PTGER4 overexpression adeno-associated virus vector drug and application thereof in atopic dermatitis

Abstract

The invention relates to a PTGER4 agonist for treating atopic dermatitis or a medicine for promoting the overexpression of PTGER4, the medicine for promoting the overexpression of PTGER4 is RNA (Ribonucleic Acid) for the overexpression of PTGER4, the sequence of the RNA is shown as SEQ ID NO.1, and the PTGER4 agonist is L-902, 688. According to the PTGER4 agonist and the PTGER4 overexpression adeno-associated virus, the PTGER4 activation or overexpression effect is achieved through local external application or intradermal injection, atopic dermatitis symptoms are improved, and the PTGER4 agonist and the PTGER4 overexpression adeno-associated virus have wide application prospects in the aspect of clinical treatment of atopic dermatitis.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to a PTGER4-overexpressing adeno-associated virus vector drug and its application in atopic dermatitis. Background Technology

[0002] Atopic dermatitis (AD) is a common, highly heritable inflammatory skin disease affecting children and adults worldwide. It is characterized by a chronic, relapsing pattern, clinically presenting as an itchy inflammatory response leading to dry, thickened, cracked, and scaling skin. Epidemiological studies have shown a significant association between extreme environmental temperatures (hot and cold) and increased atopic dermatitis-related visits, while higher humidity levels may be associated with increased disease severity. Atopic dermatitis not only impairs skin barrier function and increases transepidermal water loss but is also associated with significant impairment of patients' quality of life, impacting both patients and their caregivers in multiple ways.

[0003] Currently, the main treatments for atopic dermatitis include: basic treatment emphasizes the use of moisturizers to maintain skin barrier function; first-line topical medications include low-potency topical corticosteroids and topical calcineurin inhibitors for anti-inflammatory and immunomodulatory purposes in mild to moderate cases. For moderate to severe cases that are difficult to control with topical therapies, systemic therapy becomes crucial: phototherapy and traditional immunosuppressants are important options. Targeted biologics such as Dupilumab are currently the only FDA-approved biologic for moderate to severe atopic dermatitis, and are safe and effective. Janus kinase inhibitors provide new oral treatment options by modulating the JAK-STAT pathway, and disease activity can be managed through continuous use or dose adjustment. In addition, phosphodiesterase-IV inhibitors, as novel topical medications, are suitable for mild to moderate atopic dermatitis. Furthermore, emerging research directions in the treatment of atopic dermatitis include optimizing drug penetration using nanoparticle skin delivery systems and reusing existing drugs to fill treatment gaps.

[0004] There are currently no reports of using PTGER4-overexpressing adeno-associated virus vector drugs to treat atopic dermatitis. Summary of the Invention

[0005] To solve the above-mentioned technical problems, the present invention includes the following aspects:

[0006] A first aspect of the present invention provides a medicament for the prevention or treatment of atopic dermatitis, said medicament being a PTGER4 agonist or a medicament that promotes PTGER4 overexpression.

[0007] Preferably, the drug that promotes PTGER4 overexpression is PTGER4 overexpression RNA, the sequence of which is shown in SEQ ID NO.1.

[0008] Preferably, the drug that promotes PTGER4 overexpression is administered via local intradermal injection.

[0009] Preferably, the PTGER4 agonist is L-902,688.

[0010] Preferably, the PTGER4 agonist is administered transdermally.

[0011] A second aspect of the present invention provides an adeno-associated virus vector pharmaceutical composition for the prevention or treatment of atopic dermatitis, the pharmaceutical composition comprising a drug that promotes PTGER4 overexpression and an adeno-associated virus (AAV) as a vector, wherein the drug that promotes PTGER4 overexpression is PTGER4 overexpressing RNA, the sequence of which is shown in SEQ ID NO.1.

[0012] Preferably, the AAV is a serum type 9 vector.

[0013] Preferably, the pharmaceutical composition is a local intradermal injection formulation.

[0014] A third aspect of the invention provides the use of the above-described medicament or pharmaceutical composition in the preparation of a medicament for the prevention or treatment of atopic dermatitis.

[0015] Preferably, the drug or drug composition prevents or treats atopic dermatitis by upregulating the expression level of PTGER4 or activating PTGER4.

[0016] More preferably, the drug or pharmaceutical composition that promotes PTGER4 overexpression prevents or treats atopic dermatitis by upregulating the expression level of PTGER4, and the PTGER4 agonist prevents or treats atopic dermatitis by activating PTGER4.

[0017] A fourth aspect of the present invention provides a kit for detecting the PTGER4 gene and its application in the preparation of reagents for early screening, early diagnosis, efficacy evaluation and follow-up, and prognostic assessment of patients with atopic dermatitis.

[0018] The technical effects of this invention are as follows:

[0019] 1. This invention unexpectedly discovered the differentially expressed site PTGER4, which is significantly associated with atopic dermatitis, and for the first time revealed at the animal level the effect of overexpression of the differentially expressed gene PTGER4 on the treatment of atopic dermatitis.

[0020] 2. This invention is the first to synthesize a PTGER4-rAAV adeno-associated virus vector drug composition, which achieves PTGER4 overexpression through local skin injection, thereby improving the symptoms of atopic dermatitis. This drug composition provides a new drug option for the clinical treatment of atopic dermatitis and has broad application prospects. Attached Figure Description

[0021] Figure 1 This is a schematic diagram of the construction of the PTGER4 overexpression rAAV virus according to the present invention;

[0022] Figure 2 The therapeutic effect of keratinocyte-specific PTGER4 overexpression in an AD mouse model; among which Figure 2 A is a schematic diagram of the experimental protocol for inducing atopic dermatitis in K14-Cre C57BL / 6 mice via rAAV injection and DNCB. Figure 2 B represents the detection of Ptger4 mRNA expression levels by RT-qPCR (n=6). Figure 2 C represents the expression level of EP4 protein as determined by immunoblotting (n=3, GAPDH as an internal control). Figure 2 D represents the morphological results of skin lesions in mice treated with rAAV. Figure 2 E represents the H&E staining result after rAAV treatment. Figure 2 F represents the detection results of toluidine blue (TB) positive mast cells in skin tissue after rAAV treatment. Figure 2 G is the result of rAAV processing. Cellular results, Figure 2 H represents the rAAV processed value. Macrophage results, Figure 2 I represents the rAAV processed value. Neutrophil results; data in the figure are expressed as mean ± standard error, where , , .

[0023] Figure 3 This describes the therapeutic effects of the therapeutic agents L-902,688 in an AD mouse model; among which... Figure 3 A is a schematic diagram of the EP4 agonist treatment regimen in C57BL / 6 mice. Figure 3 B represents the morphological results of skin lesions in mice of each experimental group. Figure 3 C represents the H&E staining result. Figure 3 D represents the results of toluidine blue mast cell staining (TB staining); Figure 3 E is Cell immunofluorescence staining results, Figure 3 F is Macrophage immunofluorescence staining results; Figure 3G is Results of immunofluorescence staining of neutrophils. Detailed Implementation

[0024] Preparation Example 1: Preparation of PTGER4-rAAV and NC-rAAV adeno-associated viruses

[0025] The construction of rAAV9-CMV-DIO-PTGER4-P2A-EGFP and the virus requires a systematic process of molecular construction, viral packaging, and functional verification. The specific steps are as follows:

[0026] 1. Vector plasmid construction

[0027] Using plasmids containing ITR sequences, such as pAAV2.1, as a backbone, the codon-optimized PTGER4 coding sequence and the EGFP sequence were tandemly linked using a P2A self-cleaving peptide sequence (GSGATNFSLLKQAGDVEENPGP, SEQ ID NO.8) to form a single open reading frame. This sequence was inserted into a specially designed DIO expression frame, flanked by loxP and lox2722 sites with opposite orientations to ensure transcriptional silencing in the absence of Cre. The entire expression cassette (CMV promoter → DIO → PTGER4-P2A-EGFP → WPRE sequence) was cloned into the multiple cloning site of the AAV vector via the XbaI / EcoRI restriction endonuclease site. A schematic diagram of virus construction is shown below. Figure 1 The PTGER4 overexpression RNA sequence coated with the virus (NM_008965.2, mouse, 1542bp) is shown below:

[0028] a tggctgaggt tggaggtacc attcctagat cgaaccgtga gctccaacgc tgtgtgttactaaccaccac catcatgtcc atccccggag tcaacgcgtc cttctcctcc actccggaga ggctgaacagcccggtgacc attcccgcag tgatgttcat cttcgggggtcgcg t cgtagtattgtgcaagtcgc gcaaggagca gaaagagacg accttttaca ctctagtatg tgggctggct gtcactgaccttctgggcac cttgttggta agcccggtga ccatcgccac atacatgaag ggccagtggc ccggagaccaggcactgtc gctacctagt acctctctctcgc gtctcagcat catctgtgccatgagcatcg agcgctacct ggccatcaac cacgcctact tctacagcca ctacgtggac aagcggctggccggcctcac actcttcgcc atctatgcat ctaacgtgct gttctgcgcg ctgcccaaca tgggcccgc cgggcacctg gtgcttcatc gactggacca ccaacgtaac ggcctacgccgccttctt acatgtacgc cggcttcagc tccttcctca tccttgccac cgtgctctgc aacgtgctggtgtgcggcgc gctgctcgc agtt atgcaccgcc gcgcgcgcgcgc agcagcaccatgcggctgcc gccgccgcgg tagcttcggt ggcctgtcgg ggccacgctg gggcctcccc agccctgcagcgcctcagcg actttcgccg ccgcaggagt ttccggcgca tcgcgggtgc ggagatccag atggtcatcttacctcctcctcgtgtggtgctca tctgctccat tccgctcgtg gtgcgagtgt tcattaaccagttatatcag ccaaacgtgg tgaaagacat cagcagaaac ccagatttgc aggccatcag gattgcttctgtgaacccca tcctggaccc ctggatttac atccttcttc ggaagactgt gctcagtaaa gccatagagaagatcaagtg cctcttctgc cgcattggcg gttccggcag agacagctcg gcccagcact gctcagagagtcggaggaca tcttccgcca tgtccggcca ctctcgctcc ttcctcgccc gggagttaaa ggagatcagcagcacgtccc agaccctcct gtacctgcca gacctgactg aaagcagcct cggaggcagg aatttgcttccaggttcgca tggcatgggc ctgacccaag cagacaccac ctcgctgaga actttgcgaa tttccgagacctcagactcc tcccagggcc aggactctga gagtgtcctg ttggtggatg aggttagtgg gagccacagagaggagcctg cctctaaagg aaactctctg caagtcacat tccccagtga aactctgaaa ttatctgaaaaatgtatata g (SEQ ID NO. 1).

[0029] The NC-rAAV virus was constructed in the same way as above, using the entire expression cassette (CMV promoter → DIO-P2A-EGFP → WPRE sequence).

[0030] 2. Plasmid Validation and Preparation

[0031] Double enzyme digestion was performed for identification, and the expected bands were the CMV promoter fragment (~0.8 kb) and the DIO expression cassette (~2.3 kb). Sanger sequencing was performed to verify the PTGER4 coding region, P2A sequence, and loxP site. The recombinant vector plasmids required for the three-plasmid system were prepared using an endotoxin-free large-scale extraction kit.

[0032] 3. Virus packaging and purification

[0033] A three-plasmid co-transfection system was used in HEK293T cells at 80% confluence. PTGER4-rAAV was mixed at a mass ratio of 1:1:1 with pAAV-CMV-DIO-PTGER4-P2A-EGFP recombinant plasmid (30 μg), pAAV9 packaging plasmid (encoding Rep2 / Cap9 protein, 30 μg), and pHelper helper plasmid (30 μg). Transfection was performed in serum-free medium using PEI transfection reagent (mass ratio 1:3). Cell pellets were collected 72 hours post-transfection, and viral particles were released through repeated freeze-thaw cycles (-80℃ / 37℃, 3 cycles). The cells were then subjected to preliminary purification via heparin affinity chromatography, followed by iodixanol density gradient ultracentrifugation (50,000 rpm, 4℃, 2 h) and PBS dialysis to remove organic reagents. The NC-rAAV virus was packaged by mixing pAAV-CMV-DIO-P2A-EGFP recombinant plasmid (30 μg), pAAV9 packaging plasmid (encoding Rep2 / Cap9 protein, 30 μg), and pHelper helper plasmid (30 μg) at a mass ratio of 1:1:1. The remaining procedures were the same as those for the PTGER4-rAAV virus described above.

[0034] 4. Quality Control System

[0035] The purified virus was subjected to the following tests: (1) Viral genome titer determination: SYBR Green qPCR was used, primers were designed for the WPRE sequence, and quantification was performed using the standard curve method. The titer was required to be ≥1×10¹³ vg / mL. (2) Purity test: SDS-PAGE silver staining was used to detect the ratio of viral capsid proteins VP1 / VP2 / VP3 (the standard should be ~5:1:1). (3) Sterility test: No microbial growth was observed after culturing in LB medium at 37℃ for 72 hours. (4) Endotoxin test: Limulus amebocyte lysate (LAL) reagent method was used, and the requirement was <0.1 EU / mL. After testing, the PTGER4-rAAV and NC-rAAV viruses prepared in this preparation example met the relevant quality control conditions.

[0036] 5. Functional verification

[0037] Infecting K14-Cre-293T cell lines with the virus (MOI=10) 5 Wild-type 293T cells (Cre-negative) were set up as a control group. The following assays were performed 72 hours after infection: EGFP fluorescence expression was observed using laser confocal microscopy; infection efficiency and fluorescence intensity were quantified by flow cytometry; EP4 receptor expression was detected by Western blotting (using anti-EP4 monoclonal antibody, 1:1000); and PTGER4 mRNA expression levels were analyzed by RT-qPCR (primers across the P2A cleavage site).

[0038] The experimental results showed that the experimental group successfully activated the viral-carried gene components using Cre recombinase in K14-Cre-293T cells. Compared with the Cre-negative wild-type 293T control group, the experimental group showed a strong EGFP fluorescence signal 72 hours after infection. Flow cytometry showed high infection efficiency and fluorescence intensity, Western blotting detected significant EP4 receptor protein expression, and RT-qPCR confirmed a significant upregulation of PTGER4 mRNA levels. These results collectively confirm that the Cre-loxP system effectively mediates the specific overexpression of the target gene.

[0039] Experimental Example 1: The therapeutic effect of PTGER4-rAAV of the present invention in an AD mouse model

[0040] 1. Test Methods

[0041] 1.1 Experimental grouping and dosing regimen

[0042] The K14-Cre / C57BL / 6 mice used in this experiment were purchased from Guangzhou Cyagen Biosciences Co., Ltd. Genotyping was performed by PCR using the following primers: Upstream primer: CGATGGGAAAGTGTAGCCTGCA (SEQ ID NO.2), Downstream primer: TCCAGGTATGCTCAGAAAACGCC (SEQ ID NO.3). All animal experiments in this experiment were approved by the Institutional Ethics Committee of Anhui Medical University (Animal Ethics Committee Approval No.: LLSC20242207). All procedures were performed under isoflurane anesthesia.

[0043] The DNCB used in this experiment was purchased from Sigma-Aldrich, USA, AE3-208 (CAS No.: 402473-54-5, molecular formula: C). 24 H 21 FN2O3 (molecular weight: 404.43) was purchased from MCE Company in Shanghai, China. Before use, dissolve DNCB or AE3-208 in a mixture of acetone and olive oil at a volume ratio of 3:1.

[0044] Six-week-old female K14-Cre / C57BL / 6 mice were locally injected intradermally into the ear skin with recombinant AAV9 (rAAV9) encoding CMV-DIO-PTGER4-P2A-EGFP (experimental group, abbreviated as PTGER4-rAAV) and CMV-DIO-EGFP (control group, abbreviated as NC-rAAV), respectively. Using the Cre-loxP system, this strategy achieved keratinocyte-specific overexpression of the EP4 receptor (Ptger4) and simultaneous expression of the EGFP reporter gene. Intradermal injections were performed in a grid pattern, with 50 μL injected at each point to a depth of 1-2 mm (injection point spacing approximately 0.5 cm). The viral titer was 1 × 10⁻⁶. 12 Viral genome copies / mL. After each injection, carefully withdraw the needle and gently press with a sterile cotton ball to prevent leakage. RT-qPCR and Western blot analysis of isolated epidermal tissue 14 days after viral injection confirmed successful local PTGER4 overexpression.

[0045] To investigate the role of PTGER4 in the pathogenesis of dermatitis, after stable transgene expression was established in mice, 12 mice from the above experimental group were randomly divided into two groups of 6 mice each: the drug group (PTGER4-rAAV+DNCB) and the drug blocking group (PTGER4-rAAV+DNCB+AE3-208). Six mice from the above control group were used as the control drug group (NC-rAAV+DNCB). At the start of the experiment, on days 15 and 20, 20 μL of 2% DNCB solution was evenly applied to both ears of the mice (sensitization phase). From day 23, 20 μL of 0.5% DNCB solution was applied to both ears of the mice every 3 days until day 44. Thirty minutes before each application of the DNCB solution, 20 μL of 200 μM AE3-208 was applied topically to both ears. Mice were sacrificed on the day following the last administration (day 44). Skin tissue was collected from each experimental group for mRNA content determination, HE staining, toluidine blue staining, and immunofluorescence staining. Specific modeling and administration protocols for each experimental group are detailed below. Figure 2 A.

[0046] 1.2 Real-time reverse transcription PCR detection

[0047] After trimming subcutaneous tissue and decontaminating the skin, the samples were cut into strips approximately 2 cm × 0.25 cm for subsequent dispersant digestion. The tissue strips were immediately immersed in a tissue separation solution consisting of 10 mg of dispersant (Sigma-Aldrich, USA), 1 mL of sterile PBS, and physiological saline. Samples were delivered to the laboratory within 30 minutes. Skin biopsy tissue was placed epidermal side up and dermal side down in sterile culture dishes and incubated overnight at 4°C. Epidermal separation was observed the following day, revealing a brown, translucent layer. Total RNA was extracted from the skin of mice in each experimental group using TRIzol reagent (Invitrogen) according to the reagent instructions. Complementary DNA was synthesized using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). PCR primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the relevant primer sequences are shown in Table 1 below. cDNA was amplified using SYBR qPCR SuperMix Plus (novoprotetien scientific) and analyzed using Roche LightCycler 480 II. The expression levels of each gene were normalized using the internal control gene GAPDH, and 2... -ΔΔCt The method calculates the relative mRNA level.

[0048] Table 1 PCR primer sequences

[0049]

[0050] 1.3 Immunoblotting

[0051] The separated epidermal samples were lysed using RIPA lysis buffer (Beyond Biotech, Shanghai, China). Nitrocellulose membranes (PALL, USA) were incubated overnight at 4°C with EP4 and GADPH antibodies (Wuhan Sanying), followed by incubation with secondary antibodies for 40 minutes. The signals were then visualized using Super ECL Prime (UElandy).

[0052] 1.4 HE staining, toluidine blue staining, and immunofluorescence staining

[0053] Samples were extracted from the ear tissue of mice after the modeling process was completed, fixed in 10% formalin, and embedded in paraffin. The specimens were then cut into 4 μm thick sections. After dewaxing, the tissue sections were stained with hematoxylin and eosin (HE) and toluidine blue (TB). The sections, after antigen retrieval and serum blocking, were incubated overnight at 4°C with CD4 antibody (Abcam, USA), F4 / 80 antibody (Huaan Biotechnology, China), and MPO antibody (Huaan Biotechnology, China). The next day, the sections were incubated with secondary antibody labeled with Alexa Fluor 594. Images were taken using a fluorescence microscope (Zeiss, Germany).

[0054] 2. Test Results

[0055] The experimental results of each experimental group are as follows Figure 2 As shown. Compared with the control drug group, local injection of the PTGER4-rAAV of the present invention significantly increased the expression level of PTGER4 in mice ( Figure 2 B), redness and swelling in the mice's ears were reduced, and scaling decreased. Figure 2 D), HE staining showed mild epidermal thickening ( Figure 2 E), the number of mast cells infiltrating the dermis is reduced ( Figure 2 F), mouse dermal infiltration T cells, macrophages and Significantly reduced neutrophils ( Figure 2 (G-2I), indicating that the PTGER4-rAAV of the present invention can effectively improve AD symptoms in mice. Furthermore, in the drug blocking group of the present invention, the simultaneous administration of the therapeutic blocker AE3-208 led to a worsening of the aforementioned AD symptoms in mice, demonstrating that AE3-208 significantly reversed the AD therapeutic effect of PTGER4-rAAV.

[0056] Experimental Example 2: Therapeutic effect of therapeutic agent L-902,688 in an AD mouse model

[0057] 1. Test Methods

[0058] The wild-type female C57BL / 6 mice used in this experiment were purchased from the Animal Center of Anhui Medical University. All animal experiments were approved by the Institutional Ethics Committee of Anhui Medical University (Animal Ethics Committee Approval No.: LLSC20242207). All procedures were performed under isoflurane anesthesia.

[0059] The DNCB used in this experiment was purchased from Sigma-Aldrich, USA, L-902,688 (CAS No.: 634193-54-7, molecular formula: C). 21 H 27F2N5O2 (molecular weight: 419.5) was purchased from Cayman Laboratories, USA. AE3-208 (CAS No.: 402473-54-5, molecular formula: C) 24 H 21 FN2O3 (molecular weight: 404.43) was purchased from MCE Company in Shanghai, China. DNCB, L-902, 688 and AE3-208 were dissolved in a mixture of acetone and olive oil at a volume ratio of 3:1 before use.

[0060] A mouse model of atopic dermatitis-like skin inflammation was induced using DNCB, and the effects of the therapeutic agents L-902,688 and the therapeutic blocker AE3-208 on AD symptoms in the model mice were investigated. The specific methods were as follows: The experiment was divided into three groups, with six mice in each group: the model group (DNCB), the treatment group (DNCB+L-902,688), and the therapeutic blocker group (DNCB+L-902,688+AE3-208). All mice in each experimental group underwent ear hair removal on day 0. On days 1 and 5, 20 μL of a 2% DNCB solution was evenly applied to both ears of the mice (sensitization phase). Starting from day 8, 20 μL of a 0.5% DNCB solution was applied to both ears of the mice in each experimental group every three days for 29 days (challenge phase). The model group (DNCB) mice were treated according to the above modeling protocol. In the treatment group (DNCB+L-902,688), starting from day 1 of modeling, 20 μL of 200 μM L-902,688 was applied topically to both ears 30 minutes before each DNCB application. In the treatment blocking group (DNCB+L-902,688+AE3-208), starting from day 1 of modeling, 20 μL of 200 μM AE3-208 was applied topically to both ears. 30 minutes later, 20 μL of 200 μM L-902,688 was applied topically to the same locations on both ears. 30 minutes later, 20 μL of LDNCB was applied topically to the same locations on both ears. For specific modeling and administration protocols for each experimental group, please refer to [link to relevant documentation]. Figure 3 A. Mice were sacrificed on the same day after administration of the drug on day 29. Skin tissue was collected from each experimental group and subjected to HE staining, toluidine blue staining, and immunofluorescence staining. The specific experimental methods were the same as in Experiment 1.

[0061] 2. Test Results

[0062] The experimental results of each experimental group are as follows Figure 3 As shown. Compared with the model group, mice in the experimental group treated with L-902,688 showed reduced ear redness and swelling, and decreased scaling. Figure 3 B), HE staining showed mild epidermal thickening ( Figure 3 C), the number of mast cells infiltrating the dermis is reduced ( Figure 3 D), while mouse dermal infiltration cell, macrophages and Neutrophils were significantly reduced ( Figure 3 The results (E-3G) indicate that the therapeutic agent L-902,688 can effectively improve AD symptoms in mice. Furthermore, in the treatment blockade group, the simultaneous administration of the treatment blockade agent AE3-208 led to a worsening of the aforementioned AD symptoms, indicating that AE3-208 significantly reversed the AD treatment effect of L-902,688.

[0063] In summary, the PTGER4-rAAV adeno-associated virus prepared in this invention can achieve the effect of targeted promotion of PTGER4 expression through local skin injection, thereby improving the symptoms of atopic dermatitis. Similarly, L-902 and 688 can also improve the symptoms of atopic dermatitis. Therefore, the above-mentioned drugs are expected to become new drug options in the clinical treatment of atopic dermatitis.

[0064] Although specific embodiments of the invention have been described, those skilled in the art will recognize that various changes and modifications can be made to the invention without departing from its scope or spirit. Therefore, the invention is intended to cover all such changes and modifications falling within the scope of the appended claims and their equivalents.

Claims

1. A drug for the prevention or treatment of atopic dermatitis, characterized in that, The drug is a PTGER4 agonist or a drug that promotes PTGER4 overexpression.

2. The drug according to claim 1, characterized in that, The drug that promotes PTGER4 overexpression is an RNA that overexpresses PTGER4, and the sequence of the RNA is shown in SEQ ID NO.

1.

3. The drug according to claim 1, characterized in that, The PTGER4 agonist is L-902,688.

4. An adeno-associated virus vector pharmaceutical composition for the prevention or treatment of atopic dermatitis, characterized in that, The pharmaceutical composition comprises a drug that promotes PTGER4 overexpression and an adeno-associated virus (AAV) as a vector, wherein the drug that promotes PTGER4 overexpression is PTGER4 overexpression RNA, the sequence of which is shown in SEQ ID NO.

1.

5. The pharmaceutical composition according to claim 4, characterized in that, The adeno-associated virus mentioned is serotype 9 vector adeno-associated virus.

6. The pharmaceutical composition according to claim 4, characterized in that, The pharmaceutical composition is a local intradermal injection preparation.

7. The use of the medicament according to any one of claims 1-3 or the pharmaceutical composition according to any one of claims 4-6 in the preparation of a medicament for the prevention or treatment of atopic dermatitis.

8. The application according to claim 7, characterized in that, The drug or drug composition prevents or treats atopic dermatitis by upregulating the expression level of PTGER4 or by activating PTGER4.

9. The application of a kit for detecting the PTGER4 gene in the preparation of reagents for early screening, early diagnosis, efficacy evaluation and follow-up, and prognostic assessment of patients with atopic dermatitis.

Images