Use of acbd3 in treating fundus diseases

By targeting Acbd3 inhibitors, especially siRNA, the problem of insufficient anti-VEGF treatment in existing technologies has been solved, achieving effective treatment and prevention of fundus diseases, alleviating retinal inflammation, reducing neuronal apoptosis, repairing the blood-retinal barrier, and improving treatment efficacy.

CN121622903BActive Publication Date: 2026-06-23TIANJIN MEDICAL UNIVERSITY EYE HOSPITAL
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
TIANJIN MEDICAL UNIVERSITY EYE HOSPITAL
Filing Date
2026-02-04
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Current technologies for treating fundus diseases, especially wet age-related macular degeneration and diabetic macular edema, do not respond adequately or at all to VEGF therapy, and long-term, frequent VEGF therapy may lead to optic nerve cell degeneration. There is a lack of effective targets and treatment methods.

Method used

By using Acbd3 as a target, drugs can be prepared for intraocular administration by inhibiting Acbd3 activity or expression levels using CRISPR/Cas systems, interfering RNA or vector delivery systems, especially siRNA, to target Acbd3, alleviate retinal inflammation, reduce retinal neuron apoptosis, inhibit abnormal cell activation, and repair the blood-retinal barrier.

Benefits of technology

It effectively alleviates retinal inflammation, reduces neuronal apoptosis, inhibits abnormal cell activation, and repairs damaged barriers, providing a means of treatment and prevention for fundus diseases such as retinopathy, optic neuropathy, and choroidal diseases, improving treatment efficacy and reducing side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121622903B_ABST
    Figure CN121622903B_ABST
Patent Text Reader

Abstract

The application relates to the technical field of biological medicine and fundus disease treatment, in particular to application of Acbd3 in treatment of fundus diseases. It is found that the mRNA expression level and the protein expression level of Acbd3 in the retina of a fundus disease model mouse are significantly higher than those of a control group. After an Acbd3 inhibitor is used, the inflammatory reaction and neuron apoptosis in the retina of the fundus disease model mouse are significantly relieved, abnormal activation of Muller cells and microglia cells can be reduced, and a damaged blood-retina barrier can be repaired.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the fields of biomedicine and fundus disease treatment technology, specifically to the application of Acbd3 in the treatment of fundus diseases. Background Technology

[0002] The fundus is the most important physiological structure of the eyeball, including the choroid, retina, and vitreous humor. The retina, richly supplied with blood vessels and nerves, is the primary structure responsible for visual function and plays a vital physiological role. Fundus diseases, such as vitreous diseases, retinal diseases (including diabetic retinopathy), optic neuropathy, or choroidal diseases, can seriously harm the eye health of people of all ages, potentially leading to vision impairment or even blindness.

[0003] For the treatment of fundus diseases, clinical treatment has long focused on vascular-targeted methods such as anti-VEGF, laser photocoagulation, or surgical intervention. However, about 20-40% of wet age-related macular degeneration and 15-20% of diabetic macular edema do not respond adequately or completely to anti-VEGF treatment. Moreover, long-term and frequent VEGF treatment may also lead to the degeneration of optic nerve cells.

[0004] Acbd3 is a Golgi apparatus-based acyl-CoA-binding protein known to participate in intracellular vesicle transport, lipid metabolism, and organelle structure maintenance. Existing technologies have linked Acbd3 to the diagnosis and treatment of various tumors; for example, patent literature (CN119770658A) describes the application of ACBD3 inhibitors in the preparation of drugs for treating lung cancer and the use of gRNAs to inhibit ACBD3 gene expression. However, its expression characteristics, cellular localization, and functional roles in fundus diseases have not been systematically elucidated, and there is a lack of reports on the therapeutic applications of this molecule in fundus diseases. Summary of the Invention

[0005] This application has discovered a novel target related to fundus diseases - Acbd3, which is Acyl-CoA Binding Domain Containing 3 protein or its encoding gene.

[0006] A first aspect of this application provides the use of Acbd3 as a target in the preparation of products for the treatment and / or prevention of fundus diseases.

[0007] Preferably, the product includes an Acbd3 inhibitor.

[0008] Preferably, the Acbd3 inhibitor inhibits Acbd3 activity or expression level.

[0009] Preferably, the inhibition of Acbd3 activity includes reducing Acbd3 activity to at least 90% of its original activity, for example, at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, at least 10%, or at least 5%.

[0010] Preferably, the inhibition of Acbd3 expression level includes reducing the Acbd3 expression level to up to 90% of the original expression level, for example, up to 90%, up to 80%, up to 70%, up to 60%, up to 50%, up to 40%, up to 30%, up to 20%, up to 10%, or up to 5%.

[0011] Preferably, the Acbd3 inhibitor comprises an agent that knocks out or knocks down Acbd3.

[0012] Preferably, the knockdown includes reducing the expression level to or significantly reducing it to the original expression level.

[0013] Preferably, the knockdown includes reducing the expression level to up to 90% of the original expression level, for example, up to 90%, up to 80%, up to 70%, up to 60%, up to 50%, up to 40%, up to 30%, up to 20%, up to 10%, or up to 5%.

[0014] Preferably, the reagents for knocking out or knocking down Acbd3 include reagents required by the CRISPR / Cas system, reagents required for tissue-specific knockout, or interfering RNA targeting Acbd3.

[0015] Preferably, the Cas proteins used in the CRISPR / Cas system include, but are not limited to, Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5d, Cas5t, Cas5h, Cas5a, Cas6, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2, Csy3, Csy4, Cse1, Cse2, Cse3, Cse4, Cse5e, Csc1, Csc2, Csa5, Csn1, Csn2, Csm1, Csm2, Csm3, Csm4, and Cs m5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx1S, Csf1, Csf2, CsO, Csf4, Csd1, Csd2, Cst1, Cst2, Csh1, Csh2, Csal, Csa2, Csa3, Csa4, Csa5, C2c1, C2c2, C2c3, Cpf1, CARF, DinG, their homologs or modified forms thereof.

[0016] Preferably, the tissue-specific knockout includes, but is not limited to, the Cre / loxp recombinase system.

[0017] Preferably, the interfering RNA includes one or more of siRNA, dsRNA, shRNA, aiRNA, or miRNA.

[0018] The target site sequence of the interfering RNA contains SEQ ID NO: 17, or a nucleotide sequence containing the nucleotide sequence shown in SEQ ID NO: 17 after substitution, deletion and / or addition of one, two or three nucleotides.

[0019] SEQ ID NO: 17: GAAGGAAGAAGAAGAGAAA

[0020] Preferably, the interfering RNA is siRNA.

[0021] Preferably, the sense strand of the siRNA comprises SEQ ID NO: 7, and the antisense strand comprises SEQ ID NO: 8.

[0022] Preferably, the siRNA sequence further includes dangling bases. More preferably, the siRNA contains 1-10 dangling bases.

[0023] Preferably, the suspended base is any one of TT, TC, CC, UC, AU, AA, AC or UU.

[0024] Preferably, the dangling base is located at the 3' end of the sense and / or antisense strands of the interfering RNA.

[0025] In some embodiments, the dangling base is TT, the sense strand of the siRNA contains SEQ ID NO: 15, and the antisense strand contains SEQ ID NO: 16.

[0026] Preferably, the siRNA sequence may include modifications, including enhancement and stabilization chemical modifications (ESC modifications) on the bases.

[0027] Preferably, the siRNA can be delivered via a vector, such as a viral vector or a non-viral vector.

[0028] Preferably, the viral vector includes one or more of the following: lentiviral vector, retroviral vector, adenovirus vector, adeno-associated virus vector, poxvirus vector, or herpesvirus vector.

[0029] Preferably, the non-viral vector includes one or more of liposomes, lipid nanoparticles, polymers, peptides, antibodies, aptamers, or N-acetylgalactosamine.

[0030] Preferably, the treatment and / or prevention of fundus diseases includes one or more of the following: alleviating inflammatory responses in the retina by inhibiting Acbd3, reducing apoptosis of retinal neurons, inhibiting abnormal activation of retinal Müller cells and / or microglia and / or macrophages, or repairing damaged blood-retinal barrier.

[0031] In some embodiments, alleviating the inflammatory response in the retina includes restoring the homeostatic balance between pro-inflammatory and anti-inflammatory factors.

[0032] In some implementations, progressive damage to the NVU is mitigated by alleviating the inflammatory response in the retina.

[0033] Preferably, the product includes a drug.

[0034] Preferably, the drug includes human or veterinary drugs.

[0035] Preferably, the treatment and / or prevention of fundus diseases includes administering an effective amount of an Acbd3 inhibitor to a subject in need.

[0036] Preferably, the administration method includes injection or eye drops.

[0037] Preferably, the application site can be one or more of the following: the aqueous humor in the anterior chamber, the suspensory ligament, the ciliary body, the ciliary body and muscles, the lens, the iris, the vitreous cavity, the retina, the choroid, or the optic nerve.

[0038] In some embodiments, the application site is the vitreous cavity.

[0039] Preferably, the dosage is 1-1000 μL / eye, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 μL / eye.

[0040] Preferably, the Acbd3 inhibitor is an siRNA targeting Acbd3, and the concentration of the siRNA is 1-1000 μg / μL, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 μg / μL.

[0041] In some embodiments, the Acbd3 inhibitor is an siRNA targeting Acbd3, and the effective amount is 1-1000 μg / eye, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 μg / eye.

[0042] Preferably, the fundus disease includes one or more of the following: retinal disease, optic nerve disease, or choroidal disease.

[0043] Preferably, the retinopathy includes diabetic retinopathy, hypertensive retinopathy, retinal vasculitis, retinal detachment, retinal ischemia-reperfusion injury, retinitis pigmentosa, retinoschisis, retinopathy of prematurity, diabetic macular edema, age-related macular degeneration, retinal vein occlusion, or choroidal retinopathy.

[0044] Preferably, choroidal lesions include choroidal neovascularization.

[0045] Preferably, the optic neuropathy includes optic neuritis.

[0046] In some embodiments, the diabetes is type I diabetes or type II diabetes, preferably type II diabetes.

[0047] A second aspect of this application provides the use of an Acbd3 inhibitor in the preparation of products for the treatment and / or prevention of fundus diseases.

[0048] Preferably, the Acbd3 inhibitor inhibits Acbd3 activity or expression level.

[0049] Preferably, the inhibition of Acbd3 activity includes reducing Acbd3 activity to at least 90% of its original activity, for example, at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, at least 10%, or at least 5%.

[0050] Preferably, the inhibition of Acbd3 expression level includes reducing the Acbd3 expression level to up to 90% of the original expression level, for example, up to 90%, up to 80%, up to 70%, up to 60%, up to 50%, up to 40%, up to 30%, up to 20%, up to 10%, or up to 5%.

[0051] Preferably, the Acbd3 inhibitor comprises an agent that knocks out or knocks down Acbd3.

[0052] Preferably, the knockdown includes reducing the expression level to or significantly reducing it to the original expression level.

[0053] Preferably, the knockdown includes reducing the expression level to up to 90% of the original expression level, for example, up to 90%, up to 80%, up to 70%, up to 60%, up to 50%, up to 40%, up to 30%, up to 20%, up to 10%, or up to 5%.

[0054] Preferably, the reagents for knocking out or knocking down Acbd3 include reagents required by the CRISPR / Cas system, reagents required for tissue-specific knockout, or interfering RNA targeting Acbd3.

[0055] Preferably, the Cas proteins used in the CRISPR / Cas system include, but are not limited to, Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5d, Cas5t, Cas5h, Cas5a, Cas6, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2, Csy3, Csy4, Cse1, Cse2, Cse3, Cse4, Cse5e, Csc1, Csc2, Csa5, Csn1, Csn2, Csm1, Csm2, Csm3, Csm4, and Cs m5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx1S, Csf1, Csf2, CsO, Csf4, Csd1, Csd2, Cst1, Cst2, Csh1, Csh2, Csal, Csa2, Csa3, Csa4, Csa5, C2c1, C2c2, C2c3, Cpf1, CARF, DinG, their homologs or modified forms thereof.

[0056] Preferably, the tissue-specific knockout includes, but is not limited to, the Cre / loxp recombinase system.

[0057] Preferably, the interfering RNA includes one or more of siRNA, dsRNA, shRNA, aiRNA, or miRNA.

[0058] The target site sequence of the interfering RNA contains SEQ ID NO: 17, or a nucleotide sequence containing the nucleotide sequence shown in SEQ ID NO: 17 after substitution, deletion and / or addition of one, two or three nucleotides.

[0059] Preferably, the interfering RNA is siRNA.

[0060] Preferably, the sense strand of the siRNA comprises SEQ ID NO: 7, and the antisense strand comprises SEQ ID NO: 8.

[0061] Preferably, the siRNA sequence further includes dangling bases. More preferably, the siRNA contains 1-10 dangling bases.

[0062] Preferably, the suspended base is any one of TT, TC, CC, UC, AU, AA, AC or UU.

[0063] Preferably, the dangling base is located at the 3' end of the sense and / or antisense strands of the interfering RNA.

[0064] In some embodiments, the dangling base is TT, the sense strand of the siRNA contains SEQ ID NO: 15, and the antisense strand contains SEQ ID NO: 16.

[0065] Preferably, the siRNA sequence may include modifications, including enhancement and stabilization chemical modifications (ESC modifications) on the bases.

[0066] Preferably, the siRNA can be delivered via a vector, such as a viral vector or a non-viral vector.

[0067] Preferably, the viral vector includes one or more of the following: lentiviral vector, retroviral vector, adenovirus vector, adeno-associated virus vector, poxvirus vector, or herpesvirus vector.

[0068] Preferably, the non-viral vector includes one or more of liposomes, lipid nanoparticles, polymers, peptides, antibodies, aptamers, or N-acetylgalactosamine.

[0069] Preferably, the fundus disease includes one or more of the following: retinal disease, optic nerve disease, or choroidal disease.

[0070] Preferably, the retinopathy includes diabetic retinopathy, hypertensive retinopathy, retinal vasculitis, retinal detachment, retinal ischemia-reperfusion injury, retinitis pigmentosa, retinoschisis, retinopathy of prematurity, diabetic macular edema, age-related macular degeneration, retinal vein occlusion, or choroidal retinopathy.

[0071] Preferably, choroidal lesions include choroidal neovascularization.

[0072] Preferably, the optic neuropathy includes optic neuritis.

[0073] In some embodiments, the diabetes is type I diabetes or type II diabetes, preferably type II diabetes.

[0074] A third aspect of this application provides an interfering RNA whose target site sequence comprises SEQ ID NO: 17, or a nucleotide sequence comprising the nucleotide sequence shown in SEQ ID NO: 17 after substitution, deletion and / or addition of one, two or three nucleotides.

[0075] Preferably, the interfering RNA is siRNA, wherein the sense strand of the siRNA contains SEQ ID NO: 7 and the antisense strand contains SEQ ID NO: 8.

[0076] Preferably, the siRNA sequence further includes dangling bases. More preferably, the siRNA contains 1-10 dangling bases.

[0077] Preferably, the suspended base is any one of TT, TC, CC, UC, AU, AA, AC or UU.

[0078] Preferably, the dangling base is located at the 3' end of the sense and / or antisense strands of the interfering RNA.

[0079] In some embodiments, the dangling base is TT, the sense strand of the siRNA contains SEQ ID NO: 15, and the antisense strand contains SEQ ID NO: 16.

[0080] Preferably, the siRNA sequence may include modifications, including enhancement and stabilization chemical modifications (ESC modifications) on the bases.

[0081] A fourth aspect of this application provides a vector comprising the interfering RNA.

[0082] The vector can be a viral vector or a non-viral vector.

[0083] Preferably, the viral vector includes one or more of the following: lentiviral vector, retroviral vector, adenovirus vector, adeno-associated virus vector, poxvirus vector, or herpesvirus vector.

[0084] Preferably, the non-viral vector includes one or more of liposomes, lipid nanoparticles, polymers, peptides, antibodies, aptamers, or N-acetylgalactosamine.

[0085] A fifth aspect of this application provides the use of the interfering RNA or the vector, or the knockout or knockdown of Acbd3, in the preparation of products for the treatment and / or prevention of fundus diseases.

[0086] Preferably, the knockdown includes reducing the expression level to or significantly reducing it to the original expression level.

[0087] Preferably, the knockdown includes reducing the expression level to up to 90% of the original expression level, for example, up to 90%, up to 80%, up to 70%, up to 60%, up to 50%, up to 40%, up to 30%, up to 20%, up to 10%, or up to 5%.

[0088] Preferably, the reagents for knocking out or knocking down Acbd3 include reagents required by the CRISPR / Cas system, reagents required for tissue-specific knockout, or interfering RNA targeting Acbd3.

[0089] Preferably, the Cas proteins used in the CRISPR / Cas system include, but are not limited to, Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5d, Cas5t, Cas5h, Cas5a, Cas6, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2, Csy3, Csy4, Cse1, Cse2, Cse3, Cse4, Cse5e, Csc1, Csc2, Csa5, Csn1, Csn2, Csm1, Csm2, Csm3, Csm4, and Cs m5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx1S, Csf1, Csf2, CsO, Csf4, Csd1, Csd2, Cst1, Cst2, Csh1, Csh2, Csal, Csa2, Csa3, Csa4, Csa5, C2c1, C2c2, C2c3, Cpf1, CARF, DinG, their homologs or modified forms thereof.

[0090] Preferably, the tissue-specific knockout includes, but is not limited to, the Cre / loxp recombinase system.

[0091] Preferably, the interfering RNA includes one or more of siRNA, dsRNA, shRNA, aiRNA, or miRNA.

[0092] In some embodiments, the reagents used to knock out or knock down Acbd3 include siRNA.

[0093] Preferably, the siRNA sequence may contain modifications, such as modifications on the bases.

[0094] Preferably, the fundus disease includes one or more of the following: retinal disease, optic nerve disease, or choroidal disease.

[0095] Preferably, the retinopathy includes diabetic retinopathy, hypertensive retinopathy, retinal vasculitis, retinal detachment, retinal ischemia-reperfusion injury, retinitis pigmentosa, retinoschisis, retinopathy of prematurity, diabetic macular edema, age-related macular degeneration, retinal vein occlusion, or choroidal retinopathy.

[0096] Preferably, choroidal lesions include choroidal neovascularization.

[0097] Preferably, the optic neuropathy includes optic neuritis.

[0098] In some embodiments, the diabetes is type I diabetes or type II diabetes, preferably type II diabetes.

[0099] A sixth aspect of this application provides an Acbd3 inhibitor that inhibits Acbd3 activity or expression level.

[0100] Preferably, the inhibition of Acbd3 activity includes reducing Acbd3 activity to at least 90% of its original activity, for example, at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, at least 10%, or at least 5%.

[0101] Preferably, the inhibition of Acbd3 expression level includes reducing the Acbd3 expression level to up to 90% of the original expression level, for example, up to 90%, up to 80%, up to 70%, up to 60%, up to 50%, up to 40%, up to 30%, up to 20%, up to 10%, or up to 5%.

[0102] Preferably, the Acbd3 inhibitor comprises an agent that knocks out or knocks down Acbd3.

[0103] Preferably, the reagents for knocking out or knocking down Acbd3 include reagents required by the CRISPR / Cas system, reagents required for tissue-specific knockout, or interfering RNA targeting Acbd3.

[0104] Preferably, the Cas proteins used in the CRISPR / Cas system include, but are not limited to, Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5d, Cas5t, Cas5h, Cas5a, Cas6, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2, Csy3, Csy4, Cse1, Cse2, Cse3, Cse4, Cse5e, Csc1, Csc2, Csa5, Csn1, Csn2, Csm1, Csm2, Csm3, Csm4, and Cs m5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx1S, Csf1, Csf2, CsO, Csf4, Csd1, Csd2, Cst1, Cst2, Csh1, Csh2, Csal, Csa2, Csa3, Csa4, Csa5, C2c1, C2c2, C2c3, Cpf1, CARF, DinG, their homologs or modified forms thereof.

[0105] Preferably, the tissue-specific knockout includes, but is not limited to, the Cre / loxp recombinase system.

[0106] Preferably, the interfering RNA includes one or more of siRNA, dsRNA, shRNA, aiRNA, or miRNA.

[0107] The target site sequence of the interfering RNA contains SEQ ID NO: 17, or a nucleotide sequence containing the nucleotide sequence shown in SEQ ID NO: 17 after substitution, deletion and / or addition of one, two or three nucleotides.

[0108] Preferably, the interfering RNA is siRNA.

[0109] Preferably, the sense strand of the siRNA comprises SEQ ID NO: 7, and the antisense strand comprises SEQ ID NO: 8.

[0110] Preferably, the siRNA sequence further includes dangling bases. More preferably, the siRNA contains 1-10 dangling bases.

[0111] Preferably, the suspended base is any one of TT, TC, CC, UC, AU, AA, AC or UU.

[0112] Preferably, the dangling base is located at the 3' end of the sense and / or antisense strands of the interfering RNA.

[0113] In some embodiments, the dangling base is TT, the sense strand of the siRNA contains SEQ ID NO: 15, and the antisense strand contains SEQ ID NO: 16.

[0114] Preferably, the siRNA sequence may include modifications, including enhancement and stabilization chemical modifications (ESC modifications) on the bases.

[0115] Preferably, the siRNA can be delivered via a vector, such as a viral vector or a non-viral vector.

[0116] Preferably, the viral vector includes one or more of the following: lentiviral vector, retroviral vector, adenovirus vector, adeno-associated virus vector, poxvirus vector, or herpesvirus vector.

[0117] Preferably, the non-viral vector includes one or more of liposomes, lipid nanoparticles, polymers, peptides, antibodies, aptamers, or N-acetylgalactosamine.

[0118] A seventh aspect of this application provides a medicament comprising the Acbd3 inhibitor described in the sixth aspect, the interfering RNA described in the third aspect, or the vector described in the fourth aspect.

[0119] Preferably, the drug further comprises pharmaceutically acceptable excipients.

[0120] Preferably, the pharmaceutically acceptable excipients include, but are not limited to, one or more of the following: diluents, wetting agents, fillers, binders, lubricants, disintegrants, antioxidants, buffers, suspending agents, solubilizers, thickeners, stabilizers, or preservatives.

[0121] Preferably, the drug can be administered via any suitable route of administration disclosed in the prior art, such as injection or eye drops.

[0122] Preferably, the drug can be any suitable dosage form disclosed in the prior art, such as dosage forms suitable for injection or eye drops, including but not limited to powder, emulsion, suspension, injection, and eye drops.

[0123] Preferably, the various dosage forms of the drug can be prepared according to conventional pharmaceutical production methods.

[0124] Preferably, the drug may contain 0.01-99.5% (e.g., 0.01%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.5%) of the Acbd3 inhibitor, interfering RNA, or vector described in this application.

[0125] The drug can be for human or veterinary use.

[0126] An eighth aspect of this application provides a method for treating and / or preventing fundus diseases, the method comprising administering an effective amount of the Acbd3 inhibitor, the interfering RNA, the vector, or the drug to a subject in need.

[0127] Preferably, the method of administration includes injection or eye drops.

[0128] Preferably, the application site can be one or more of the following: the aqueous humor in the anterior chamber, the suspensory ligament, the ciliary body, the ciliary body and muscles, the lens, the iris, the vitreous cavity, the retina, the choroid, or the optic nerve.

[0129] In some embodiments, the application site is the vitreous cavity.

[0130] Preferably, the dosage is 1-1000 μL / eye, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 μL / eye.

[0131] Preferably, the Acbd3 inhibitor is an siRNA targeting Acbd3, and the concentration of the siRNA is 1-1000 μg / μL, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 μg / μL.

[0132] In some embodiments, the Acbd3 inhibitor is an siRNA targeting Acbd3, and the effective amount is 1-1000 μg / eye, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 μg / eye.

[0133] The ninth aspect of this application provides the use of an Acbd3 inhibitor in the preparation of products for the treatment and / or prevention of fundus diseases by alleviating inflammatory responses in the retina, reducing apoptosis of retinal neurons, inhibiting abnormal activation of retinal Müller cells and / or microglia and / or macrophages, and / or repairing damaged blood-retinal barrier.

[0134] A tenth aspect of this application provides a method for alleviating inflammatory responses in the retina, reducing apoptosis of retinal neurons, inhibiting abnormal activation of retinal Müller cells and / or microglia and / or macrophages, and / or repairing damaged blood-retinal barrier, the method comprising administering an effective amount of an Acbd3 inhibitor to a subject in need.

[0135] The eleventh aspect of this application provides the use of Acbd3 as a biomarker in the preparation of products for diagnosing and / or prognostic assessment of fundus diseases.

[0136] Preferably, the Acbd3 is one or more Acbd3s in cells, tissues or organs.

[0137] Preferably, the cells include cells derived from the eye; more preferably, the cells include cells derived from the retina, such as Müller cells or microglia.

[0138] Preferably, the tissue includes tissue derived from the eye, such as the retina.

[0139] Preferably, the organ includes the eye.

[0140] Preferably, the diagnosis and / or prognostic assessment of fundus diseases includes detecting the expression levels of Acbd3 gene mRNA and / or Acbd3 protein.

[0141] Preferably, the diagnosis and / or prognostic assessment of fundus diseases includes comparing the expression levels of Acbd3 gene mRNA and / or Acbd3 protein with a threshold, which is obtained from previous experiments. That is, the threshold is determined by the degree of difference in the expression levels of Acbd3 gene mRNA and / or Acbd3 protein between subjects with fundus diseases and subjects without fundus diseases through experiments and data analysis.

[0142] Preferably, when the expression levels of Acbd3 gene mRNA and / or Acbd3 protein differ from the threshold or are significantly different (the difference is statistically significant, for example...), p <0.05, p <0.01, p <0.005, pIf the expression level is <0.001, a diagnosis of fundus disease is made. For example, when the expression level of Acbd3 gene mRNA and / or Acbd3 protein is higher than or significantly higher than the threshold, a diagnosis of fundus disease is made.

[0143] Preferably, the fundus disease includes one or more of the following: retinal disease, optic nerve disease, or choroidal disease.

[0144] Preferably, the retinopathy includes diabetic retinopathy, hypertensive retinopathy, retinal vasculitis, retinal detachment, retinal ischemia-reperfusion injury, retinitis pigmentosa, retinoschisis, retinopathy of prematurity, diabetic macular edema, age-related macular degeneration, retinal vein occlusion, or choroidal retinopathy.

[0145] Preferably, choroidal lesions include choroidal neovascularization.

[0146] Preferably, the optic neuropathy includes optic neuritis.

[0147] In some embodiments, the diabetes is type I diabetes or type II diabetes, preferably type II diabetes.

[0148] The twelfth aspect of this application provides a method for diagnosing and / or prognostically assessing fundus diseases, the method comprising detecting Acbd3.

[0149] The detection of Acbd3 refers to the detection of the presence or expression level of Acbd3.

[0150] Preferably, the Acbd3 is one or more Acbd3s in cells, tissues or organs.

[0151] Preferably, the cells include cells derived from the eye; more preferably, the cells include cells derived from the retina, such as Müller cells or microglia.

[0152] Preferably, the tissue includes tissue derived from the eye, such as the retina.

[0153] Preferably, the organ includes the eye.

[0154] Preferably, the method includes detecting the expression levels of Acbd3 gene mRNA and / or Acbd3 protein.

[0155] Preferably, the method includes comparing the expression levels of Acbd3 gene mRNA and / or Acbd3 protein with a threshold, wherein the threshold is obtained from previous experiments, i.e., the threshold is determined by the degree of difference in the expression levels of Acbd3 gene mRNA and / or Acbd3 protein between subjects with fundus diseases and subjects without fundus diseases through experiments and data analysis.

[0156] Preferably, when the expression levels of Acbd3 gene mRNA and / or Acbd3 protein differ from the threshold or are significantly different (the difference is statistically significant, for example...), p <0.05, p <0.01, p <0.005, p If the expression level is <0.001, a diagnosis of fundus disease is made. For example, when the expression level of Acbd3 gene mRNA and / or Acbd3 protein is higher than or significantly higher than the threshold, a diagnosis of fundus disease is made.

[0157] Preferably, the fundus disease includes one or more of the following: retinal disease, optic nerve disease, or choroidal disease.

[0158] Preferably, the retinopathy includes diabetic retinopathy, hypertensive retinopathy, retinal vasculitis, retinal detachment, retinal ischemia-reperfusion injury, retinitis pigmentosa, retinoschisis, retinopathy of prematurity, diabetic macular edema, age-related macular degeneration, retinal vein occlusion, or choroidal retinopathy.

[0159] Preferably, choroidal lesions include choroidal neovascularization.

[0160] Preferably, the optic neuropathy includes optic neuritis.

[0161] In some embodiments, the diabetes is type I diabetes or type II diabetes, preferably type II diabetes.

[0162] The “method” or “application” described in this application may be for therapeutic or non-therapeutic purposes.

[0163] The terms "comprising" or "including" as used in this application are open-ended descriptions, encompassing the specified components or steps described, as well as other specified components or steps that do not materially affect them.

[0164] The term "and / or" as used in this application includes all combinations of items connected by the term, and should be regarded as each combination having been individually listed in this application. For example, "A and / or B" includes "A", "B" and "A and B", and "A, B and / or C" includes "A", "B", "C", "A and B", "A and C", "B and C" and "A and B and C".

[0165] The term "treatment" as used in this application means slowing, interrupting, preventing, controlling, stopping, reducing, or reversing the progression or severity of a sign, symptom, disorder, condition, or disease after the disease has begun to develop, but does not necessarily involve the complete elimination of all disease-related signs, symptoms, conditions, or disorders.

[0166] The term "pharmaceutically acceptable" as used in this application refers to the biological activity and characteristics of the active substance (e.g., an Acbd3 inhibitor) of the product of this application, which neither significantly irritates the organism nor inhibits its biological activity.

[0167] The term "prevention" as used in this application refers to all actions taken to suppress or delay the progression of symptoms by applying the products described in this application (e.g., Acbd3 inhibitors).

[0168] The term "diagnosis" as used in this application refers to determining whether a patient had a disease or condition in the past or at the time of diagnosis, or determining the progression or potential future progression of a disease.

[0169] The “prognostic assessment” mentioned in this application refers to assessing a patient’s response to treatment and the risk of developing the disease in the future.

[0170] The term "effective amount" as used in this application refers to the amount or dose of the product of this application (e.g., an Acbd3 inhibitor) that provides the desired treatment or prevention after being administered to a subject in one or more doses.

[0171] The "subject" mentioned in this application can be a human or a non-human mammal. The non-human mammal can be a wild animal, a zoo animal, an economic animal, a pet, a laboratory animal, etc. Preferably, the non-human mammal includes, but is not limited to, pigs, cattle, sheep, horses, donkeys, jackals, minks, foxes, camels, dogs, cats, rabbits, mice (e.g., rats, mice, guinea pigs, hamsters, gerbils, chinchillas, squirrels) or monkeys, etc. Attached Figure Description

[0172] The embodiments of this application will now be described in detail with reference to the accompanying drawings, wherein:

[0173] Figure 1 Quantitative analysis of Acbd3 mRNA expression in the retina of db / m and db / db mice using qRT-PCR, with β-actin as an internal control. n =5;

[0174] Figure 2 Western blot analysis was used to verify the expression of Acbd3 protein in the db / db retina. The left image is a band plot (with β-actin as an internal control); the right image is a quantitative bar chart (normalized with β-actin and expressed as fold change). n =6;

[0175] Figure 3 Immunofluorescence staining results of Acbd3 (red) and F4 / 80 (green) in retinal sections of dbm and db / db mice. Cell nuclei were counterstained with DAPI (blue).

[0176] Figure 4 qRT-PCR was used to detect the expression level of Acbd3 mRNA in BV2 cells treated with different concentrations of Acbd3 siRNA (GAPDH was used as an internal control). n =6), where the group without LPS treatment is the Ctrl group, the group transfected with the disordered control is the NC group, 50nM represents the treatment with 1.0 μg / mL LPS and 50nM of Acbd3-targeting siRNA, 100nM represents the treatment with 1.0 μg / mL LPS and 100nM of Acbd3-targeting siRNA, and 200nM represents the treatment with 1.0 μg / mL LPS and 200nM of Acbd3-targeting siRNA.

[0177] Figure 5 qRT-PCR quantitative analysis of Acbd3 mRNA expression;

[0178] Figure 6 Representative morphological images of BV2 cells observed under an optical microscope. Among them, Ctrl: untreated BV2 cells; LPS group: stimulated with 1 μg / mL LPS for 24 h; Acbd3 siRNA group: transfected with Acbd3 siRNA 6 h before LPS stimulation; NC group: transfected with disordered control sequence 6 h before LPS stimulation.

[0179] Figure 7 qRT-PCR was used to quantitatively analyze the relative expression levels of M1-related pro-inflammatory genes (TNF-α, iNOS, CCL2, and IL-1β).

[0180] Figure 8 Western blot analysis of M1 / M2 polarized cell-related protein markers showed banding and quantitative histograms. CD86 was identified as a marker for M1 polarized cells, and Arg-1 as a marker for M2 polarized cells. β-actin served as an internal control. n =6;

[0181] Figure 9 Electron microscope images show the morphology of the Golgi apparatus in BV2 cells under different treatments;

[0182] Figure 10 qRT-PCR was used to detect the expression of Acbd3 in the retina of mice in each group;

[0183] Figure 11 qRT-PCR was used to detect the expression of various inflammatory factors in the retinas of mice in each group;

[0184] Figure 12 TUNEL staining was used to detect retinal apoptosis in mice in each group. Among them, ONL is the outer nuclear layer, INL is the inner nuclear layer, GCL is the ganglion cell layer, OPL is the outer plexiform layer, and IPL is the inner plexiform layer.

[0185] Figure 13 GFAP staining was used to detect the activation of retinal Müller cells in mice of each group;

[0186] Figure 14 F4 / 80 staining was used to detect the activation of retinal microglia in mice of each group.

[0187] Figure 15 The cadaverine leakage test was used to detect retinal vascular leakage in mice of each group.

[0188] In the figures, ns indicates no statistically significant difference, and * indicates no statistically significant difference. p <0.05, ** indicates p <0.01, *** indicates p <0.001, **** indicates p <0.0001. Detailed Implementation

[0189] The technical solutions of the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, and not all of them. Based on the embodiments of this application, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of this application.

[0190] The Acbd3-siRNA used in the cell experiments of this application was purchased from Heyuan Biotechnology (Shanghai) Co., Ltd.

[0191] The Acbd3-siRNA drug used in the animal experiments of this application was purchased from Shanghai Jima Pharmaceutical Technology Co., Ltd., catalog number A17001.

[0192] The non-human animals and methods of raising them used in this application:

[0193] C57BLKS / J db / db mice were used as a type 2 diabetes model, and dbm mice were used as normal controls. All animals were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd. (SPF grade). All animal husbandry and experimental procedures complied with the relevant regulations of the Animal Protection and Ethics Committee of Tianjin Medical University and were approved by the Laboratory Animal Care and Use Committee of Tianjin Medical University Eye Hospital. Animals were allowed to acclimatize to their environment for one week, with 12-hour alternating light and dark lighting, humidity of 45-65%, temperature of 21-25℃, and unlimited food and water at room temperature. All procedures involving mice were approved by the Laboratory Animal Protection and Use Committee of Tianjin Medical University and adhered to ARVO standards regarding the use of animals in ophthalmological and visual research.

[0194] The RNA extraction step is used in this application:

[0195] Mouse retinal sample processing: Week-old mice were euthanized by cervical dislocation, and the right eyeball was quickly enucleated. The retina was harvested and cryopreserved at -80°C. Following the universal RNA purification kit (EZBioscience, EZB-RN4), the cryopreserved retinal tissue was transferred to a pre-chilled homogenizing tube, 1 mL of lysis buffer RL was added, and the tissue was thoroughly homogenized using an electric homogenizer until no obvious tissue clumps remained (approximately 30 s × 3 times, on ice). Total RNA was extracted from the mouse retinal samples according to the method described in the kit instructions.

[0196] The RNA reverse transcription step used in this application:

[0197] According to the reverse transcription kit (EZBioscience, EZB-miRT4), transfer RNA samples to an RNase-free PCR tube, add 2 μL of 5×gDNA Eraser Buffer, and then add RNase-Free ddH2O to a final volume of 10 μL. Add 4 μL of 5×Reaction Buffer, 1 μL of dNTP Mix (10 mM each), and 1 μL of reverse transcriptase (200 U / μL) to the tube. Gently mix and centrifuge (2,000 rpm × 10 s). Incubate at 42°C for 15 min (reverse transcription reaction); heat at 85°C for 5 min (inactivation of reverse transcriptase); store at 4°C or -20°C for long-term storage.

[0198] The qRT-PCR steps used in this application are as follows:

[0199] The design and synthesis of gene-specific primers were completed by Sangon Biotech, and dissolved in ddH2O buffer (stored at -20℃). The reaction system according to the 2×SYBR Green qPCR kit (EZBioscience, EZB-A0010CGQ) was as follows: 10 μL system (containing 2×EZB qPCR Master Mix, 10 μM forward and reverse primers, cDNA template, and ddH2O). Reagents were added sequentially according to the above formula, and the tube was gently tapped to mix, avoiding air bubbles. Pre-denaturation: 95℃ for 3 min; Cycles (40 times): 95℃ for 10 s → 60℃ for 30 s (fluorescence signal acquisition); Melting curve: 95℃ for 15 s → 60℃ for 1 min → 95℃ for 15 s (product specificity detection). The relative expression level was calculated using the 2^-ΔΔCt method: ΔCt = Ct (target gene) - Ct (internal reference gene); ΔΔCt = ΔCt (experimental group) - ΔCt (control group); a single peak in the melting curve indicates good amplification specificity, excluding interference from primer dimers or non-specific products. Some primer sequences used in this application are shown in Table 1.

[0200] Table 1

[0201]

[0202] The retinal protein blot analysis steps used in this application are as follows:

[0203] ① Retinal tissue homogenization and protein assay: Frozen retinal tissue was collected, pre-chilled RIPA lysis buffer was added, and the tissue was homogenized on ice for 30 seconds × 3 times using an electric homogenizer. The homogenate was then incubated at 4℃ for 30 min for lysis. The supernatant was collected by centrifugation at 12000 rpm for 15 min (4℃). The supernatant was the total protein extract. The absorbance at 562 nm was measured using the BCA protein quantification kit (Thermo Fisher) according to the manufacturer's instructions. A standard curve was plotted to calculate the protein concentration, and the sample concentration was adjusted to 30 μg / μL.

[0204] ② SDS-PAGE electrophoresis and transfer: Prepare separating and stacking gels, pour the gels and polymerize for 30 min; load 20 μg total protein into each well, add 5× loading buffer, and electrophores at constant voltage until bromophenol blue reaches the bottom of the gel; use wet transfer to transfer the gel to a 0.22 μm PVDF membrane, transfer at constant voltage (ice bath cooling to prevent overheating); after transfer, immerse the PVDF membrane in 5% skim milk powder-TBST buffer, and block on a shaker at room temperature for 1 h to block non-specific binding sites.

[0205] ③ Antibody incubation and signal detection: Primary antibodies against the target proteins were added, including CD86 (1:2000, Proteintech, 13395-1-AP), Arginase-1 (Arg-1, 1:2000, Cell Signaling Technology, 933668), Acbd3 (1:1000, BOSTER, M05645), and β-actin (1:3000, Proteintech, 20536-1-AP), and incubated overnight at 4°C on a shaker. After washing the membrane three times with TBST (10 min each time), HRP-labeled secondary antibodies (dilution ratio 1:5000-1:10000) were added, and the membrane was incubated for 1 h at room temperature on a shaker. After washing the membrane three times with TBST, ECL chemiluminescent substrate was added, and images were acquired using a chemiluminescence imaging system.

[0206] The mouse retinal TUNEL apoptosis staining procedure used in this application is as follows:

[0207] After deep anesthetizing mice using the cervical dislocation method, the eyeballs were removed, and the corneas were immediately placed face down in OCT composite cryo-media and stored at -80°C for sectioning.

[0208] Preparation of frozen sections: Before sectioning, the eyeballs were removed from -80℃ and quickly transferred to a -20℃ cryostat for pre-thawing for 10-15 min. The parameters were adjusted to perform continuous coronal sections with a thickness of 6 μm. The sections were attached to glass slides treated with poly-L-lysine and temporarily stored in a -20℃ freezer.

[0209] Tissue fixation and pretreatment: Frozen sections were fixed in 4% paraformaldehyde fixative at room temperature for 30 min; rinsed three times with PBS buffer (pH=7.4), 5 min each time. Then endogenous peroxidase blocking was performed: sections were immersed in 3% H2O2 methanol solution (prepared in the dark) and blocked at room temperature for 10 min; rinsed three times with PBS, 5 min each time.

[0210] Permeation and TUNEL labeling: Immerse the slides in permeation solution, dissolve 0.1% Triton X-100 in 0.1% sodium citrate buffer (pH=6.0), and incubate on ice for 2 min to promote reagent permeation; wash 3 times with PBS, 5 min each time, and then perform the labeling reaction.

[0211] Following the Roche In Situ Cell Death Detection Kit instructions, TUNEL reaction solution was prepared by mixing labeling buffer (Solution A) and terminal deoxynucleotidyl transferase (TdT, Solution B) at a volume ratio of 9:1. Three groups were set up: a positive control group (pretreated with DNase I for 1 h before adding TUNEL reaction solution), a negative control group (labeling buffer only), and an experimental group (50 μL TUNEL reaction solution added). All slides were incubated in a light-protected 37°C incubator for 60 min. The slides were washed three times with PBS for 8 min each time.

[0212] Nuclear counterstaining and result observation: Remove excess liquid, add DAPI staining solution (1 μg / mL), incubate at room temperature in the dark for 5 min, and mount with anti-fluorescence quenching mounting medium.

[0213] Observation was performed using a confocal laser scanning microscope. A 200 μm region lateral to the optic disc in the posterior pole of the retina was selected, and five consecutive 20× high-power fields (HPF) were collected for each slice. Results: TUNEL-positive cells showed green fluorescence signals (FITC channels), which completely overlapped with the blue nuclei stained by DAPI (DAPI channels), and appeared shrunken, round, or irregular in shape, thus serving as a morphological marker of retinal cell apoptosis.

[0214] The staining procedure for frozen sections of mouse retina used in this application is as follows:

[0215] Following the method described above (preparation steps for frozen sections in TUNEL apoptosis staining of mouse retina), 6 μm serial frozen sections of the retina of 16-week-old mice were prepared. The sections were fixed with 4% paraformaldehyde fixative at room temperature for 30 min, and then rinsed three times with PBS (pH=7.4) for 10 min each time.

[0216] Tissue blocking: Immerse the tissue section in blocking solution and incubate at room temperature for 1 hour to block non-specific antigen binding sites.

[0217] Primary antibody incubation: Remove the blocking solution and add the required antibodies, including rabbit anti-GFAP monoclonal antibody (Abcam, ab7260, 1:500), rat anti-F4 / 80 monoclonal antibody (Abcam, ab6640, 1:200), and mouse anti-Acbd3 (BOSTER, M05645, 1:200). Incubate overnight (approximately 16 hours) in a humidified chamber at 4°C.

[0218] Secondary antibody reaction and counterstaining: After washing three times with PBS for 10 min each time, add Alexa Fluor 488-labeled goat anti-rabbit IgG (Abcam, ab150077, 1:1000), Alexa Fluor 488-labeled goat anti-rat IgG (Abcam, ab150157, 1:1000), or Alexa Fluor 594-labeled goat anti-mouse IgG (Abcam, ab150116, 1:1000), and incubate at room temperature in the dark for 2-4 h. Wash three more times with PBS for 10 min each time. Finally, add DAPI staining solution (1 μg / ml), incubate at room temperature in the dark for 5 min, and mount with anti-fluorescence quenching mounting medium.

[0219] Fluorescence observation and image acquisition: Using a confocal laser scanning microscope, observation was performed under a designated channel. A 200 μm region lateral to the optic disc in the posterior pole of the retina was selected. Five consecutive 20× high-power fields (HPF) were acquired for each slice, and the fluorescence distribution and intensity characteristics were recorded.

[0220] The cadaverine staining procedure used in this application to mark retinal vascular leakage is as follows:

[0221] Mice were deeply anesthetized with Avodin to ensure no physical response during the procedure. After anesthesia, mice were fixed in a stereotaxic apparatus, and the tail vein was exposed. AF647-Cad working solution was prepared at a dose of 5 mg / kg body weight and slowly injected via the tail vein using a 1 mL sterile syringe (injection rate ≈ 0.1 mL / s) to ensure uniform distribution of the dye into the systemic circulation. Anesthesia was maintained for 30 min after injection to promote sufficient interaction between the dye and the vascular endothelium. The mouse eyeballs were dissected, and the optic nerve was perfused with 4% paraformaldehyde phosphate buffer (pH=7.4) for 15 min for fixation. Subsequently, the retinal tissue was excised, cut into a clover shape, and fixed in anhydrous methanol at 4°C for 0.5 h. The fixed retinal tissue was rinsed three times with PBS, blocked at 4°C for 2 h, stained overnight at 4°C in the dark with IB4, rinsed four times with 0.3% Triton X-100, and transferred to a glass slide after each 1 h wash. The retina was gently flattened with ophthalmic forceps (avoiding mechanical traction damage), covered with a coverslip, and observed under a confocal laser scanning microscope. Obtain a two-dimensional tiled image of the retinal vascular network.

[0222] Example 1: Expression and localization of Acbd3 in the retina of db / db mice

[0223] In this study, qRT-PCR was used to detect the endogenous mRNA level of Acbd3 in the retinal tissue of db / db mice at different ages (16 and 22 weeks). The results showed that, compared with the dbm group, Acbd3 mRNA expression was significantly upregulated between 16 and 22 weeks of age as diabetes progressed. Figure 1 ).

[0224] Western blot analysis further confirmed that the expression level of Acbd3 protein in the retinas of 16-week-old and 22-week-old db / db mice was significantly higher than that in the dbm group, and showed an increasing trend with disease progression. Figure 2 This is consistent with the results of mRNA detection.

[0225] Immunofluorescence staining showed that Acbd3 signal was mainly located at F4 / 80. + Microglia, and significantly enhanced in db / db group mice (see [reference]). Figure 3 The results suggest that the upregulation of Acbd3 is closely related to diabetes-induced microglial activation.

[0226] Example 2: LPS stimulation-induced pro-inflammatory polarization model of BV2 cells and the effect of Acbd3 knockdown on the model.

[0227] 1. BV2 (microglia) cell line was cultured in DMEM / F12 medium containing 10% fetal bovine serum and 1% penicillin-streptomycin in a 37°C, 5% CO2 incubator. The medium was changed every 2-3 days, and cells were passaged when confluence reached 80%-90%. During passage, the old medium was discarded, and the cells were gently washed twice with PBS (pH=7.4) buffer. The cells were then incubated at 37°C for 1-2 min with 0.25% trypsin-EDTA digestion solution until they became rounded and gaps appeared. Serum-containing medium was then added to terminate the digestion. After centrifugation at 1000 rpm for 5 min, the supernatant was discarded, and the cells were resuspended and seeded at a ratio of 1:3-1:5.

[0228] 2. Cell transfection: BV2 cells were transfected at a rate of 5 × 10⁻⁶ cells / year. 5 Cells / wells were seeded in 6-well plates and cultured overnight until approximately 60% confluence. The medium was then replaced with serum-free DMEM / F12. 100 μl of Opti-MEM medium was added to each of two EP tubes. 3 μl of Lipofectamine 3000 reagent was added to the first tube, and 10 μl of a randomized control or Acbd3-siRNA was added to the second tube. The two solutions were mixed and incubated at room temperature for 5 min. Then, 200 μl of the mixture was added to one well. When preparing the solution, the total volume of solution to be added to all wells should be calculated, and the mixture should be added to each well individually to avoid errors.

[0229] The sense strand of Acbd3-siRNA is: GAAGGAAGAAGAAGAGAAATT (SEQ ID NO: 15); the antisense strand of Acbd3-siRNA is: UUUCUCUUCUUCUUCCUUCUUTT (SEQ ID NO: 16).

[0230] 3. Grouping

[0231] Ctrl group: BV2 cells obtained from culture were cultured at 5 × 10⁻⁶. 5 Cells / wells were seeded in 6-well plates and cultured overnight until confluence reached approximately 60%.

[0232] LPS group: BV2 cells obtained from culture were cultured at 5×10⁶ 5 Cells / wells were seeded in 6-well plates and cultured overnight until confluence reached approximately 60%. Then, 1.0 μg / mL LPS was added for 24 h of treatment.

[0233] LPS+NC group: The disordered control was transfected into the cultured BV2 cells as described above. After 6 h, the medium was replaced with fresh DMEM / F12 medium and 1.0 μg / mL LPS was added for 24 h treatment.

[0234] LPS+siRNA group: Acbd3-siRNA was transfected into BV2 cells obtained by culture as described above. After 6 h, the medium was replaced with fresh DMEM / F12 medium and 1.0 μg / mL LPS was added for 24 h treatment.

[0235] The polarization status of BV2 cells in each group was verified by observing cell morphology and the expression levels of pro-inflammatory factors (TNF-α, iNOS, CCL2, IL-1β).

[0236] The results show:

[0237] 1) siRNA treatment reversed LPS-induced aberrant Acbd3 expression.

[0238] Previous experiments confirmed that different concentrations of Acbd3-siRNA could significantly reduce the expression level of Acbd3, especially treatment with 100 nM siRNA, which significantly reduced Acbd3 expression level, with an inhibition rate of approximately 64% (P < 0.0001). Figure 4 ), for use in subsequent experiments.

[0239] qRT-PCR analysis showed that LPS stimulation (LPS group) significantly upregulated the mRNA expression level of Acbd3 in BV2 cells, increasing it by approximately 7.3 times compared to the Ctrl group. Knockdown of Acbd3 (LPS+siRNA) significantly reduced both the mRNA and protein levels of Acbd3, effectively reversing the abnormally high expression induced by LPS. Figure 5 The above results indicate that changes in Acbd3 expression are closely related to the inflammatory activation state of microglia.

[0240] 2) Acbd3 regulates cell morphology

[0241] After stimulation with 1 μg / mL LPS for 24 h, BV2 cells exhibited typical M1-type pro-inflammatory polarization morphology, characterized by significantly enlarged cell bodies, shortened or absent cell processes, and an overall morphology shift from branching to amoeboid. However, transfection with Acbd3-siRNA significantly restored the LPS-induced morphological changes, with BV2 cells partially recovering from an activated state to a near-resting state. Figure 6 ).

[0242] 3) Acbd3 regulates the expression of inflammatory factors in microglia.

[0243] Following LPS stimulation, the transcriptional levels of M1 markers TNF-α, iNOS, CCL2, and IL-1β in BV2 cells were significantly increased (all... P <0.0001), further confirming that the cells had successfully polarized into a pro-inflammatory phenotype. However, knocking down Acbd3 expression effectively reversed the abnormally high expression of the aforementioned pro-inflammatory factors. Specifically, the mRNA levels of TNF-α, iNOS, CCL2, and IL-1β were inhibited by 76%, 68%, 72%, and 69%, respectively. Figure 7 These data confirm at the functional level that inhibiting Acbd3 can significantly suppress the core molecular features of microglia’s pro-inflammatory polarization towards the M1 type.

[0244] 4) Acbd3 regulates protein expression in microglia during M1 / M2 phenotypic transition.

[0245] Western blot was used to detect specific marker proteins of the M1 / M2 phenotype. The results showed that LPS stimulation significantly altered the polarization state of BV2 cells: the protein expression level of the pro-inflammatory marker CD86 was significantly upregulated, approximately 4.3 times that of the control group, while the protein level of the anti-inflammatory marker Arg-1 was significantly decreased, by approximately 91%, indicating a shift in cell polarization from the anti-inflammatory M2 phenotype to the pro-inflammatory M1 phenotype. Knockdown of Acbd3 expression significantly reversed these protein expression changes, manifested as a significant decrease in CD86 protein levels and a significant increase in Arg-1 expression. Figure 8The above results indicate at the protein level that Acbd3 expression level is closely related to the M1 / M2 polarization state of microglia.

[0246] 5) Acbd3 regulates the structural integrity of the Golgi apparatus in microglia. The ultrastructure of BV2 cells was observed using transmission electron microscopy. The steps included:

[0247] Cell fixation and embedding: Cells from each group were washed twice with PBS after treatment, then fixed with electron microscopy fixative at room temperature for 2 h. After discarding the fixative, 1% osmium tetroxide (OsO4, EMS, 19170) was added for 2 h at room temperature (to enhance membrane structure contrast). Gradient ethanol dehydration was performed (30%→50%→70%→90%→100%, 15 min each time), followed by replacement with acetone (100%) twice (15 min each time). Resin embedding and sectioning: Cells were transferred to epoxy resin embedding cassettes, embedded with embedding solution (EMS, Epon 812), and polymerized at 60℃ for 48 h. 70 nm thick sections were prepared using an ultramicrotome (Leica UC7) and placed on copper grids. Staining and observation: Sections were stained with uranium acetate (5%, 50% ethanol solution) for 10 min, rinsed with double-distilled water, and stained with lead citrate for 5 min, then rinsed with double-distilled water. After drying, the Golgi apparatus structure was observed under a transmission electron microscope (JEOL JEM-2100F, accelerating voltage 80 kV), and the number of stacked layers of flattened vesicles, the number of vesicles, and their distribution characteristics were recorded.

[0248] The results showed that LPS stimulation significantly altered the Golgi apparatus structure in BV2 cells, manifesting as fragmentation of the Golgi vesicles and disintegration of the flattened vesicle hierarchical structure, suggesting that inflammatory stimulation disrupted the structural integrity of the Golgi apparatus. In contrast, under Acbd3 knockdown intervention, the morphology and structure of the Golgi apparatus were significantly improved, the vesicles were relatively intact, and fragmentation was significantly reduced. Figure 9 The above results indicate that knocking down Acbd3 expression levels can improve the structural stability of the Golgi apparatus under inflammatory conditions.

[0249] Example 3: Knockdown of Acbd3 in an animal model

[0250] 1. Grouping

[0251] Mice were randomly divided into three groups: dbm mice served as the healthy control group; model mice were db / db mice that received an intravitreal injection of 1 μL of a randomized control (concentration of 2 μg / μL, db-scramble group); and the treatment group consisted of db / db mice that received an intravitreal injection of 1 μL of Acbd3-siRNA (concentration of 2 μg / μL, db-siRNA group). The intervention began at 12 weeks of age. A second booster injection of the same dose was administered at week 14. Treatment efficacy was assessed at week 16.

[0252] The sense strand sequence of the Acbd3-siRNA drug is: GAAGGAAGAAGAAGAGAAA (SEQ ID NO: 7); the antisense strand sequence is: UUUCUCUUCUUCUUCCUUCUU (SEQ ID NO: 8).

[0253] 2. Administration method

[0254] Mice were intraperitoneally anesthetized, followed by mydriasis with compound tropicamide, topical anesthesia with oxybuprofen hydrochloride, and application of ofloxacin clear gel to each eye to prevent corneal dryness. The operated eye was observed under a surgical microscope at 10-15x magnification to identify the corneal-scleral junction, which appears as a grayish-white ring. The injection point was selected 1-1.5 mm posterior to the temporal limbus, avoiding retinal vessels and the lens. A micro-incision (approximately 0.1 mm deep) was made in the sclera at the injection point using a 34G sterile needle to minimize tissue damage. A 34G blunt needle was connected to a syringe, and 1 μL of medication was drawn and slowly inserted along the scleral incision (at approximately 45° angle, avoiding perpendicular puncture of the lens) until the needle tip entered the vitreous cavity. The medication was then slowly injected (approximately 0.05-0.1 μL / s) to ensure even diffusion within the vitreous cavity. After injection, the needle was kept in the vitreous cavity for 1-2 minutes to prevent backflow, and then the needle was slowly withdrawn. Post-operatively, gently wipe the area around the eye with a sterile cotton swab to remove any excess medication, and apply levofloxacin eye ointment to cover the corneal surface to prevent bacterial infection. Return the mouse to its cage and place it on a heating pad, keeping the environment quiet to avoid stress, until it recovers.

[0255] This intervention program comprehensively covers the core pathological stages from the initiation of inflammation and neuronal damage to the disruption of the blood-retinal barrier.

[0256] The mRNA expression level of Acbd3 was detected by qRT-PCR. The results showed that, compared with the db-scramble group, the db-siRNA group significantly inhibited the expression of Acbd3 in mice. Figure 10 These results fully confirm the effectiveness of the selected intervention program and time window, laying a solid foundation for subsequent in-depth phenotypic analysis.

[0257] Example 4: Inhibition of Acbd3 can effectively alleviate inflammatory responses in the retina of diabetic mice.

[0258] Progressive damage to the NVU (neurovascular unit) is the core pathological feature of DR, and persistent excessive secretion of inflammatory factors is a key driver of this process. In this study, the mRNA expression levels of six key inflammatory factors (VCAM-1, ICAM-1, VEGF, IL-1β, IL-6, and TNF-α) in the retina of mice after intervention were detected by qRT-PCR.

[0259] The results showed that, compared with the healthy dbm control group, the transcriptional levels of all inflammatory factors in the retina of model mice (db / db mice injected with disordered control, db-scramble group) were significantly upregulated, indicating that diabetes induces the infiltration and amplification of systemic inflammatory responses into the retina. However, after intervention with Acbd3 siRNA (db-siRNA group), the mRNA expression of all the above inflammatory factors was significantly inhibited. Figure 11 This result confirms that inhibiting Acbd3 can effectively block the local inflammatory storm in the retina induced by diabetes, providing key molecular evidence for restoring the homeostatic balance between pro-inflammatory and anti-inflammatory factors, thereby alleviating progressive damage to NVU and treating diabetic retinopathy.

[0260] Example 5: Inhibition of Acbd3 can regulate apoptosis of diabetic retinal neurons

[0261] Neuronal apoptosis is a core pathological process leading to irreversible vision loss in diabetic retinopathy (DR). This study used TUNEL fluorescence staining to label and quantify apoptotic cells in mouse retinal sections. Results showed that compared to the healthy dbm control group, the number of TUNEL-positive cells in the retinas of model mice (db / db mice injected with a randomized control, db-scramble group) increased by 39-fold. These apoptotic cells were mainly densely distributed in the GCL and INL, clearly revealing the progressive apoptosis of retinal neurons caused by the course of diabetes. However, after Acbd3 siRNA intervention (db-siRNA group), the number of TUNEL-positive cells in the retinal tissue was significantly reduced, decreasing by approximately 85% compared to the untreated db-scramble group. Figure 12 This result directly confirms that inhibiting Acbd3 expression can effectively antagonize diabetes-induced retinal neuron apoptosis, which is of vital protective significance for maintaining the homeostasis of the neuronal population and thus delaying irreversible visual impairment caused by DR.

[0262] Example 6: Inhibition of Acbd3 can regulate the activation of Müller cells in the diabetic retina.

[0263] Müller cells, the main glial cells of the retina, are a key marker of neuroinflammatory responses in diabetic retinopathy (DR) due to abnormal activation (manifested as upregulated GFAP expression). They can also directly exacerbate neuronal damage by releasing toxic substances. This study analyzed the expression and distribution of GFAP in mouse retinal sections using immunofluorescence staining. Results showed that compared to the healthy dbm control group, the fluorescence intensity of GFAP in the retinas of model mice (db / db mice injected with a randomized control, db-scramble group) was dramatically increased, by up to 9-fold. Simultaneously, GFAP-positive cells were no longer confined to GCLs but extended extensively into INLs, indicating deep activation of Müller cells. After intervention with Acbd3 siRNA (db-siRNA group), the fluorescence intensity of GFAP in the retina was significantly inhibited, decreasing by approximately 80% compared to the untreated db-scramble group. Figure 13 This result confirms that knocking down Acbd3 can effectively inhibit diabetes-induced abnormal activation of Müller cells, providing direct cellular evidence for the role of this pathway in alleviating neuroinflammation and glial cytotoxicity in diabetic diabetics.

[0264] Example 7: Inhibition of Acbd3-mediated regulation of diabetic retinal microglia activation

[0265] Microglia and their derived macrophages (collectively referred to as F4 / 80) + Excessive activation of cells (F4 / 80) is another core factor driving the neuroinflammatory cascade in DR. This example uses immunofluorescence staining to detect F4 / 80 cells in the mouse retina. + The number, morphology, and distribution of cells were systematically analyzed.

[0266] The results showed that, compared with the healthy dbm control group, the F4 / 80 ratio in the retinas of the model mice (db / db mice injected with randomized control, db-scramble group) was significantly higher. + The cell number increased significantly by 6.6-fold. Morphologically, these cells transformed from elongated, branching structures at rest to amoeboid structures characteristic of activation, accompanied by marked process retraction. Spatially, they densely clustered in the inner and outer plexiform layers (OPL and IPL), suggesting a close association with the disruption of retinal synaptic connections. After Acbd3siRNA intervention (db-siRNA group), the F4 / 80 ratio in the retina decreased. + The number of cells was effectively controlled, decreasing by approximately 70% compared to the untreated db-scramble group. Figure 14This result confirms that inhibiting Acbd3 can effectively reverse the abnormal activation state of microglia / macrophages in the diabetic environment and significantly reduce their pathological infiltration in the retina, thus providing key evidence for elucidating the role of this pathway in blocking the neuroinflammatory process and thus treating diabetic retinopathy.

[0267] Example 8: Regulation of the blood-retinal barrier in diabetes by inhibiting Acbd3

[0268] Blood-retinal barrier disruption and the resulting vascular leakage are key pathological events in the progression of diabetic retinopathy to the proliferative phase. To assess the impact of Acbd3 on BRB (blood-retinal barrier) integrity, this study used AlexaFluor 647-labeled cadaverine as a tracer to quantitatively analyze retinal vascular permeability. Results showed that compared to the healthy dbm control group, vascular leakage in the retina of model mice (db / db mice injected with a randomized control, db-scramble group) increased by 110-fold, indicating severe damage to their BRB structure. After Acbd3 siRNA intervention (db-siRNA), vascular leakage was significantly inhibited, decreasing by approximately 80% compared to the untreated db-scramble group. Figure 15 This result confirms that inhibiting Acbd3 expression can effectively alleviate diabetes-induced BRB dysfunction and restore its structural integrity, thereby inhibiting the abnormal infiltration of inflammatory factors and other toxic substances into retinal tissues. This provides important functional evidence for elucidating the protective role of this pathway in delaying the pathological progression of late-stage diabetic retinal disease.

[0269] The preferred embodiments of this application have been described in detail above. However, this application is not limited to the specific details of the above embodiments. Within the scope of the technical concept of this application, various simple modifications can be made to the technical solution of this application, and these simple modifications all fall within the protection scope of this application.

[0270] It should also be noted that the various specific technical features described in the above embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, this application will not describe the various possible combinations separately.

Claims

1. Application of Acbd3-targeting interfering RNA in the preparation of drugs for the treatment of diabetic retinopathy; The interfering RNA mentioned is siRNA; The sense strand of the siRNA is SEQ ID NO: 7, and the antisense strand is SEQ ID NO: 8; or, The sense strand of the siRNA is SEQ ID NO: 15, and the antisense strand is SEQ ID NO:

16.

2. The application according to claim 1, characterized in that, The treatment of diabetic retinopathy involves administering the Acbd3-targeting siRNA into the intraocular space of subjects in need.

3. Application of Acbd3 as a biomarker in the preparation of products for diagnosing diabetic retinopathy.

4. The application according to claim 3, characterized in that, The Acbd3 mentioned above refers to Acbd3 in cells; The cells mentioned are Müller cells or microglia.

5. The application according to claim 3, characterized in that, The Acbd3 mentioned above refers to Acbd3 in the tissue; The tissue in question is the retina.

6. The application according to claim 3, characterized in that, The Acbd3 mentioned refers to Acbd3 in organs; The organ in question is the eye.

7. The use of a carrier in the preparation of a drug for treating diabetic retinopathy; The vector contains siRNA; The sense strand of the siRNA is SEQ ID NO: 7, and the antisense strand is SEQ ID NO: 8; or, The sense strand of the siRNA is SEQ ID NO: 15, and the antisense strand is SEQ ID NO:

16.

8. The application according to claim 7, characterized in that, The vector can be a viral vector or a non-viral vector.

Citation Information

Patent Citations

  • Application of ACBD3 inhibitor in preparation of medicine for treating lung cancer and gRNA for inhibiting ACBD3 gene expression

    CN119770658A