapid substrate degradation due to the action of endogenous L-serine dehydrating enzymes when using L-serine as a substrate, resulting in low conversion rates. This invention addresses this issue by selectively knocking out... sdaA and tdcGThe gene significantly reduced substrate loss, allowing more L-serine residues to be used in the synthesis of the target product, thereby significantly improving the overall conversion efficiency.

[0037] 3. This invention utilizes the β subunit of tryptophan synthase. trpB By introducing double-site mutations of H86W and Q114M into the gene, the double-mutant tryptophan synthase TrpAB was constructed. This double mutation significantly enhances the enzyme's catalytic activity while maintaining its structural stability. Compared to the existing wild-type tryptophan synthase TrpAB, the H86W / Q114M double mutation can enhance... β The substrate-binding ability of the subunit accelerates the overall reaction efficiency of the conversion of L-serine to L-cysteine. Experimental results show that the conversion rate and final yield of L-cysteine ​​in the engineered strain containing this double mutant are significantly higher than those in the strain expressing wild-type TrpAB, demonstrating higher catalytic efficiency and substrate utilization, thus providing a superior biocatalytic tool for the efficient and green synthesis of cysteine.

[0038] 4. The method of this invention uses whole-cell catalysis, eliminating the need for further cell disruption or surfactant treatment for the catalytic reaction of L-cysteine, thus significantly simplifying the process and reducing production costs. Using optimized recombinant enzyme-producing strains and the improved whole-cell catalysis process, the reaction system achieves high-efficiency conversion within 2 hours, with an L-cysteine ​​yield as high as 114 g / L and a molar conversion rate of 94.2% from L-serine to L-cysteine. This method not only has a short reaction time and high conversion efficiency but also exhibits stable processing and simple operation, demonstrating excellent potential for industrial scale-up and application.

[0039] 5. The enzymatic reaction method of this invention features mild reaction conditions, low energy consumption, and is environmentally friendly, with high substrate utilization and significantly reduced overall cost. The catalytic system can react efficiently under neutral to weakly alkaline conditions at 25-35℃, without the need for high temperature, high pressure, or toxic chemical reagents, significantly reducing energy consumption and environmental impact. Simultaneously, the reaction system of this invention has high substrate conversion rate and few side reactions, resulting in a substantial increase in raw material utilization and significant economic advantages. Attached Figure Description

[0040] Figure 1 In this invention sdaA Gene knockout verification diagram; where M: Marker, 1: sdaA Upstream homologous arm fragment, 2: sdaA Downstream homologous arm fragment, 3: sdaA Overlapping fragments: 4: Use primers 7-12 for the original bacteria using the P fragment; 5: Use primers 7-12 for the target bacteria using the P fragment.

[0041] Figure 2 In this invention tdcG Gene knockout verification diagram; where M: Marker, 1: tdcG Upstream homologous arm fragment, 2: tdcG Downstream homologous arm fragment, 3: tdcG Overlapping fragments, 4: Use primers 13-18 for the original bacteria and the P fragment; 5: Use primers 13-18 for the target bacteria and the P fragment.

[0042] Figure 3 This is a graph showing the L-serine degradation rate determination in this invention;

[0043] Figure 4 The recombinant plasmid in this invention Cys-2 validation image; where M: Marker, 1: Enzyme digestion plasmid band; 2: Correct band;

[0044] E. coli The recombinant plasmid in this invention Figure 5 Cys-3 validation image; where M: Marker, 1: Enzyme digestion plasmid band; 2: Correct band;

[0045] E. coli This is a diagram of the whole-cell catalytic reaction process in this invention. Detailed Implementation

[0046] The present invention will be further described below with reference to the embodiments. The following embodiments are descriptive and not limiting, and should not be used to limit the scope of protection of the present invention.

[0047] The various experimental operations involved in the specific embodiments are all conventional techniques in the field. For parts not specifically annotated in this document, those skilled in the art can refer to various commonly used reference books, scientific and technological documents or related instructions and manuals prior to the filing date of this invention to carry out the operations.

[0048] A recombinant *E. coli* strain capable of whole-cell catalytic synthesis of L-cysteine, wherein the recombinant *E. coli* strain is constructed by the following method:

[0049] First of all, Figure 6 Knockout of L-serine dehydratase in BL21 (DE3) Escherichia coli and sdaA Genes; subsequently, on tdcG K-12-derived tryptophan synthase β subunit gene Escherichia coli Site-directed mutagenesis was performed to obtain a mutant β subunit gene with higher enzyme activity. Then, the recombinant plasmid was constructed to efficiently overexpress the mutant β subunit gene in the strain. and tryptophan synthase α subunit gene trpBRecombinant Escherichia coli was obtained;

[0050] Among them, the trpA The nucleotide sequence of the gene is SEQ ID No. 1. sdaA The nucleotide sequence of the gene is SEQ ID No. 2, tryptophan synthase α subunit gene. tdcG The nucleotide sequence is SEQ ID No. 3, tryptophan synthase β subunit gene. trpA The nucleotide sequence is SEQ ID No. 4, and it is the result of a site-directed mutation in the tryptophan synthase β subunit gene. The nucleotide sequence is SEQ ID No. 5.

[0051] Furthermore, the aforementioned trpB Genes originate from sdaA 1 (DE3), Escherichia coli BL2 Genes originate from tdcG BL21 (DE3);

[0052] Or, the Escherichia coli Genes originate from Genes originate from trpA Escherichia K-12, coli Genes originate from trpB K-12.

[0053] Furthermore, the specific steps are as follows:

[0054] (1) Knockout via homologous recombination technology Escherichia coli BL21 (DE3) Escherichia coli Genes and sdaA Genes were used to reduce the conversion of L-serine to pyruvate, and recombinant strains were constructed. tdcG Cys-1;

[0055] (2) Amplify separately from E. coli K-12 Escherichia coli Genes and mutations The gene was ligated into the vector pET-28a to construct the recombinant plasmid pET28a- trpA -1, and transform the plasmid to trpAB Cys-1, obtaining recombinant strains capable of expressing tryptophan synthase mutants. E. coli Cys-2 was used to obtain recombinant Escherichia coli.

[0056] The application of recombinant Escherichia coli as described above in the catalytic synthesis of L-cysteine.

[0057] The method for synthesizing L-cysteine ​​using whole-cell catalysis of recombinant Escherichia coli as described above includes the following steps:

[0058] Recombinant Escherichia coli was induced and cultured, and the bacterial cells were collected for whole-cell catalysis to achieve efficient synthesis of L-cysteine.

[0059] Furthermore, the specific steps are as follows:

[0060] (1) Culture recombinant Escherichia coli to express intracellular tryptophan synthase TrpAB under induction conditions. The bacterial cells were collected by centrifugation.

[0061] (2) The collected bacterial cells, substrate L-serine, and sulfur source are combined to form a reaction system, and an enzyme-catalyzed reaction is carried out under alkaline conditions to generate L-cysteine.

[0062] Furthermore, the specific culture steps for culturing the recombinant strain in step (1) are as follows:

[0063] 1) Resuscitation of recombinant Escherichia coli from glycerol storage tubes: First, five loops of bacteria were picked using a sterile inoculation loop and streaked onto LB agar slant tubes containing 100 mg / L kanamycin, and incubated overnight at 37 ℃; then, all colonies on the slant tubes were streaked again onto LB agar slant tubes containing 100 mg / L kanamycin, and incubated overnight at 37 ℃ to obtain sufficient healthy bacteria as seed source;

[0064] 2) Inoculate all the bacterial cells from the solid slant of the eggplant-shaped flask into TB liquid fermentation medium containing 100 mg / L kanamycin, and add it to the fermenter at a filling factor of 60% for fermentation. During fermentation, the aeration rate is maintained at 3 L / min, the dissolved oxygen is controlled at 20% to 40%, and the pH is stabilized at 7.0 by automatically adding ammonia water. The culture temperature is set at 37 ℃.

[0065] 3) When the bacterial cells grow to OD 600 When the temperature reaches 40-60°C, IPTG with a final concentration of 0.1 mM is added to the fermenter to induce the expression of the recombinant protein. During the induction phase, the temperature is lowered to 25 °C, and the culture is continued for 20 h. After induction, the cells are collected by centrifugation at 8000 r / min for 15 min for subsequent enzyme preparation and catalytic reactions.

[0066] Further, the formulation of LB solid medium in step 1) is as follows: glucose 5g / L, peptone 10g / L, beef extract 10g / L, yeast powder 5g / L, agar 25g / L, NaCl 2.5g / L, kanamycin 100 mg / L; sterilize at 115℃ for 15 min.

[0067] Alternatively, each 2L of the TB liquid fermentation medium described in step 2) contains: 10g peptone, 10g yeast powder, 30g glycerol, 26g potassium dihydrogen phosphate, 20g dipotassium hydrogen phosphate, 3.4g citric acid, 8g ammonium sulfate, and 2mL of defoamer.

[0068] Further, in step (2), each 50 mL reaction system consists of: 1 M L-serine, 1.1 M sulfur donor, 0.5 mmol / L pyridoxal phosphate, 50 g / L cell concentration, water as solvent, pH adjusted to 8.5 with HCl during the reaction, reaction temperature of 40℃, and reaction time of 2 h.

[0069] Furthermore, the sulfide donor is sodium hydrosulfide or sodium sulfide.

[0070] Specifically, the relevant preparation and testing methods are as follows:

[0071] A method for producing L-cysteine ​​includes the following steps:

[0072] Example 1: Construction of an engineered Escherichia coli strain lacking L-serine dehydratase E. coli Cys-1

[0073] 1. E. coli gene knockout

[0074] by sdaA BL21 (DE3) was the starting strain, and the L-serine dehydratase gene in its genome was knocked out using gene editing technology. Escherichia coli The knockout fragment was identified by PCR and verified by sequencing to obtain recombinant strains. sdaA Δ E. coli .

[0075] according to sdaA Design upstream homologous arm primers UP- for gene upstream and downstream sequences. sdaA -S (SEQ ID No. 7), UP- sdaA -A (SEQ ID No. 8) and downstream homologous arm primer DN- [[ID=(88)]]sdaA -S (SEQ ID No. 9), DN- sdaA -A (SEQ ID No. 10). With sdaA Using BL21 (DE3) genomic DNA as a template, the sample was amplified by PCR. Escherichia coli The upstream and downstream homologous arms of the gene were obtained, and the two homologous arms were spliced ​​together using recombinant PCR to construct a homologous recombination fragment for gene knockout. Primers gRNA- sdaA -S (SEQ ID No. 11) and gRNA- sdaA -A (SEQ ID No. 12) Annealing forms containingsdaA The gRNA fragment of the target sequence was homologously recombinated with the linearized pGRB vector to construct the editing plasmid pGRB- sdaA The constructed pGRB- sdaA Electroporation was performed on the above homologous recombination fragments together with a plasmid containing pREDCas9. sdaA Single colonies were obtained from competent cells after resuscitation and plate culture. Colony identification was performed by PCR to screen for... E. coli The positive recombinant with successful gene knockout then loses pGRB- sdaA Achieving stable sdaA Single knockout strain sdaA Δ E. coli . sdaA The construction process of the knockout fragment and the PCR verification electrophoresis image of the positive clone are shown in [link to documentation]. sdaA .

[0076] The upstream homologous arm is 479 bp long, the downstream homologous arm is 496 bp long, and the total length of the spliced ​​knockout fragment is 975 bp. During PCR verification, the amplified band of the positive recombinant strain should be 975 bp, while the amplified band of the unedited original strain is 2340 bp long. The two are significantly different and can be used to effectively distinguish them.

[0077] Containing pREDCas9 plasmid Figure 1 The method for preparing competent cells is as follows: culturing at 32℃ until OD... 600 When the concentration is 0.1, add IPTG to a final concentration of 0.1 mM and continue culturing until OD reaches 0.1. 600 Competent cells were prepared at a pH of 0.2-0.3. The purpose of adding IPTG was to induce the expression of the recombinase on the pREDCas9 plasmid. The culture medium and preparation process for competent cells followed standard operating procedures. The PCR system and method are shown in Table 1 below, and the overlap PCR system is shown in Table 2 below.

[0078] Table 1 PCR amplification system

[0079]

[0080] Table 2 Overlap PCR Amplification System

[0081]

[0082] PCR reaction conditions (Baori Bio PrimeSTAR HS DNA Polymerase): pre-denaturation (95℃) for 5 min; denaturation (98℃) for 10 s, annealing (60℃) for 15 s, extension at 72℃, 30 cycles; further extension at 72℃ for 10 min; incubation at 4℃.

[0083] 2. E. coli gene knockout

[0084] by tdcG Δ E. coli As the starting strain, the L-serine dehydratase gene in its genome was knocked out using gene editing technology. sdaA The knockout fragment was identified by PCR and verified by sequencing to obtain recombinant strains. tdcG Cys-1 ( E. coli Δ E. coli Δ sdaA ).

[0085] according to tdcG Design upstream homologous arm primers UP- for gene upstream and downstream sequences. [[ID=1(15)]]tdcG -S (SEQ ID No. 13), UP- tdcG -A (SEQ ID No. 14) and downstream homologous arm primer DN- tdcG -S (SEQ ID No. 15), DN- tdcG -A (SEQ ID No. 16). With tdcG Δ E. coli Using genomic DNA as a template, it was obtained by PCR amplification. sdaA The upstream and downstream homologous arms of the gene were obtained, and the two homologous arms were spliced ​​together using recombinant PCR to construct a homologous recombination fragment for gene knockout. Primers gRNA- tdcG -S (SEQ ID No. 17) and gRNA- tdcG -A (SEQ ID No. 18) Annealing forms containing tdcG The gRNA fragment of the target sequence was homologously recombinated with the linearized pGRB vector to construct the editing plasmid pGRB- tdcG The constructed pGRB- tdcG Electroporation was performed on the above homologous recombination fragments together with a plasmid containing pREDCas9. tdcG Δ E. coli Single colonies were obtained from competent cells after resuscitation and plate culture. Colony identification was performed by PCR to screen for... sdaA The positive recombinant with successful gene knockout then loses pGRB- tdcG Achieving stable tdcG Knockout strains are also known as recombinant strains sdaA, tdcG Cys-1 ( E. coli Δ E. coli Δ ). sdaA The construction process of the knockout fragment and the PCR verification electrophoresis image of the positive clone are shown in [link to documentation]. tdcG .

[0086] The upstream homologous arm is 406 bp long, the downstream homologous arm is 483 bp long, and the total length of the spliced ​​knockout fragment is 889 bp. During PCR verification, the amplification band of the positive recombinant strain should be 1086 bp, while the amplification band of the unedited original strain is 2189 bp long. The two are significantly different and can be used to effectively distinguish them.

[0087] Containing pREDCas9 plasmid tdcG Δ Figure 2 The method for preparing competent cells is as follows: culturing at 32℃ until OD... 600 When the concentration is 0.1, add IPTG to a final concentration of 0.1 mM and continue culturing until OD reaches 0.1. 600 Competent cells were prepared at a pH of 0.2-0.3. The purpose of adding IPTG was to induce the expression of the recombinase on the pREDCas9 plasmid. The culture medium and preparation process for competent cells followed standard operating procedures. The PCR system and method are shown in Table 1, and the overlap PCR system is shown in Table 2.

[0088] Example 2 Recombinant strain E. coli Determination of L-serine degradation rate by Cys-1

[0089] To verify knockout sdaA Genes and recombinant strains E. coli Cys-1 ( sdaA Δ E. coli Δ E. coli The effect of ) on L-serine degradation ability, with the starting strain and single knockout strain sdaA Gene strains and recombinant strains tdcG Cys-1 ( E. sdaA Δ E. coli Δ coli Parallel control experiments were conducted. Three bacterial strains were inoculated into TB liquid medium and cultured at 37 ℃ and 220 rpm until the logarithmic growth phase. After collecting the cells, they were washed with PBS buffer and resuspended. The resuspended cells were added to 50 mL of 1 M L-serine solution to achieve a cell concentration of 50 g / L. The pH of the reaction system was adjusted to 8.5 using 6 mol / L NaOH solution, and the reaction was carried out in a shaker for 2 h. After the reaction, samples were taken, centrifuged at 13000 rpm for 1 min, and the supernatant was used to determine the residual L-serine content by high-performance liquid chromatography (HPLC).

[0090] The PBS buffer contains 8 g / L NaCl, 0.2 g / L KCl, 1.42 g / L Na2HPO4, and 0.27 g / L KH2PO4. After weighing the reagents, first dissolve them in 800 mL of ultrapure water, then add concentrated NaOH solution to adjust the pH to 7.4, and finally bring the volume to 1 L.

[0091] The results showed that after 2 hours of reaction, the degradation rate of L-serine by the starting strain was 34.1%; single knockout sdaA The L-serine degradation rate of the strain decreased to 10.6%; while that of the recombinant strain... tdcG The L-serine degradation rate of Cys-1 was 2.5%. Compared with the original strain, this engineered strain reduced the degradation of L-serine by approximately 92.7%, significantly weakening its ability to decompose L-serine. The L-serine degradation rate was determined as follows: sdaA As shown.

[0092] Example 3 Site-directed mutagenesis of tryptophan synthase E. coli Subunit-constructed engineered strains Figure 3 Cys-2

[0093] In the above trpB Based on the Cys-1 strain, to further improve the synthesis efficiency of L-cysteine, this invention utilizes strains derived from Cys-1. E. coli K-12 tryptophan synthase E. coli Genes undergo site-directed mutagenesis. This invention uses structural simulation and molecular docking for screening. First, the three-dimensional structure of tryptophan synthase is obtained from the PDB database, along with the structural information of the substrate L-serine. Subsequently, on the CB-DOCK2 platform ( Escherichia coli trpB CB-Dock2: An accurate protein-ligand blind Note: There seems to be a formatting issue with the original text where "(88)" and "1(15)" are not standard notations. They are kept as-is in the translation for consistency with the original. If these are errors in the original, they should be corrected before translation for a more accurate result. docking tool Molecular docking of the enzyme and substrate was performed, and the sites potentially affecting catalytic efficiency were comprehensively analyzed using parameters such as binding energy, conformational stability, and substrate channel spatial changes. Screening results showed that His86 and Gln114, located near the substrate binding channel, have a significant impact on enzyme-substrate binding. Therefore, in trpB Two key residues located near the catalytic center in the amino acid sequence were selected for modification, namely H86W and Q114M.

[0094] Obtaining products containing double mutation sites through artificial synthesis Gene (SEQ ID No. 5), and trpA Genes are assembled together to construct a mutant. trpAB Gene fragments. Restriction endonucleases were used. SaI I and HindIII. The vector pET-28a (SEQ ID No. 6, pET-28a is a commercially available plasmid) was double-digested with enzymes to ensure that the vector and the gene fragment to be inserted have the same sticky ends. Based on... trpAB Primers for amplification were designed based on the upstream and downstream sequences of the gene and the pET-28a restriction site, with the upstream primer being UP- trpAB -S (SEQ ID No. 19), downstream primer is DN- trpAB -A (SEQ ID No. 20). The target fragment was obtained by PCR amplification using a synthetic gene as a template. trpAB The PCR product and the linearized pET-28a fragment, which had undergone double enzyme digestion, were ligated at their homologous ends using Takara T4 DNA ligase to construct the recombinant expression plasmid pET28a- trpAB - 1. After confirming the sequence is correct through sequencing, the obtained expression vector is transformed into... E. coli In Cys-1 strain, an engineered strain successfully expressing tryptophan synthase was obtained through resistance selection. The enzyme-digested plasmid band was 5350 bp, and the correctly verified band was 2184 bp. (See attached image) Figure 4 .

[0095] Example 4: Construction of a control strain expressing wild-type tryptophan synthase E. coli Cys-3

[0096] In constructing mutant recombinant strains E. coli Along with Cys-2, this invention also constructed a control strain expressing wild-type tryptophan synthase for comparative evaluation. trpB The effect of mutations on catalytic performance. Specifically, firstly, unmodified amino acid residues were... trpA Genes and trpB Genes are synthesized artificially or amplified by PCR to obtain complete genes. trpAB Gene fragments. Subsequently, using the same procedures as for constructing mutant plasmids, [the following was performed]. SaI I and Hind The vector pET-28a was treated with double enzyme digestion (III) to generate sticky ends that could pair with the target gene fragment. Then, Takara T4 DNA ligase was used to ligate the DNA. trpAB The gene fragment was ligated into the linearized pET-28a vector to construct the expression vector pET28a- trpAB -2. After transformation, screening, and sequence verification, it was confirmed that sequences containing [the desired sequence] were successfully obtained. trpABRecombinant expression plasmids of genes are transformed into E. coli In Cys-1 recipient strains, engineered strains that successfully express tryptophan synthase were obtained through resistance selection. E. coli Cys-3 ( E. coli Δ sdaA Δ tdcG -pET-28a- trpAB (The band of the enzyme-digested plasmid was 5350 bp, and the band that was verified to be correct was 2184 bp. See...) Figure 5 .

[0097] Example 5 Recombinant strain E. coli Cys-2 and E. coli Fermentation enzyme production and induced expression of Cys-3

[0098] ①Recombinant strains Escherichia coli Cys-2 and Escherichia coli Cys-3 cells were revived from glycerol culture tubes. First, approximately 5 loops of bacterial cells were picked using a sterile inoculation loop and streaked onto LB slant tubes containing 100 mg / L kanamycin, and incubated overnight at 37 °C. Subsequently, all colonies from the slant tubes were streaked again onto LB slant tubes containing the same 100 mg / L kanamycin, and incubated overnight at 37 °C to obtain sufficient healthy cells as a seed source. The formulation of the LB slant medium is shown in Table 3.

[0099] Table 3

[0100]

[0101] ② Inoculate all the bacterial cells from the solid slant culture in the flask into TB liquid fermentation medium containing 100 mg / L kanamycin, and add it to the fermenter at a 60% packing factor for fermentation. During fermentation, maintain an aeration rate of 3 L / min, control dissolved oxygen at 20%–40%, and stabilize the pH at 7.0 by automatically adding ammonia. Set the culture temperature to 37 ℃.

[0102] The 2L liquid fermentation medium in the TB fermenter contains: 10g peptone, 10g yeast powder, 30g glycerol, 26g potassium dihydrogen phosphate, 20g dipotassium hydrogen phosphate, 3.4g citric acid, 8g ammonium sulfate, and 2mL defoamer (foam ant)

[0103] ③ When the bacterial cells grow to OD 600At approximately 40-60°C, IPTG at a final concentration of 0.1 mM was added to the fermenter to induce recombinant protein expression. During the induction phase, the temperature was lowered to 25°C, and the culture was continued for 20 h. After induction, the cells were collected by centrifugation at 8000 r / min for 15 min for subsequent enzyme preparation and catalytic reactions.

[0104] Example 6 Recombinant strain E. coli Cys-2 and E. coli Cys-3 whole-cell catalytic synthesis of L-cysteine

[0105] The recombinant strain obtained from the construction E. coli Cys-2 and E. coli Cys-3 cells were inoculated into TB liquid medium containing 100 mg / L kanamycin and cultured at 37 ℃ and 220 rpm until OD500. 600 Approximately 0.6-0.8. Then, IPTG was added to a final concentration of 0.1 mM for induction, and the cells were cultured at 25 °C for another 20 h to achieve high-efficiency expression of the TrpAB enzyme system. After culture, the cells were collected by centrifugation at 8000 rpm, washed twice with PBS buffer, and resuspended for later use.

[0106] 1 M L-serine, 1.1 M sulfide donor (sodium hydrosulfide or sodium sulfide), 0.5 mmol / L pyridoxal phosphate, and 50 g / L (wet weight) of treated cells were added sequentially to the reaction vessel, with a total volume of 50 mL. The reaction temperature was set at 35 °C, and the pH was adjusted to 8.5 with HCl during the reaction. The reaction time was 2 h. After the reaction, high-performance liquid chromatography (HPLC) was used to determine the composition of the samples. E. coli The Cys-2 strain produced 114 g / L of L-cysteine, with a molar conversion rate of 94.2% from L-serine to L-cysteine, resulting in a production efficiency of 57 g / L / h. The whole-cell catalytic reaction process was as follows: Figure 6 As shown. E. coli The Cys-3 strain produced 105 g / L of L-cysteine, with a molar conversion rate of 86.8% from L-serine to L-cysteine ​​and a production efficiency of 52.5 g / L / h.

[0107] The results showed that the expression of mutant TrpAB engineered strains E. coli Cys-2 has significantly higher catalytic efficiency than TrpAB expressing wild type. E. coli Compared to the control Cys-3, Cys-2 showed an approximately 8.57% increase in L-cysteine ​​production and an approximately 8.52% improvement in conversion rate, demonstrating a significant catalytic advantage. These results indicate that... trpBThe H86W and Q114M double mutations in the gene can enhance the overall catalytic efficiency of the tryptophan synthase complex, increase the conversion flux of substrate L-serine to product L-cysteine, and allow more metabolic flux to converge on the cysteine ​​synthesis pathway, thereby significantly improving the overall yield of the whole-cell catalytic system.

[0108] Compared with existing technologies, this invention achieves its advantages by simultaneously knocking out key genes in the L-serine degradation pathway in wild-type strains. and sdaA Furthermore, a double-mutated tryptophan synthase was introduced, achieving synergistic optimization of substrate protection and enhanced catalytic efficiency. Based on this, the constructed engineered strain can be directly used for whole-cell catalytic synthesis of L-cysteine, making the metabolic flux from L-serine to L-cysteine ​​more concentrated. This results in high yields without significantly increasing the amount of coenzyme or enzyme. A 50 mL system with 1 M L-serine substrate can achieve efficient conversion in 2 h, with an L-cysteine ​​yield as high as 114 g / L and a molar conversion rate of 94.2% from L-serine to L-cysteine. This demonstrates promising prospects for industrial application.

[0109] The relevant sequences are as follows:

[0110] The sequences used in this invention are as follows:

[0111] SEQ ID No. 1: tdcG

[0112]

[0113] SEQ ID No.2: sdaA

[0114]

[0115] SEQ ID No.3: tdcG

[0116] ATGGAACGCTACGAATCTCTGTTTGCCCAGTTGAAGGAGCGCAAAGAAGGCGCATTCGTTCCTTTCGTCACGCTCGGTGATCCGGGCATTGAGCAGTCATTGAAAATTATCGATACGCTAATTGAAGCCGGTGCTGACGCGCTGGAGTTAGGTATCCCCTTCTCCGACCCACTGGCGGATGGCCCGACGATTCAAAACGCCACTCTGCGCGCCTTTGCGGCAGGTGTGACTCCGGCACAATGTTTTGAAATGCTGGCACTGATTCGCCAGAAACACCCGACCATTCCCATTGGCCTGTTGATGTATGCCAATCTGGTGTTTAACAAAGGCATTGATGAGTTTTATGCCCAGTGCGAAAAAGTCGGCGTCGATTCGGTGCTGGTTGCCGATGTGCCAGTTGAAGAGTCCGCGCCCTTCCGCCAGGCCGCGTTGCGTCATAATGTCGCACCTATCTTCATCTGCCCGCCAAATGCCGATGACGACCTGCTGCGCCAGATAGCCTCTTACGGTCGTGGTTACACCTATTTGCTGTCACGAGCAGGCGTGACCGGCGCAGAAAACCGCGCCGCGTTACCCCTCAATCATCTGGTTGCGAAGCTGAAAGAGTACAACGCTGCACCTCCATTGCAGGGATTTGGTATTTCCGCCCCGGATCAGGTAAAAGCAGCGATTGATGCAGGAGCTGCGGGCGCGATTTCTGGTTCGGCCATTGTTAAAATCATCGAGCAACATATTAATGAGCCAGAGAAAATGCTGGCGGCACTGAAAGTTTTTGTACAACCGATGAAAGCGGCGACGCGCAGTTAA

[0117] SEQ ID No.4: trpA trpB

[0118]

[0119] (H86W、Q114M)

[0120]

[0121] SEQ ID No. 6: pET-28a vector plasmid

[0122]

[0123] The primers used in the strain construction process are shown in Table 4 below:

[0124] Table 4

[0125]

[0126] Although embodiments of the invention have been disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, variations, and modifications are possible without departing from the spirit and scope of the invention and the appended claims. Therefore, the scope of the invention is not limited to the contents disclosed in the embodiments.

Claims

1. A recombinant *Escherichia coli* strain capable of whole-cell catalytic synthesis of L-cysteine, characterized in that: The recombinant Escherichia coli was constructed using the following method: First of all, Escherichia coli Knockout of L-serine dehydratase in BL21 (DE3) sdaA and tdcG Genes; subsequently, on Escherichia coli K-12-derived tryptophan synthase β subunit gene trpB Site-directed mutagenesis was performed to obtain a mutant β subunit gene with higher enzyme activity. trpB * Then, a recombinant plasmid was constructed to overexpress the mutant β subunit gene in the strain. trpB * and tryptophan synthase α subunit gene trpA Recombinant Escherichia coli was obtained; Among them, the sdaA The nucleotide sequence of the gene is SEQ ID No.

1. tdcG The nucleotide sequence of the gene is SEQ ID No. 2, tryptophan synthase α subunit gene. trpA The nucleotide sequence is SEQ ID No. 3, tryptophan synthase β subunit gene. trpB The nucleotide sequence is SEQ ID No. 4, mutant β subunit gene. trpB * The nucleotide sequence is SEQ ID No.

5.

2. The recombinant Escherichia coli according to claim 1, characterized in that: The specific steps are as follows: (1) Knockout via homologous recombination technology Escherichia coli BL21 (DE3) sdaA Genes and tdcG Genes were used to reduce the conversion of L-serine to pyruvate, and recombinant strains were constructed. E. coli Cys-1; (2) Amplify separately from Escherichia coli K-12 trpA Genes and trpB * The gene was ligated into the vector pET-28a to construct the recombinant plasmid pET28a- trpAB *-1, and transform the plasmid into... E. coli Cys-1, obtaining recombinant strains capable of expressing tryptophan synthase mutants. E. coli Cys-2 was used to obtain recombinant Escherichia coli.

3. The application of the recombinant Escherichia coli as described in claim 1 or 2 in the catalytic synthesis of L-cysteine.

4. A method for synthesizing L-cysteine ​​using whole-cell catalysis of recombinant Escherichia coli as described in claim 1 or 2, characterized in that: Includes the following steps: Recombinant Escherichia coli was induced and cultured, and the bacterial cells were collected for whole-cell catalysis to achieve the synthesis of L-cysteine.

5. The method according to claim 4, characterized in that: The specific steps are as follows: (1) Culture recombinant Escherichia coli to express intracellular tryptophan synthase TrpAB* under induction conditions, and collect the bacterial cells by centrifugation; (2) The collected bacterial cells, substrate L-serine, and sulfur source are combined to form a reaction system, and an enzyme-catalyzed reaction is carried out under alkaline conditions to generate L-cysteine.

6. The method according to claim 5, characterized in that: The specific culture steps for culturing recombinant Escherichia coli in step (1) are as follows: 1) Resuscitation of recombinant Escherichia coli from glycerol storage tubes: First, five loops of bacteria were picked using a sterile inoculation loop and streaked onto LB agar slants containing 100 mg / L kanamycin in test tubes, and incubated overnight at 37 ℃; then, all colonies on the test tube slants were streaked again onto LB agar slants containing 100 mg / L kanamycin in a flask, and incubated overnight at 37 ℃ to obtain sufficient healthy bacteria as a seed source; 2) Inoculate all the bacterial cells from the solid slant of the eggplant-shaped flask into TB liquid fermentation medium containing 100 mg / L kanamycin, and add it to the fermenter at a filling factor of 60% for fermentation. During fermentation, the aeration rate is maintained at 3 L / min, the dissolved oxygen is controlled at 20% to 40%, and the pH is stabilized at 7.0 by automatically adding ammonia water. The culture temperature is set at 37 ℃. 3) When the bacterial cells grow to OD 600 When the temperature reaches 40-60°C, IPTG with a final concentration of 0.1 mM is added to the fermenter to induce the expression of recombinant protein. During the induction phase, the temperature is lowered to 25 °C and cultured for another 20 h. After induction, the cells are collected by centrifugation at 8000 r / min for 15 min for subsequent enzyme preparation and catalytic reaction.

7. The method according to claim 6, characterized in that: The formula for LB solid medium in step 1) is: glucose 5g / L, peptone 10g / L, beef extract 10g / L, yeast powder 5g / L, agar 25g / L, NaCl 2.5g / L, kanamycin 100mg / L; sterilize at 115℃ for 15 min. Alternatively, each 2L of the TB liquid fermentation medium described in step 2) contains: 10g peptone, 10g yeast powder, 30g glycerol, 26g potassium dihydrogen phosphate, 20g dipotassium hydrogen phosphate, 3.4g citric acid, 8g ammonium sulfate, and 2mL of defoamer.

8. The method according to any one of claims 5 to 7, characterized in that: In step (2), each 50 mL reaction system consists of: 1 M L-serine, 1.1 M sulfur donor, 0.5 mmol / L pyridoxal phosphate, 50 g / L cell concentration, water as solvent, pH adjusted to 8.5 with HCl during the reaction, reaction temperature of 40 ℃, and reaction time of 2 h.

9. The method according to claim 8, characterized in that: The sulfide donor is sodium hydrosulfide or sodium sulfide.

Citation Information

Patent Citations

  • Method for preparing L-cysteine through enzymatic conversion

    CN102517352A

  • Method for synthesizing L-cysteine through immobilized enzyme conversion of DL-ATC (DL-2-amino-delta<2>-thiazoline-4-carboxylic acid)

    CN105177076A

  • Tryptophan synthetase mutant and application thereof

    CN115261365A

  • Tryptophan synthase mutant and application thereof in preparation of cysteine and cystine

    CN117683760A

  • Tryptophan synthetase mutant with improved enzymatic activity and application of tryptophan synthetase mutant in production of L-cysteine

    CN120026015A