Primer for detecting SNP (Single Nucleotide Polymorphism) molecular marker related to body weight character of acipenser Yangtze River and application thereof

Abstract

The invention discloses a primer for detecting a Yangtze River acipenser body weight character related SNP molecular marker. The primer is characterized by comprising an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is as shown in SEQ ID NO: 1, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO: 2. The method can be used for breeding Yangtze River sturgeon juveniles with body weight character advantages and selecting parents. The invention firstly provides an SNP site related to the body weight character of acipenser Yangtze River. The SNP site exists in a low-weight population in sexual mature acipenser dungryanus individuals, and the technology can provide technical support for protection of acipenser dungryanus.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a primer for detecting SNP molecular markers related to the weight trait of the Yangtze sturgeon and its application. Background Technology

[0002] The Yangtze sturgeon, a rare fish species endemic to the Yangtze River basin in China, belongs to the family Acipenseridae within the order Acipenseriformes. One of the oldest fish species on Earth, with an evolutionary history exceeding 140 million years, it is hailed as a "living fossil." The Yangtze sturgeon has a spindle-shaped body, five rows of bony plates, and a long, pointed snout. It typically lives at the bottom of rivers, feeding mainly on benthic invertebrates and small fish. The Yangtze sturgeon has a long maturation period, usually requiring 6-10 years to reach sexual maturity, making it particularly vulnerable to environmental changes and human disturbance. However, due to overfishing, water conservancy projects, habitat destruction, and water pollution, the Yangtze sturgeon population has declined sharply. To protect this precious species, multiple conservation measures are needed, including fishing bans, artificial breeding, and habitat restoration, with the hope that these efforts will help the Yangtze sturgeon population recover.

[0003] The wild population of Yangtze sturgeon is extremely small, and artificial release is an important way to replenish it. Therefore, the superior traits of captive Yangtze sturgeon populations are of great research significance. There are few reports on Yangtze sturgeon traits, especially weight traits. Previous studies have attempted to investigate weight traits by changing pond size, stocking density, and feed administration. However, no reports have been found on genetic studies of Yangtze sturgeon traits. Summary of the Invention

[0004] To improve the artificial release and breeding effects of Yangtze sturgeon, this invention provides primers for detecting SNP molecular markers related to the weight trait of Yangtze sturgeon and their applications. To achieve the above objectives, this invention adopts the following technical solution: Primers for detecting SNP molecular markers related to weight traits in Yangtze sturgeon include an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:1 and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:2.

[0005] The present invention also proposes a kit for detecting SNP molecular markers related to the weight trait of Yangtze sturgeon, comprising the primers described above for detecting SNP molecular markers related to the weight trait of Yangtze sturgeon.

[0006] This invention also proposes the application of primers or kits for detecting SNP molecular markers related to the weight trait of Yangtze sturgeon in predicting the sexually mature weight shape of Yangtze sturgeon.

[0007] This invention also proposes a method for predicting the body weight and shape of Yangtze sturgeon at sexual maturity, comprising the following steps: Step 1: Extracting DNA from Yangtze sturgeon larvae; Step 2: The DNA obtained in Step 1 was amplified using the primers described above for detecting SNP molecular markers related to the weight trait of Yangtze sturgeon, to obtain the amplification product; Step 3: Sequencing the amplified products to obtain the detection results of SNP molecular markers related to the weight trait of Yangtze sturgeon; the SNP molecular markers related to the weight trait of Yangtze sturgeon include a first SNP site and a second SNP site, and the base sequence between the first SNP site and the second SNP site is GCAATTCAATAA; Step 4: When the base of the first SNP site is G or the base of the second SNP site is C, it is determined that the Yangtze sturgeon juveniles are small-weight individuals when they reach sexual maturity.

[0008] The first SNP site is located at 268-273 bp of the amplification product, and the second SNP site is located at 280-285 bp of the amplification product.

[0009] Optionally, the amplification process includes: pre-denaturation at 92-95℃ for 2-4 min; followed by a cycle of denaturation at 92-95℃ for 8-12 s, annealing at 54-56℃ for 10 s, and extension at 70-73℃ for 26-30 s, repeated 35-38 times; and finally extension at 70-73℃ for 4-6 min.

[0010] Optionally, the amplification reaction system may contain: 10-20 ng of DNA template and 10-20 μM of primers.

[0011] Optionally, the Yangtze sturgeon juveniles are sexually immature Yangtze sturgeon.

[0012] Optionally, the small-weight individuals are Yangtze sturgeon individuals whose weight is less than 20 kg at sexual maturity.

[0013] Optionally, in step one, DNA of juvenile Yangtze sturgeon is extracted from the fin rays of the juvenile Yangtze sturgeon.

[0014] The present invention has the following beneficial effects: This invention provides primers for detecting SNP molecular markers related to the weight trait of Yangtze sturgeon, including an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:2. By amplifying and sequencing Yangtze sturgeon DNA samples using the primers for detecting SNP molecular markers related to the weight trait of Yangtze sturgeon, the weight of the Yangtze sturgeon can be predicted and determined. The SNP molecular markers related to the weight trait of Yangtze sturgeon of this invention can be used for rapid identification or auxiliary identification of superior growth traits, without being limited by the age or sex of the Yangtze sturgeon. It can be used for early breeding of Yangtze sturgeon, with accurate and reliable identification results, simple operation, and low cost, which can significantly promote the breeding process of Yangtze sturgeon and solve the problem of blind selection in parent breeding. Only a small number of fin samples are needed to detect superior growth traits, providing a scientific tool for molecular-assisted breeding.

[0015] The Yangtze sturgeon is a Class I protected animal in my country, and its wild population is extremely limited. Artificial release is an important way to replenish wild resources, so the superior traits of captive Yangtze sturgeon populations are of great research significance. This technology can reduce the number of individuals with poor weight traits in captive Yangtze sturgeon populations, avoid the occurrence of offspring with poor traits during artificial breeding, and improve the survival rate of offspring in the wild after artificial release. Attached Figure Description

[0016] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0017] Figure 1 The sequencing results are from Example 2; Figure 2 The sequencing results are from Example 3. Detailed Implementation

[0018] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention. It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the present invention.

[0019] Furthermore, regarding the numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, are also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0020] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar to or equivalent to those described herein may be used in the implementation or testing of this invention.

[0021] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0022] This invention provides SNP molecular markers related to the weight trait of the Yangtze sturgeon and their applications. The SNP sites are located at approximately 270 bp and 283 bp of the PCR product, with the base sequence between the two SNPs being GCATTCAATAA. If the SNP at approximately 270 bp is G, or the SNP at approximately 283 bp is C, then the individual's weight at sexual maturity is less than the average weight of the Yangtze sturgeon population.

[0023] Single nucleotide polymorphisms (SNPs) refer to DNA sequence polymorphisms caused by a single nucleotide variation at the genomic level. They are the most abundant type of DNA molecular marker in the genome. SNP marker technology has the following characteristics: uneven distribution, mainly enriched in non-coding regions and non-transcribed sequences; high genetic stability, especially prominent in coding region SNPs; a large number and wide distribution; some intragenetic SNPs can directly affect protein structure or gene expression; and suitability for high-throughput automated detection. Compared to traditional molecular markers (SSR, AFLP, or RAPD, etc.), SNPs, as representatives of third-generation molecular marker technology, are characterized by good polymorphism and wide distribution throughout the genome. Studies have shown that a haplotype composed of 3-4 adjacent SNPs can generate 8-16 possible combinations of variations, with a polymorphism equivalent to a short tandem repeat (STR) site. From the perspective of linkage analysis, 1000 SNP markers provide information equivalent to 400 STR markers. As stable genetic markers, SNPs have higher genetic stability than STRs. Compared to traditional molecular markers (SSR, AFLP, or RAPD, etc.), SNPs, as representatives of third-generation molecular marker technologies, are characterized by high polymorphism and wide distribution throughout the genome. Currently, SNP molecular marker technology is widely used in the development of SNP markers related to growth traits in aquatic animals.

[0024] This application method involves using the primers provided in this technology to perform PCR amplification on the Yangtze sturgeon individuals to be identified, sequencing the PCR amplification products, and determining whether the sequencing results contain the SNP described in this technology. If the sequencing results contain the SNP, the weight of the individual to be identified at sexual maturity is less than the average weight of the Yangtze sturgeon population. The primer sequences are: XYTZF3: AAATAACTGCGGAGGACACT; XYTZR3: CCCCAAGCCAAGGTTC.

[0025] In some specific embodiments, the PCR amplification program includes: pre-denaturation at 94 °C for 3 min; denaturation at 94 °C for 10 s, annealing at 56 °C for 10 s, extension at 72 °C for 29 s, for a total of 35 cycles; and a final extension at 72 °C for 5 min. The PCR reaction system is 25 μL, including: 2 µL of DNA template, 1 µL each of upstream and downstream primer sequences, 12.5 µL of 2×Taq MasterMix, and 8.5 µL of ddH2O. The amplification treatment reaction system contains: 10-20 ng of DNA template and 10-20 μM of primers.

[0026] Example 1 At the Three Gorges Experimental Station of the Three Gorges Group, the largest and smallest sexually mature Yangtze sturgeon individuals were selected for genome resequencing. Sequence differences between the large and small weight groups were compared to identify differentially expressed null and void (SNP) sites. Upstream and downstream primers were designed at both ends of each differentially expressed SNP site. 200 differentially expressed SNP sites were randomly selected, and 200 primer pairs were designed for each of these 200 sites. These 200 primer pairs were used to perform PCR amplification on the five largest and five smallest Yangtze sturgeon individuals, and the amplification products were then subjected to first-generation sequencing. The sequencing results were compared to identify SNP sites linked to either the large or small weight groups. Based on the sequencing and comparison results...

[0027] The specific method for screening SNP sites by comparing the results is as follows: Based on the PCR amplification results of the five largest and five smallest Yangtze sturgeon, the sequences of the PCR amplification products of the five largest and five smallest Yangtze sturgeon are compared to identify sites that differ at the same base position among these 10 Yangtze sturgeon. If this site is linked in the five largest Yangtze sturgeon, or linked in the five smallest Yangtze sturgeon, or if there is a significant difference in the frequency of occurrence between the five largest and five smallest Yangtze sturgeon populations, then this site is the desired SNP site. This site is the SNP site linked to the weight trait of Yangtze sturgeon, and the primers that can amplify this site are the SNP primers linked to the weight trait of Yangtze sturgeon.

[0028] Based on the screening results, primer XYTZ3 was identified as an SNP primer linked to the weight trait of the Yangtze sturgeon. The specific primer sequence is: XYTZF3:AAATAACTGCGGAGGACACT; XYTZR3: CCCCAAGCCAAGGTTC. The SNP sites are located at approximately 270bp and 283bp in the PCR product, and the base sequence between the two SNPs is GCATTCAATAA. If the SNP at approximately 270bp is G, or the SNP at approximately 283bp is C, then the individual's weight at sexual maturity is less than the average weight of the Yangtze sturgeon population.

[0029] Example 2 The weights of 76 sexually mature Yangtze sturgeon individuals at the Three Gorges Experimental Station sturgeon breeding base of the Three Gorges Group were measured. The 10 largest and 10 smallest Yangtze sturgeon were selected, and their specific weights are shown in Table 1.

[0030] Table 1. Weights of 10 large and 10 small Yangtze sturgeon at the Three Gorges Experimental Station Sturgeon Farming Base

[0031] Fin rays were cut from 20 Yangtze sturgeon specimens, and DNA was extracted. PCR amplification was performed on the individual Yangtze sturgeon to be identified using the primers provided in this technique. The specific primer sequences were: XYTZF3: AAATAACTGCGGAGGACACT; XYTZR3: CCCCAAGCCAAGGTTC. The PCR amplification program included: 94 ℃ pre-denaturation for 3 min; 94 ℃ denaturation for 10 s, 56 ℃ annealing for 10 s, 72 ℃ extension for 29 s, for a total of 35 cycles; and a final extension at 72 ℃ for 5 min. The PCR reaction volume was 25 μL, including: 2 µL of DNA template, 1 µL each of the forward and reverse primer sequences, 12.5 µL of 2×Taq MasterMix, and 8.5 µL of ddH2O.

[0032] The PCR amplification products of the above 20 individuals were sequenced, and the sequencing results were compared and analyzed. The comparison and analysis results are as follows: Figure 1 As shown.

[0033] according to Figure 1 The results showed that SNP sites were present at approximately 270 bp and 283 bp of the PCR product, with the base sequence between the two SNPs being GCATTCAATAA. This SNP was found only in the small population. The SNP at approximately 270 bp was G, or the SNP at approximately 283 bp was C. The SNP site at approximately 270 bp accounted for 30% of the small population, and the SNP site at approximately 283 bp accounted for 30% of the small population. Combining the SNP sites at 270 bp and 283 bp, 50% of the small Yangtze sturgeon individuals could be identified.

[0034] Example 3: Nine sexually mature Yangtze sturgeon were sampled from the sturgeon breeding base of the Yichang Experimental Station of the Three Gorges Group. Fin strips were cut and samples were taken. The PIT number of each sample was recorded. The weight potential of Yangtze sturgeon was assessed using the method provided in this technique for PCR amplification of these nine individuals. The specific primer sequences were: XYTZF3: AAATAACTGCGGAGGACACT; XYTZR3: CCCCAAGCCAAGGTTC. The PCR amplification program included: 94 ℃ pre-denaturation for 3 min; 94 ℃ denaturation for 10 s, 56 ℃ annealing for 10 s, 72 ℃ extension for 29 s, for a total of 35 cycles; and a final extension at 72 ℃ for 5 min. The PCR reaction volume was 25 μL, including: 2 µL of DNA template, 1 µL each of the forward and reverse primer sequences, 12.5 µL of 2×Taq MasterMix, and 8.5 µL of ddH2O.

[0035] The PCR amplification products of the above 9 individuals were sequenced, and the sequencing results were compared and analyzed. The comparison and analysis results are as follows: Figure 2 As shown.

[0036] according to Figure 2 The results showed that the SNP sites at approximately 270 bp (G) and 283 bp (C) of the PCR product (with the base sequence between the two SNPs being GCATTCAATAA) were not present in the above nine Yangtze sturgeon individuals.

[0037] Therefore, it is judged that these 9 Yangtze sturgeon are most likely individuals with weight potential, and are sexually mature individuals with relatively large weight.

[0038] The weights of nine sexually mature Yangtze sturgeon individuals at the Yichang Experimental Station of the Three Gorges Group were measured. The specific weights are shown in Table 2.

[0039] Table 2. Weights of 9 sexually mature Yangtze sturgeon individuals at the Yichang Experimental Station Sturgeon Farming Base

[0040] The accuracy and practicality of this technology were demonstrated by comparing the sequencing results and the weighing results.

[0041] In summary, this method can screen out 50% of small individuals (weighing less than 20 kg) in the captive population of Yangtze sturgeon, effectively increasing the proportion of superior traits in the captive population.

[0042] Example 4 Based on the above implementation method, the present invention further proposes a method for predicting the body weight and shape of Yangtze sturgeon at sexual maturity, characterized by comprising the following steps: Step 1: Extracting DNA from Yangtze sturgeon larvae; Step 2: The DNA obtained in Step 1 was amplified using primers XYTZF3:AAATAACTGCGGAGGACACT and XYTZR3:CCCCAAGCCAAGGTTC to obtain the amplification product. The CR amplification program included: 94 ℃ pre-denaturation for 3 min; 94 ℃ denaturation for 10 s, 56 ℃ annealing for 10 s, 72 ℃ extension for 29 s, for a total of 35 cycles; and a final extension at 72 ℃ for 5 min. The PCR reaction volume was 25 μL, including: 2 µL of DNA template, 1 µL each of the forward and reverse primer sequences, 12.5 µL of 2×TaqMasterMix, and 8.5 µL of ddH2O.

[0043] Step 3: Sequencing the amplified products to obtain the detection results of SNP molecular markers related to the weight trait of Yangtze sturgeon; the SNP molecular markers related to the weight trait of Yangtze sturgeon include a first SNP site and a second SNP site, and the base sequence between the first SNP site and the second SNP site is GCAATTCAATAA; Step 4: If the base at the first SNP site is G, or the base at the second SNP site is C, the juvenile Yangtze sturgeon is determined to be a small-weight individual upon sexual maturity. A small-weight individual is defined as a Yangtze sturgeon individual with a weight less than 20 kg upon sexual maturity. Otherwise, it is determined to be an individual with weight potential, and thus a larger-weight individual upon sexual maturity.

[0044] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is impossible to exhaustively list all the implementation methods here. All obvious variations or modifications derived from the technical solutions of the present invention are still within the protection scope of the present invention.

Claims

1. Primers for detecting SNP molecular markers related to weight trait in Yangtze sturgeon, characterized in that: It includes an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:1 and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

2.

2. A kit for detecting SNP molecular markers related to the weight trait of Yangtze sturgeon, characterized in that, The primers include those described in claim 1 for detecting SNP molecular markers related to the weight trait of the Yangtze sturgeon.

3. The primers of claim 1 for detecting SNP molecular markers related to the weight trait of Yangtze sturgeon or the kit of claim 2 for predicting the sexually mature weight morphology of Yangtze sturgeon.

4. A method for predicting the body weight and shape of Yangtze sturgeon at sexual maturity, characterized in that, Includes the following steps: Step 1: Extracting DNA from Yangtze sturgeon larvae; Step 2: The DNA obtained in Step 1 is amplified using the primers described in claim 1 for detecting SNP molecular markers related to the weight trait of Yangtze sturgeon, to obtain amplification products; Step 3: Sequencing the amplified products to obtain the detection results of SNP molecular markers related to the weight trait of Yangtze sturgeon; the SNP molecular markers related to the weight trait of Yangtze sturgeon include a first SNP site and a second SNP site, and the base sequence between the first SNP site and the second SNP site is GCAATTCAATAA; Step 4: When the base of the first SNP site is G or the base of the second SNP site is C, it is determined that the Yangtze sturgeon juveniles are small-weight individuals when they reach sexual maturity.

5. The method for predicting the body weight and shape of Yangtze sturgeon at sexual maturity according to claim 4, characterized in that, The first SNP site is located at 268-273 bp of the amplification product, and the second SNP site is located at 280-285 bp of the amplification product.

6. The method for predicting the body weight and shape of Yangtze sturgeon at sexual maturity according to claim 4, characterized in that, The amplification process includes: pre-denaturation at 92-95℃ for 2-4 min; followed by a cycle of denaturation at 92-95℃ for 8-12 s, annealing at 54-56℃ for 10 s, and extension at 70-73℃ for 26-30 s, repeated 35-38 times; and finally extension at 70-73℃ for 4-6 min.

7. The method for predicting the body weight and shape of Yangtze sturgeon at sexual maturity according to claim 4, characterized in that, The amplification reaction system contains: 10-20 ng DNA template and 10-20 uM primers.

8. The method for predicting the body weight and shape of Yangtze sturgeon at sexual maturity according to claim 4, characterized in that, The Yangtze sturgeon juveniles mentioned are immature Yangtze sturgeon.

9. The method for predicting the body weight and shape of Yangtze sturgeon at sexual maturity according to claim 4, characterized in that, The "small weight individuals" refer to Yangtze sturgeon individuals whose weight is less than 20 kg at sexual maturity.

10. The method for predicting the body weight and shape of Yangtze sturgeon at sexual maturity according to claim 4, characterized in that, In step one, DNA of Yangtze sturgeon juveniles is extracted from their fin rays.

Images