Cross-linked polymer-GalNT1 siRNA (small interfering Ribonucleic Acid) nanocomposite as well as preparation method and application thereof

By utilizing the cross-linked polymer-GalNT1 siRNA nanocomposite to respond in the tumor-specific microenvironment, delivery efficiency is improved, addressing the issues of insufficient targeting and abnormally elevated Tn antigen in siRNA delivery systems. This enhances the efficacy of tumor immunotherapy and significantly reduces the risk of tumor metastasis.

CN121622728APending Publication Date: 2026-03-10CANGZHOU INSTITUTE OF TIANGONG UNIVERSITY +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511803626.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-03
Publication Date
2026-03-10

AI Technical Summary

Technical Problem

Existing siRNA delivery systems have insufficient targeting and are prone to inactivation in colorectal cancer, leading to immunosuppression and increased risk of tumor metastasis. Abnormally elevated Tn antigen levels result in insufficient immune infiltration.

Method used

We developed a cross-linked polymer-GalNT1 siRNA nanocomposite. The siRNA was electrostatically adsorbed and bound to the polymer by homocysteine-modified cationic and zwitterionic polymers and cross-linked by disulfide bonds. The resulting nanocomposite responded in the tumor-specific microenvironment, improving delivery efficiency and reducing Tn antigen levels.

Benefits of technology

It significantly enhances the infiltration of immune cells into tumor tissues, alleviates immunosuppression, reduces tumor cell viability, prolongs the survival of mouse tumor models, and inhibits tumor metastasis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121622728A_ABST
    Figure CN121622728A_ABST
Patent Text Reader

Abstract

The invention provides a preparation method of a cross-linked polymer-GalNT1 siRNA nano compound and application of the cross-linked polymer-GalNT1 siRNA nano compound in tumor immunotherapy, and belongs to the technical field of biological medicine. According to the invention, the homocysteine modified cationic polymer and the homocysteine modified zwitterionic polymer are introduced into the nano-composite, so that the consumption of serine in tumor tissues or tumor cells is realized, and the inhibition effect of GalNT1 siRNA on Tn antigens is enhanced. The nanocomposite can effectively cope with the problem of insufficient tumor immune infiltration caused by abnormal expression of Tn antigens, can respond to reducing substances in a colorectal cancer microenvironment, improves the targeting of tumor treatment, further enhances immune infiltration in tumors, relieves the immunosuppression of tumor tissues and reduces the metastasis capacity of tumor cells. The nano-composite has important significance and wide application prospect in the field of tumor treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of a cross-linked polymer-GalNT1 siRNA nanocomposite and its preparation method in anti-tumor therapy. Background Technology

[0002] As tumor research deepens, clinical studies have shown that the tumor environment of colorectal cancer generally exhibits a significant immunosuppressive state. This immunosuppressive environment promotes increased drug resistance and metastatic potential in tumor cells, and limits various treatment strategies, thereby significantly weakening the clinical treatment efficacy of colorectal cancer.

[0003] Significant progress has been made in tumor immunotherapy in recent years. By using drugs, antibodies, or immune adjuvants to enhance immune cell infiltration and regulate immune checkpoint signals, the therapeutic effect of tumors can be effectively improved. However, the immunosuppressive environment prevalent in solid tumors can lead to insufficient immune cell infiltration, thereby limiting the effectiveness of immunotherapy. The core mechanism of this is closely related to the immune escape of tumor cells.

[0004] Abnormal glycosylation is commonly observed in colorectal cancer patient samples. Among these, high levels of Tn antigen are frequently seen on the surface of tumor cells. Tn antigen is an abnormal early glycosylation structure generated by N-acetylgalactosamine modifying serine or threonine residues in proteins. This structure can be recognized by MGL receptors on the surface of immune cells (such as macrophages and dendritic cells), promoting tumor immune escape through the Tn-MGL immune axis, exacerbating drug resistance, treatment difficulty, and metastasis risk.

[0005] N-acetylgalactosamine transferase 1 (GalNT1) is a key enzyme in the formation of Tn antigens. Therefore, inhibiting GalNT1 activity can effectively reduce Tn antigen levels. Small interfering RNA (siRNA) can significantly inhibit GalNT1 expression through gene silencing, thereby downregulating Tn antigens. Furthermore, reducing intracellular serine levels can decrease the number of glycosylation sites for N-acetylgalactosamine, thus enhancing the inhibitory effect on Tn antigens. On the other hand, existing siRNA delivery systems generally suffer from problems such as inactivation, off-target effects, and insufficient targeting. Therefore, developing functionalized vectors with efficient and precise delivery capabilities that can significantly improve the tumor immune microenvironment is a key requirement for enhancing the efficacy of tumor immunotherapy.

[0006] In view of the above problems, this invention provides a novel nanocomposite designed to address the issue of insufficient immune infiltration caused by abnormally elevated Tn antigen levels. The nanocomposite constructed in this invention responds to a specific reducing microenvironment within colorectal cancer tissue, improving targeted delivery efficiency to the tumor site, thereby more effectively downregulating Tn antigen levels, enhancing tumor tissue immune infiltration, alleviating immunosuppression, and inhibiting tumor metastasis. This invention has significant value in cancer treatment and broad application prospects. Summary of the Invention

[0007] The purpose of this invention is to overcome the problems of insufficient targeting, easy inactivation of siRNA, and immunosuppression caused by abnormally elevated Tn antigen in existing technologies, and to provide a cross-linked polymer-GalNT1 siRNA nanocomposite for the treatment of colorectal cancer, its preparation method, and its application. The nanocomposite of this invention can achieve efficient delivery and release in the tumor-specific microenvironment, inhibit Tn antigen levels by downregulating GalNT1 expression, increase immune cell infiltration in tumor tissue, inhibit tumor cell viability, alleviate tumor immunosuppression, and reduce metastatic potential, thereby significantly enhancing the efficacy of tumor immunotherapy.

[0008] To achieve the above objectives, a first aspect of the present invention provides a cross-linked polymer-GalNT1 siRNA nanocomposite, the cross-linked polymer-siRNA nanocomposite comprising a homocysteine-modified cationic polymer, a homocysteine-modified zwitterionic polymer, and GalNT1 siRNA; wherein the siRNA and the homocysteine-modified cationic polymer are combined by electrostatic adsorption to form a cationic siRNA nanocomposite, and the homocysteine-modified zwitterionic polymer and the homocysteine-modified cationic polymer are cross-linked by disulfide bonds formed between homocysteine ​​residues to form the cross-linked polymer-GalNT1 siRNA nanocomposite.

[0009] The N / P ratio of the homocysteine-modified cationic polymer to siRNA is 15-100:1, preferably 25-35:1; the mass ratio of the homocysteine-modified cationic polymer to the homocysteine-modified zwitterionic polymer is 1:0.1-5, preferably 1:0.5-1.5. The GalNT1 siRNA sequences are sense (5'-3'): GUGGAAACGAAUCAGUGCUCUA (SEQ ID NO.1); Antisense (5'-3'): UAGAGCAGCACUGAUUCGUUUCCAC (SEQ ID NO.2).

[0010] A second aspect of this invention provides a method for preparing a cross-linked polymer GalNT1 siRNA nanocomposite, comprising the following steps: S11: GalNT1 siRNA was added to a homocysteine-modified cationic polymer solution and stirred to obtain a cationic polymer-siRNA nanocomposite intermediate; S12: Add homocysteine-modified zwitterionic polymer to the cationic siRNA nanocomposite solution and stir to obtain cross-linked polymer-GalNT1 siRNA nanocomposite.

[0011] In the above technical solution, the preparation of the homocysteine-modified cationic polymer includes the following steps: Butyl methacrylate, dimethylaminoethyl methacrylate, chain transfer agent dithiobenzoic acid 4-cyanopentanoic acid and initiator were polymerized by free radical polymerization, followed by dialysis and drying to obtain a cationic polymer (intermediate 1); intermediate 1 was reacted with homocysteine ​​by amidation reaction, followed by dialysis and drying to obtain a homocysteine-modified cationic polymer; Preferably, the molar ratio of butyl methacrylate, dimethylaminoethyl methacrylate, dithiobenzoic acid 4-cyanopentanoic acid and the initiator is 0.8-1.5:0.8-1.5:0.1:0.1; Preferably, the initiator is azobisisobutyronitrile; Preferably, the molar ratio of intermediate 1 to homocysteine ​​is 1:1.5-3; Preferably, the homocysteine-modified zwitterionic polymer has a molecular weight of 5,000-20,000 Da; Preferably, the conditions for the free radical polymerization reaction include: a temperature of 40-100℃, a stirring rate of 100-200 rpm, and a time of 6-12 h; the conditions for the amidation reaction include: a temperature of 10-40℃, a stirring rate of 100-200 rpm, and a time of 24-48 h.

[0012] In the above technical solution, the preparation of homocysteine-modified zwitterionic polymer includes the following steps: Methacrylsulfonate betaine, chain transfer agent dithiobenzoic acid 4-cyanopentanoic acid, and initiator were subjected to free radical polymerization, followed by dialysis and drying to obtain zwitterionic polymer (intermediate 2); intermediate 2 was subjected to amidation reaction with homocysteine, followed by dialysis and drying to obtain homocysteine-modified zwitterionic polymer; Preferably, the molar ratio of methacrylsulfonate betaine, dithiobenzoic acid 4-cyanopentanoic acid and the initiator is 1.5-2.5:0.1:0.1; Preferably, the initiator is azobisisobutyronitrile; Preferably, the molar ratio of intermediate 2 to homocysteine ​​is 1:1.5-3; Preferably, the homocysteine-modified zwitterionic polymer has a molecular weight of 3,000-6,000 Da; Preferably, the conditions for the free radical polymerization reaction include: a temperature of 40-100℃, a stirring rate of 100-200 rpm, and a time of 6-12 h; the conditions for the amidation reaction include: a temperature of 10-40℃, a stirring rate of 100-200 rpm, and a time of 24-48 h.

[0013] In the above technical solution, step S11 specifically includes: dissolving the homocysteine-modified cationic polymer in a citrate buffer solution with a pH of 3.5-5.5, slowly adding a solution containing GalNT1 siRNA, and shaking and stirring at 4-37℃ for 4-12 h to obtain a cationic polymer-siRNA nanocomposite solution. And / or, step S12 specifically includes: dissolving the homocysteine-modified zwitterionic polymer in a phosphate buffer solution with a pH of 6.5-8.5; adding the homocysteine-modified zwitterionic polymer solution to a cationic polymer-siRNA nanocomposite solution with a pH of 3.5-5.5; readjusting the pH to 6.5-8.5 using sodium hydroxide solution; and stirring at 20-40°C for 12-36 h to obtain the cross-linked polymer-GalNT1 siRNA nanocomposite.

[0014] A third aspect of the present invention provides the use of the above-described cross-linked polymer-GalNT1 siRNA nanocomposite and the cross-linked polymer-GalNT1 siRNA nanocomposite prepared by the above-described preparation method in the preparation of drugs for tumor immunotherapy.

[0015] This invention has at least the following beneficial effects: 1. As verified by the embodiments of the present invention, the cross-linked polymer-GalNT1 siRNA nanocomposite carrying GalNT1 siRNA effectively silences GalNT1 expression in tumor cells or colorectal cancer tissues, and reduces the level of Tn antigen in cells or tissues. 2. As verified by the embodiments of the present invention, the disulfide bonds formed between homocysteine ​​residues in the cross-linked polymer-GalNT1 siRNA nanocomposite are reduced by reducing substances in tumor cells or colorectal cancer tissues, exposing homocysteine ​​residues; preferably, the reducing substance is hydrogen sulfide. 3. As verified by the embodiments of the present invention, the cross-linked polymer-GalNT1 siRNA nanocomposite, under the catalysis of cystathionine β-synthase in tumor cells or colorectal cancer tissues, exposes homocysteine ​​residues that bind to serine in cells or tissues, consumes serine levels, and further reduces Tn antigen levels. 4. As verified by the embodiments of the present invention, the cross-linked polymer-GalNT1 siRNA nanocomposite provided by the present invention effectively relieves the inhibition of the immune system by reducing the Tn antigen level, activates a strong anti-tumor immune response, and ultimately leads to a decrease in tumor cell viability and death, significantly prolonging the survival time in mouse tumor models.

[0016] The fourth aspect of the present invention provides the use of the above-described cationic polymer-GalNT1 siRNA nanocomposite in the preparation of a medicament for inhibiting the activity of tumor cells or colorectal cancer tissue.

[0017] The present invention also provides a tumor treatment method that reduces Tn antigen levels by applying homocysteine ​​or its modifications to consume serine in tumor cells. Attached Figure Description

[0018] Figure 1 A schematic diagram illustrating the preparation process and serine consumption of the cross-linked polymer-GalNT1 siRNA nanocomposite; Figure 2 This is a schematic diagram showing the synthesis of the homocysteine-modified cationic polymer (a) in Example 1 and the homocysteine-modified zwitterionic polymer (b) in Example 2; Figure 3 The 1H NMR spectrum of the homocysteine-modified cationic polymer in Example 1; Figure 4 The 1H NMR spectrum of the homocysteine-modified zwitterionic polymer in Example 2; Figure 5 This is a diagram showing the average hydrodynamic diameter of the cross-linked polymer-GalNT1 siRNA nanocomposite in Example 3 of the present invention. Figure 6 The hydrogen sulfide responsiveness measurement results provided in Example 4 of the present invention are as follows: (a) is the thiol content of the cationic polymer-siRNA nanocomposite intermediate, (b) is the thiol content of the cross-linked polymer-GalNT1 siRNA nanocomposite, and (c) is the thiol content of the cross-linked polymer-GalNT1 siRNA nanocomposite after hydrogen sulfide treatment. Figure 7The serine consumption results provided in Example 4 of the present invention are as follows: (a) is the group treated with homocysteine-modified cationic polymer, (b) is the group treated with homocysteine-modified zwitterionic polymer, (c) is the group treated with cysteine-modified zwitterionic polymer, and (d) is the group treated with cysteine-modified zwitterionic polymer. Figure 8 The results of the Tn antigen consumption experiment provided in Example 4 of the present invention are shown in (a) as the control group, (b) as the cross-linked polymer siNC nanocomposite treatment group, (c) as the cross-linked polymer-cysteine ​​GalNT1 siRNA nanocomposite treatment group, and (d) as the cross-linked polymer-GalNT1 siRNA nanocomposite treatment group. Figure 9 The following table shows the subcutaneous tumor growth in mice under different treatment regimens provided in Example 5 of this invention: (a) is the control group, (b) is the cross-linked polymer siNC nanocomposite treatment group, (c) is the cross-linked polymer-cysteine ​​GalNT1 siRNA nanocomposite treatment group, and (d) is the cross-linked polymer-GalNT1 siRNA nanocomposite treatment group. Figure 10 The survival comparison results of mice in the whole-body transfer model provided in Example 6 of the present invention were obtained by CT26 mice before the model was established. Among them, (a) is the control group, (b) is the cross-linked polymer siNC nanocomposite treatment group, (c) is the cross-linked polymer-cysteine ​​GalNT1 siRNA nanocomposite treatment group, and (d) is the cross-linked polymer-GalNT1 siRNA nanocomposite treatment group. Detailed Implementation

[0019] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0020] The “siNC” in this invention refers to the meaningless siRNA used in this invention, which is used to compare and observe the specific effects of GalNT1 siRNA. It does not affect the activity of N-acetylgalactosamine transferase 1 described in this invention. The siNC sequence is sense (5'-3'): CAACCUCAGCCAUGUCGACUGGUUU (SEQ ID NO.3); Antisense (5'-3'): AAACCAGUCGACAUGGCUGAGGUUA (SEQ ID NO.4).

[0021] The "Tn-MGL immune axis" of this invention refers to the interaction between tumor cells and immune cells. Specifically, the Tn antigen overexpressed on the surface of tumor cells is recognized by the MGL receptor (a galactose-type lectin) on the surface of dendritic cells or macrophages, thus being recognized by the immune system as a normal cell—an immunosuppressive axis. Inhibiting this immune axis can relieve immunosuppression to a certain extent, ultimately reflected in CD8... + The increased infiltration of T cells in tumor tissues allows the immune system to kill tumor cells.

[0022] The "CD8" described in this invention + T cells are immune cells, specifically CD8-positive T cells, belonging to the cytotoxic T lymphocyte family of T cells. They mature and differentiate after antigen presentation and possess the ability to kill tumor cells. CD8... + The level of T cells reflects the immune recovery effect of the tumor environment.

[0023] The "CBS enzyme" described in this invention is a cystathionine β-synthase, which is upregulated in colorectal cancer tumors or tissues. It can catalyze the synthesis reaction of homocysteine ​​and serine, thereby utilizing homocysteine ​​residues to consume serine in tumor tissues or cells and reduce serine levels.

[0024] The "reducing substances" described in this invention refer to proteins, polypeptides, and small molecule compounds with reducing capabilities found in colorectal cancer cells or tissues. These reducing substances are characterized by their ability to reduce disulfide bonds to thiol groups. Preferably, the reducing substance is hydrogen sulfide.

[0025] In a first aspect, the present invention provides a cross-linked polymer-siRNA nanocomposite, the nanocomposite comprising a homocysteine-modified cationic polymer, a homocysteine-modified zwitterionic polymer, and GalNT1 siRNA; wherein the siRNA and the homocysteine-modified cationic polymer are combined by electrostatic adsorption to form a cationic siRNA nanocomposite, and the homocysteine-modified zwitterionic polymer and the homocysteine-modified cationic polymer are cross-linked by disulfide bonds formed between homocysteine ​​residues to form the cross-linked polymer-GalNT1 siRNA nanocomposite.

[0026] According to the present invention, GalNT1 siRNA is encapsulated by cationic and zwitterionic polymers respectively, which can prolong the blood circulation time of siRNA, increase its accumulation at the tumor site, promote its internalization by tumor cells, and enhance its inhibitory effect on GalNT1 and Tn antigens.

[0027] According to the present invention, in order to improve the stability of the nanocomposite and the loading effect on siRNA, the N / P ratio of the homocysteine-modified cationic polymer to siRNA is 15-100:1, preferably 25-35:1.

[0028] According to the present invention, in order to improve the biocompatibility of the nanocomposite, the mass ratio of the homocysteine-modified cationic polymer to the homocysteine-modified zwitterionic polymer is 1:0.1-5, preferably 1:0.5-1.5.

[0029] According to the present invention, in order to improve the transfectivity of siRNA nanocomposites, preferably, the average particle size of the cross-linked polymer-siRNA nanocomposites is 100-250 nm.

[0030] According to the present invention, preferably, the sequence of the GalNT1 siRNA is sense (5'-3'): GUGGAAACGAAUCAGUGCUCUA; Antisense (5'-3'): UAGAGACUGAUUCGUUUCCAC.

[0031] According to the present invention, the zwitterionic polymer layer of the cross-linked polymer-GalNT1 siRNA nanocomplex is cross-linked by disulfide bonds between homocysteine ​​residues and coated on the outside of the positive polymer. This structure not only improves the stability and delivery efficiency of siRNA, but also allows disulfide bond cleavage under the reducing conditions of the tumor microenvironment, exposing homocysteine ​​residues. These homocysteine ​​residues then react with serine under CBS catalysis, thereby reducing intracellular serine levels and inhibiting Tn antigen production, thus enhancing the efficacy of GalNT1 siRNA.

[0032] Secondly, this invention provides a method for preparing a cross-linked polymer-GalNT1 siRNA nanocomposite. Please refer to [link to relevant documentation]. Figure 1 , Figure 1 This is a schematic diagram illustrating the preparation process and serine consumption of the cross-linked polymer-GalNT1 siRNA nanocomposite in one embodiment.

[0033] The method includes the following steps: S11: GalNT1 siRNA was added to a homocysteine-modified cationic polymer solution and stirred to obtain a cationic polymer-siRNA nanocomposite intermediate; S12: Add homocysteine-modified zwitterionic polymer to the cationic siRNA nanocomposite solution and stir to obtain cross-linked polymer-GalNT1 siRNA nanocomposite.

[0034] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0035] In Example 1, the synthesis schematic diagram of the homocysteine-modified cationic polymer is shown below. Figure 2 As shown in a, the specific steps include: Step 1: Dimethylaminoethyl methacrylate, butyl methacrylate, 4-cyanopentanoic acid dithiobenzoic acid, and azobisisobutyronitrile were dissolved in 1,4-dioxane. The mixture was purged with nitrogen for 30 min, stirred at 65 °C for 18 h, and the reaction was terminated by adding water. The mixture was dialyzed against methanol for 1 day and against water for 1 day (molecular weight cutoff 1,000 Da). After freeze-drying, a cationic polymer (intermediate 1) was obtained.

[0036] In step 1, the molar ratio of dimethylaminoethyl methacrylate, butyl methacrylate, dithiobenzoic acid 4-cyanopentanoic acid and azobisisobutyronitrile is 1:1:0.1:0.1.

[0037] Step 2: The intermediate 1,2-(7-azabenzotriazole)- N,N,N',N' -Tetramethylurea hexafluorophosphate and N,N -Diisopropylethylamine dissolved in N,N In dimethylformamide, the mixture was stirred at 37°C for 4 h, then homocysteine ​​was added and the reaction was continued at 37°C for another 24 h. The crude product was dialyzed in water for 2 days (molecular weight cutoff 1,000 Da), and then freeze-dried to obtain the homocysteine-modified cationic polymer.

[0038] In step 2, intermediates 1,2-(7-azabenzotriazole)- N,N,N',N' -Tetramethylurea hexafluorophosphate, N,N The molar ratio of diisopropylethylamine to homocysteine ​​is 1:2:4:2.

[0039] like Figure 3 As shown, the 1H NMR data indicate that the homocysteine-modified cationic polymer has been successfully synthesized.

[0040] Comparative Example 1 Comparative Example 1 provides a method for synthesizing a cysteine-modified cationic polymer to verify the serine consumption of the homocysteine-modified cationic polymer. The steps are as follows: The method for synthesizing the cationic polymer (intermediate 1) is as described in Example 1 (step 1).

[0041] Step 2: Intermediate 1,2-(7-azabenzotriazole)- N,N,N',N' -Tetramethylurea hexafluorophosphate and N,N -Diisopropylethylamine dissolved in N,N Dimethylformamide was stirred at 37°C for 4 h, cysteine ​​was added, and the reaction was carried out at 37°C for 24 h. The mixture was dialyzed in water for 2 days (molecular weight cutoff 1,000 Da), and then freeze-dried to obtain the cysteine-modified cationic polymer.

[0042] In step 2, the intermediate 1,2-(7-azabenzotriazole)- N,N,N',N' -Tetramethylurea hexafluorophosphate, N,N The molar ratio of diisopropylethylamine to cysteine ​​is 1:2:4:2.

[0043] Example 2 This embodiment uses the synthesis of homocysteine-modified zwitterionic polymers as an example, and its synthesis schematic diagram is shown below. Figure 2 As shown in b, the specific steps include: Step 1: Methacrylate sulfobetaine, dithiobenzoic acid 4-cyanopenic acid and azobisisobutyronitrile are dissolved in... N,N - Dimethylformamide. Purge with nitrogen for 30 min and stir at 65 °C for 18 h. Then add water to terminate the reaction and dialyze the product in water for 2 days (molecular weight cutoff 1,000 Da). After freeze drying, obtain zwitterionic polymer (intermediate 2).

[0044] In step 1, the molar ratio of methacrylic acid sulfobetaine, dithiobenzoic acid 4-cyanopentanoic acid and azobisisobutyronitrile is 1:0.1:0.1.

[0045] Step 2: Intermediate 2,2-(7-azabenzotriazole)- N,N,N',N' -Tetramethylurea hexafluorophosphate and N,N -Diisopropylethylamine dissolved in N,N Dimethylformamide was stirred at 37°C for 4 h, homocysteine ​​was added, and the reaction was carried out at 37°C for 24 h. The product was dialyzed against water for 2 days (molecular weight cutoff 1,000 Da), and freeze-dried to obtain a homocysteine-modified zwitterionic polymer.

[0046] In step 2, intermediate 2, 2-(7-azabenzotriazole)- N,N,N',N' -Tetramethylurea hexafluorophosphate, N,N The molar ratio of diisopropylethylamine to homocysteine ​​is 1:2:4:2.

[0047] like Figure 4As shown, the 1H NMR data indicate that the homocysteine-modified zwitterionic polymer has been successfully synthesized.

[0048] Comparative Example 2 Comparative Example 2 provides a method for synthesizing cysteine-modified zwitterionic polymers to verify the serine consumption of homocysteine-modified zwitterionic polymers. The steps are as follows: The synthesis method of the zwitterionic polymer (intermediate 2) is as described in Example 2 (step 1).

[0049] Step 2: The intermediate 2,2-(7-azabenzotriazole)- N,N,N',N' -Tetramethylurea hexafluorophosphate and N, N -Diisopropylethylamine dissolved in N,N In dimethylformamide, the mixture was stirred at 37°C for 4 h, then cysteine ​​was added, and the reaction was continued at 37°C for 24 h. The crude product was dialyzed against water for 2 days (molecular weight cutoff 1,000 Da), and then freeze-dried to obtain a cysteine-modified zwitterionic polymer.

[0050] In step 2, intermediate 2, 2-(7-azabenzotriazole)- N,N,N',N' -Tetramethylurea hexafluorophosphate, N,N The molar ratio of diisopropylethylamine to cysteine ​​is 1:2:4:2.

[0051] Example 3 This embodiment takes the preparation of cross-linked polymer-GalNT1 siRNA nanocomposite as an example, and specifically includes the following steps: S11: Dissolve the homocysteine-modified cationic polymer in citrate buffer at pH 3.5-5.5, slowly add a solution containing GalNT1 siRNA, and shake and stir at 4-37℃ for 4-12 h to obtain a cationic polymer-siRNA nanocomposite solution.

[0052] In step S11, the N / P ratio of GalNT1 siRNA to the cysteine-modified cationic polymer is 35:1.

[0053] S12: Homocysteine-modified zwitterionic polymers were dissolved in phosphate buffer solution with a pH of 6.5-8.5. Homocysteine-modified zwitterionic polymer solution was added to cationic polymer-siRNA nanocomposite solution with a pH of 3.5-5.5. The pH was readjusted to 6.5-8.5 using sodium hydroxide solution. The mixture was stirred at 20-40℃ for 12-36 h to obtain cross-linked polymer-GalNT1 siRNA nanocomposite.

[0054] In step S12, the mass ratio of the homocysteine-modified cationic polymer to the homocysteine-modified zwitterionic polymer is 1:1.

[0055] like Figure 5 As shown, the average hydrodynamic diameter of the cross-linked polymer-GalNT1 siRNA nanocomposite was 200 nm, as measured by dynamic light scattering.

[0056] Comparative Example 3 This invention provides a method for preparing a cross-linked polymer (cysteine)-GalNT1 siRNA nanocomposite, comprising a cysteine-modified cationic polymer, a cysteine-modified zwitterionic polymer, and GalNT1 siRNA, and including the following steps: Step 1: Add GalNT1siRNA to a cysteine-modified cationic polymer solution at pH 3.5-5.5 and stir at room temperature to obtain an intermediate complex, namely the cationic polymer (cysteine)-GalNT1 siRNA nanocomposite.

[0057] In step 1, the N / P ratio of GalNT1 siRNA to the cysteine-modified cationic polymer is 35:1.

[0058] Step 2: Add cysteine-modified zwitterionic polymer to a cationic polymer (cysteine)-siRNA nanocomposite solution with pH 6.5-8.5, and stir at 30-40℃ for 12-36 h to obtain cross-linked polymer (cysteine)-GalNT1 siRNA nanocomposite.

[0059] In step 2, the mass ratio of the cysteine-modified cationic polymer to the cysteine-modified zwitterionic polymer is 1:1.

[0060] Comparative Example 4 This invention provides a cross-linked polymer-siNC nanocomposite, comprising a homocysteine-modified cationic polymer, a homocysteine-modified zwitterionic polymer, and siNC, and includes the following steps: Step 1: Add siNC to a homocysteine-modified cationic polymer solution with a pH of 3.5-5.5 and stir at room temperature to obtain an intermediate complex: cationic siNC nanocomposite.

[0061] In step 1, the N / P ratio of siNC to the homocysteine-modified cationic polymer is 35:1.

[0062] Step 2: Add homocysteine-modified zwitterionic polymer to a cationic siNC nanocomposite solution with pH 6.5-8.5, and stir at 30-40℃ for 12-36 h to obtain cross-linked polymer siNC nanocomposite.

[0063] In step 2, the mass ratio of the homocysteine-modified cationic polymer to the homocysteine-modified zwitterionic polymer is 1:1.

[0064] Example 4 The performance of the cross-linked polymer-GalNT1 siRNA nanocomposite was tested, and the specific experiments are as follows: 1. Hydrogen sulfide responsiveness test An aqueous solution containing hydrogen sulfide was added to the cross-linked polymer-GalNT1 siRNA nanocomposite solution, and the mixture was treated at 37°C for 6 h. The thiol content was then determined using 5,5'-dithiobis(2-nitrobenzoic acid) reagent (DTNB).

[0065] like Figure 6 As shown, the thiol content measured in the hydrogen sulfide-treated group was significantly higher than that in the non-hydrogen sulfide-treated group. Specifically, the thiol content in the cationic polymer-siRNA nanocomposite was 87.5%, the thiol content in the cross-linked polymer-GalNT1 siRNA nanocomposite was 13.5%, and the thiol content in the cross-linked polymer-GalNT1 siRNA nanocomposite after hydrogen sulfide treatment was 90.3%. This demonstrates that the cross-linked polymer-GalNT1 siRNA nanocomposite can respond to hydrogen sulfide and can expose homocysteine ​​residues after hydrogen sulfide treatment.

[0066] Experimental results are expressed as mean ± standard deviation, and one-way ANOVA was used for analysis. P <0.05 (*) indicates a significant difference. P <0.01 (**) indicates a highly significant difference. P <0.001 (***) indicates a highly significant difference. P ≥0.05 (ns) indicates no significant difference.

[0067] 2. Serine Consumption Test Solutions of homocysteine-modified cationic polymers, homocysteine-modified zwitterionic polymers, cysteine-modified zwitterionic polymers, and cysteine-modified zwitterionic polymers were placed in dialysis bags (molecular weight cutoff 1,000 Da) and then placed in water containing serine. The serine content in the aqueous solution was measured at specific time points.

[0068] like Figure 7As shown, the serine levels in the treatment groups containing cationic polymers or zwitterionic polymers containing homocysteine ​​were significantly reduced, demonstrating that cationic polymers or zwitterionic polymers containing homocysteine ​​residues can consume serine.

[0069] 3. Tn antigen inhibition test CT26 cells were treated for 24 h with group 1 (no treatment control), group 2 (cross-linked polymer siNC nanocomposite), group 3 (cross-linked polymer-cysteine ​​GalNT1 siRNA nanocomposite), and group 4 (cross-linked polymer-GalNT1 siRNA nanocomposite), respectively. After treatment with anti-CD175 antibody, the Tn antigen level of CT26 cells was measured by flow cytometry.

[0070] The mouse colorectal cancer cells CT26 used in the above embodiments were purchased from Wuhan Pronosei Life Science Technology Co., Ltd.

[0071] The culture method for tumor cells CT26 is as follows: CT26 cells were cultured adherently in RPMI-1640 medium containing 10% fetal bovine serum and 1% penicillin / streptomycin at a temperature of 37°C and a CO2 concentration of 5%.

[0072] like Figure 8 As shown, the Tn antigen level in cells treated with the cross-linked polymer-GalNT1 siRNA nanocomposite decreased significantly compared with other groups. In particular, the presence of GalNT1 siRNA led to the downregulation of Tn antigen, and the treatment containing GalNT1 siRNA and homocysteine ​​further downregulated the Tn antigen level.

[0073] Thirdly, the present invention also provides the use of the cross-linked polymer-GalNT1 siRNA nanocomposite as described above in tumor immunotherapy drugs.

[0074] Example 5 The therapeutic effect of the above-mentioned cross-linked polymer-GalNT1 siRNA nanocomposite on subcutaneous tumors in mice was evaluated.

[0075] The following SPF-grade mice were purchased from Vital River Pharmaceuticals Beijing. They were male, BALB / c strain, and housed in a standard environment. Animal experiments were conducted under the guidance of the Laboratory Animal Management and Use Committee (IRM-DWLL-2022118).

[0076] The mouse subcutaneous tumor model was divided into 4 groups for drug treatment, of which (a) was the control group, (b) was the cross-linked polymer siNC nanocomposite treatment group, (c) was the cross-linked polymer-cysteine ​​GalNT1 siRNA nanocomposite treatment group, and (d) was the cross-linked polymer-GalNT1 siRNA nanocomposite treatment group.

[0077] In this embodiment, each group contains at least 5 mice.

[0078] The subcutaneous tumor was established subcutaneously in the left forelimb axilla of mice, using RPMI-1640 medium and 10-1 cells. 5 indivual.

[0079] The administration method is tail vein injection, with an injection dose of 200 μL and a dosage of 10 mg / kg, administered three times on days 0, 2, and 4.

[0080] Treatment of the subcutaneous tumor should begin when the tumor volume is approximately 100 mm. 3 Day 0 is considered the starting point, and monitoring is conducted at 2-day intervals. The tumor volume is calculated using the formula: Tumor volume = Length × Width. 2 ÷ 2.

[0081] This embodiment evaluates the therapeutic effect of combined treatment with serine depletion and N-acetylgalactosamine transferase inhibitors using a mouse subcutaneous tumor model.

[0082] like Figure 9 As shown, in a mouse subcutaneous tumor model, the combination therapy of serine depletion and N-acetylgalactosamine transferase inhibitor significantly slowed tumor growth. Compared with the serine depletion group and the N-acetylgalactosamine transferase inhibitor group alone, the tumor volume in the combination therapy group was significantly lower, with a reduction of 47.6%.

[0083] The subcutaneous tumor model also includes CD8. + The detection of T cell infiltration level and MGL level is as follows: After obtaining tumor tissue, a single cell suspension is prepared, labeled with fluorescently labeled antibodies, and then quantified using flow cytometry.

[0084] As shown in Table 1, compared with single therapy, serine depletion combined with N-acetylgalactosamine transferase inhibitors significantly enhanced CD8. + It significantly reduced T-cell immune infiltration and MGL levels.

[0085] Table 1: Example 6 Evaluation of the therapeutic effect of cross-linked polymer-GalNT1 siRNA nanocomposite in a mouse model of systemic metastatic tumors.

[0086] The transfer model was divided into 4 groups: CT26 cells were pretreated in groups (a) as control group, (b) as cross-linked polymer siNC nanocomposite treatment group, (c) as cross-linked polymer-cysteine ​​GalNT1 siRNA nanocomposite treatment group, and (d) as cross-linked polymer-GalNT1 siRNA nanocomposite treatment group.

[0087] The method for establishing the systemic metastatic tumor model involved tail vein injection of CT26 cells after different treatments, using RPMI-1640 medium and a cell count of 10. 5 indivual.

[0088] The survival time of mice in the transfer model was monitored, and data were collected every 2 days.

[0089] like Figure 10 As shown, in the whole-body transfer model, the cross-linked polymer-GalNT1 siRNA nanocomposite treatment group significantly improved the overall survival of mice compared with the cross-linked polymer-cysteine ​​GalNT1 siRNA nanocomposite treatment group.

[0090] In summary, the cross-linked polymer-GalNT1 siRNA nanocomposite provided by this invention has both tumor targeting and multiple regulatory functions. It can consume serine in tumors, downregulate Tn antigen levels, inhibit tumor cell and tissue viability, enhance tumor tissue immune infiltration, and reduce tumor cell metastasis, thereby providing a new strategy for immunotherapy of colorectal cancer.

[0091] The present invention has been described in detail above. Specific examples have been used to illustrate the principles and implementation methods of the invention. The descriptions of the embodiments above are only for the purpose of helping to understand the invention and its core ideas. It should be noted that those skilled in the art can make various improvements and modifications to the invention without departing from its principles, and these improvements and modifications also fall within the protection scope of the claims of the present invention.

Claims

1. A cross-linked polymer-GalNTl siRNA nanocomplex, characterized in that, The cross-linked polymer-siRNA nanocomplex comprises a homocysteine-modified cationic polymer, a homocysteine-modified zwitterionic polymer and a GalNT1 siRNA; and the siRNA is combined with the homocysteine-modified cationic polymer to form a cationic siRNA nanocomplex by electrostatic adsorption, and the homocysteine-modified zwitterionic polymer is cross-linked with the homocysteine-modified cationic polymer by a disulfide bond formed between homocysteines to form a cross-linked polymer-GalNT1 siRNA nanocomplex.

2. The crosslinked polymer-GalNTl siRNA nanocomplex of claim 1, wherein, The N / P ratio of the homocysteine-modified cationic polymer to the siRNA is 15-100:1, preferably 25-35:1; and the mass ratio of the homocysteine-modified cationic polymer to the homocysteine-modified zwitterionic polymer is 1:0.1-5, preferably 1:0.5-1.5; Preferably, the average diameter of the cross-linked polymer-GalNT1 siRNA nanocomplex is 100-250 nm; The sequence of the GalNT1 siRNA is sense (5'-3'): GUGGAAACGAAUCAGUGCUCUA (SEQ ID NO. 1); antisense (5'-3'): UAGAGCACUGAUUCGUUUCCAC (SEQ ID NO. 2).

3. The method for preparing the cross-linked polymer GalNT1 siRNA nanocomposite according to claims 1 and 2, characterized in that, Specifically comprising the following steps: S11: adding GalNT1 siRNA into a homocysteine-modified cationic polymer solution to obtain a cationic polymer-siRNA nanocomplex intermediate by stirring; S12: adding a homocysteine-modified zwitterionic polymer into the cationic siRNA nanocomplex solution to obtain a cross-linked polymer-GalNT1 siRNA nanocomplex by stirring.

4. The method for preparing a homocysteine-modified cationic polymer according to claim 3, characterized by, Comprising the following steps: After free radical polymerization of butyl methacrylate, dimethylaminoethyl methacrylate, a chain transfer agent dithiobenzoic acid 4-cyanopentanoic acid and an initiator, the cationic polymer (intermediate 1) is obtained by dialysis and drying; and after amidation reaction of the intermediate 1 and homocysteine, the homocysteine-modified cationic polymer is obtained by dialysis and drying; Preferably, the molar ratio of the butyl methacrylate, dimethylaminoethyl methacrylate, dithiobenzoic acid 4-cyanopentanoic acid and initiator is 0.8-1.5:0.8-1.5:0.1:0.1; Preferably, the initiator is azobisisobutyronitrile; Preferably, the molar ratio of the intermediate 1 to homocysteine is 1:1.5-3; Preferably, the molecular weight of the homocysteine-modified zwitterionic polymer is 5,000-20,000 Da; Preferably, the conditions of the radical polymerization reaction include: temperature of 40-100℃, stirring rate of 100-200 rpm, and time of 6-12 h; and the conditions of the amidation reaction include: temperature of 10-40℃, stirring rate of 100-200 rpm, and time of 24-48 h.

5. The method of preparing a homocysteine-modified zwitterionic polymer according to claim 3, wherein, The method comprises the following steps: After the methacryloyl sulfobetaine, the chain transfer agent dithiobenzoic acid 4-cyanopentanoic acid, and the initiator are subjected to a radical polymerization reaction, dialysis, and drying, a zwitterionic polymer (intermediate 2) is obtained; after the intermediate 2 and homocysteine are subjected to an amidation reaction, dialysis, and drying, a homocysteine-modified zwitterionic polymer is obtained. Preferably, the molar ratio of the methacryloyl sulfobetaine, the dithiobenzoic acid 4-cyanopentanoic acid, and the initiator is 1.5-2.5:0.1:0.

1. Preferably, the initiator is azobisisobutyronitrile. Preferably, the molar ratio of the intermediate 2 and the homocysteine is 1:1.5-3. Preferably, the homocysteine-modified zwitterionic polymer has a molecular weight of 3000-6000 Da. Preferably, the conditions of the radical polymerization reaction include: temperature of 40-100℃, stirring rate of 100-200 rpm, and time of 6-12 h; and the conditions of the amidation reaction include: temperature of 10-40℃, stirring rate of 100-200 rpm, and time of 24-48 h.

6. The method of claim 3, wherein the cross-linked polymer-GalNTl siRNA nanocomplex is prepared by the steps of: (a) dissolving the cross-linked polymer in a solvent; (b) adding the siRNA to the solution of step (a); and (c) removing the solvent. The step S11 specifically comprises: The homocysteine-modified cationic polymer is dissolved in a citrate buffer solution with a pH of 3.5-5.5, a solution containing GalNT1 siRNA is slowly added dropwise, and the mixture is subjected to oscillation stirring at 4-37℃ for 4-12 h to obtain a cationic polymer-siRNA nanocomposite solution. And / or, the step S12 specifically comprises: the homocysteine-modified zwitterionic polymer is dissolved in a phosphate buffer solution with a pH of 6.5-8.5, the homocysteine-modified zwitterionic polymer solution is added to the cationic polymer-siRNA nanocomposite solution with a pH of 3.5-5.5, the pH is re-adjusted to 6.5-8.5 using a sodium hydroxide solution, and the mixture is subjected to stirring at 20-40℃ for 12-36 h to obtain a crosslinked polymer-GalNT1 siRNA nanocomposite.

7. Use of the crosslinked polymer-GalNT1 siRNA nanocomposite according to any one of claims 1 and 2 and the preparation method according to any one of claims 3-6 in the preparation of a drug for tumor immunotherapy.

8. The cross-linked polymer-GalNTl siRNA nanocomplex for use in the treatment of cancer according to claim 7, characterized in that, The method comprises the following micro-processes: (1) The GalNT1 siRNA silences the expression of GalNT1 in tumor cells or colorectal cancer tissues, and reduces the level of Tn antigens in the cells or tissues; (2) The disulfide bonds formed between the homocysteines are reduced by reducing substances in the tumor cells or colorectal cancer tissues, and the homocysteine residues are exposed; preferably, the reducing substance is hydrogen sulfide. (3) The exposed homocysteine residues, under the catalysis of cystathionine β-synthase in tumor cells or colorectal cancer tissues, bind to serine in the cells or tissues, deplete the level of serine, and further reduce the level of Tn antigen; (4) The reduced level of Tn antigen effectively releases its inhibition on the immune system, activates a strong anti-tumor immune response, and eventually leads to reduced viability and death of tumor cells.

9. Use of the cationic polymer-GalNT1 siRNA nanocomplex of claim 3 in the preparation of a medicament for inhibiting the activity of tumor cells or colorectal cancer tissues.

10. A method of treating a tumor, comprising administering to a subject in need thereof a therapeutically effective amount of a compound of any one of claims 1-9. By administering homocysteine or its modifications to deplete serine in tumor cells, the level of Tn antigen is reduced.