A strain of Trichoderma, biocontrol agents, bio-organic fertilizer, methods and applications for controlling plant diseases.

By using Trichoderma P11 biocontrol agent and bio-organic fertilizer, the problem of high incidence of root rot in Panax notoginseng was solved, the survival rate, root length and fresh weight of Panax notoginseng were improved, the antagonistic ability against a variety of pathogens was enhanced, the incidence of disease was reduced, and the saponin content was increased.

CN121674233BActive Publication Date: 2026-06-30YUNNAN AGRICULTURAL UNIVERSITY +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
YUNNAN AGRICULTURAL UNIVERSITY
Filing Date
2026-02-04
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

The incidence of root rot of Panax notoginseng is extremely high in the soil after harvest. There is limited research on Trichoderma in alleviating the obstacle of continuous cropping of Panax notoginseng, and there is a lack of effective biocontrol factors.

Method used

Using Trichoderma P11, biocontrol agents and bio-organic fertilizers are prepared, containing Trichoderma P11 spore suspension and livestock manure or crop straw as carriers. When applied to the soil, these agents enhance the expression of disease-resistant genes and enzyme activity in plants, affect the redox dynamic balance of pathogen cell membranes, and inhibit the growth of pathogens.

Benefits of technology

Trichoderma P11 significantly reduced the incidence of root rot in Panax notoginseng, increased the survival rate of seedlings, root length and fresh root weight, enhanced the plant's antagonistic ability against multiple pathogens, increased saponin content, and achieved biocontrol effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121674233B_ABST
    Figure CN121674233B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of biological agent technology, specifically relating to a strain of *Trichoderma*, a biocontrol agent, a bio-organic fertilizer, and methods and applications for controlling plant diseases. This invention provides a strain of *Trichoderma* P11, with accession number CCTCC NO: M 2024648. The *Trichoderma* P11 of this invention can enhance positively correlated disease resistance genes in plants. PnCAD , PnSN1 , PnDEFL1 The relative expression level of *Trichoderma* P11 was increased, enhancing the activity of disease resistance-related enzymes SOD, POD, and CAT. Furthermore, *Trichoderma* P11 could damage the cell membrane of pathogens, inhibiting their growth. *Trichoderma* P11 also exhibits good rhizosphere colonization ability. The results of the examples show that *Trichoderma* P11 of the present invention can reduce the incidence of root rot in Panax notoginseng fields and can also antagonize various pathogens such as *Pseudomonas aeruginosa*, *Pseudomonas oryzae*, *Geotrichum candida*, *Early Blight of Tomato*, *Phytophthora indicum*, *Phytophthora capsici*, and *Alternaria spiralis*.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological agents technology, specifically relating to a strain of Trichoderma hygroscopica, a biocontrol agent, a bio-organic fertilizer, and methods and applications for controlling plant diseases. Background Technology

[0002] Sanqi ( Panax notoginseng Panax notoginseng is a traditional and precious Chinese medicinal herb with high medicinal value. However, if Panax notoginseng is continuously planted in the soil after harvest, the incidence of root rot becomes extremely severe, even leading to total crop failure. Therefore, solving the problem of continuous cropping obstacles for Panax notoginseng has become an urgent task for the Panax notoginseng cultivation industry. The pathogens of Panax notoginseng root rot mainly include *Corylus spp.* (…). Cylindrocarpon destructans ), Phytophthora ( Phytophthora cactorum Rhizoctonia solani ( ) Rhizoctonia solani Fusarium oxysporum ( Fusarium oxysporum Fusarium solani () Fusarium solani )wait.

[0003] Trichoderma ( Trichoderna Trichoderma (spp.) is a fungus widely found in the environment and has been recognized in recent years as one of the most promising biocontrol agents, widely used for the control of plant diseases. Currently, Trichoderma harzianum is one of the more studied species. Trichoderma harzianum ), green Trichoderma ( Trichoderma viride ) and Corning Trichoderma ( Trichoderma koningii Trichoderma is mainly used on crops such as peppers, tomatoes, and cucumbers, but research on its ability to alleviate the obstacles of continuous cropping of Panax notoginseng is still limited. There are no reports on whether Trichoderma can control root rot. Summary of the Invention

[0004] In view of this, the purpose of this invention is to provide a method and application for controlling plant diseases using Trichoderma spp., as a biocontrol agent, a bio-organic fertilizer, and a fungicide, which can antagonize a variety of pathogens such as ginseng black spot fungus, rice blast fungus, Polygonatum anthracnose fungus, white ground mold, tomato early blight fungus, sclerotium spp., Phytophthora capsici, and Polyspora spiralis.

[0005] To address the aforementioned technical problems, the present invention proposes the following technical solution:

[0006] This invention provides a *Trichoderma* P11, the Latin name of which is... Trichoderma crassum P11, accession number CCTCC NO:M 2024648.

[0007] This invention provides a biocontrol agent comprising the *Trichoderma* P11 described in the above technical solution.

[0008] Preferably, the effective viable count of Trichoderma p11 in the biocontrol agent is ≥1×10⁻⁶.7 CFU / mL or ≥1×10 7 CFU / g.

[0009] Preferably, the biocontrol agent comprises a suspension of Trichoderma p11 spores.

[0010] This invention provides a bio-organic fertilizer, comprising a fungal component and a carrier, wherein the fungal component includes *Trichoderma* P11 as described in the above technical solution.

[0011] Preferably, the carrier includes livestock and poultry manure and / or crop straw.

[0012] This invention provides the application of *Trichoderma p11*, the biocontrol agent, or the bio-organic fertilizer described in the above-mentioned technical solutions in at least one of the following:

[0013] 1) Control of disease pathogens;

[0014] 2) Promote plant growth;

[0015] 3) Prevention and control of plant diseases;

[0016] 4) Increase the expression of genes related to resistance to root rot;

[0017] 5) Increase the activity of enzymes related to resistance to root rot;

[0018] 6) Increase the content of plant saponins.

[0019] Preferably, the pathogenic fungus includes one or more of the following: root rot pathogen, ginseng black spot pathogen, rice blast pathogen, Polygonatum anthracnose fungus, Geotrichum candida, tomato early blight pathogen, Cyclospora destructosa, Phytophthora capsici, and Polyspora spiralis.

[0020] Preferably, the plant includes Panax notoginseng;

[0021] The plant growth promotion includes increasing one or more of the following: root fresh weight, root length, and seedling survival rate.

[0022] The enhancement of the expression of genes related to resistance to root rot includes increasing... PnPRPL1, PnPR1, PnDEFL1 , PnCAD and PnPnSN1 The expression of one or more genes in the root rot resistance-related enzymes includes increasing the activity of one or more of SOD, POD and CAT.

[0023] The saponins include one or more of saponins Rg1, Rb1, and R1.

[0024] This invention provides a method for preventing and controlling plant diseases, characterized by comprising: applying the Trichoderma p11 described in the above technical solution, or the biocontrol agent described in the above technical solution, or the bio-organic fertilizer described in the above technical solution to the plants.

[0025] The beneficial effects of this invention: This invention provides a strain of *Trichoderma* P11, with the preservation number CCTCC NO: M2024648. *Trichoderma* P11 of this invention can enhance the levels of disease resistance-related genes in plants. PnCAD , PnSN 1, PnDEFL The relative expression level of 1 increases the activity of disease resistance-related enzymes SOD, POD, and CAT, which may help plants resist pathogen infection by inducing systemic resistance. Furthermore, *Trichoderma* P11 can affect the redox dynamic balance of pathogen cell membranes, causing an increase in MDA and H2O2 content, thereby damaging the pathogen cell membrane and inhibiting the growth of pathogens. In addition, *Trichoderma* P11 has good rhizosphere colonization ability, effectively protecting roots from pathogen infection, which is crucial for *Trichoderma* to achieve biocontrol mechanisms. The results of the examples show that *Trichoderma* P11 of the present invention can antagonize various pathogens, including *Phytophthora indicum* (the pathogen causing black spot of ginseng), *Pseudomonas aeruginosa* (the pathogen causing anthracnose of *Polygonum sibiricum*), *Geotrichum candida* and *Alternaria spiralis* (the pathogen causing tuber rot of *Gastrodia elata*), *Early blight of tomato*, *Cyclocarya paliurus* (the pathogen causing rust rot of *Panax notoginseng*), and *Phytophthora capsici*; and reduces the incidence of root rot in *Panax notoginseng*, demonstrating biocontrol effects. Attached Figure Description

[0026] Figure 1 This study aims to identify the morphology and molecular structure of *Trichoderma* P11. A through B represent the morphological and partial functional identification of *Trichoderma*. In A, a through e represent the morphology of *Trichoderma* on PDA, CMA, SNA, OA, and CzapaK media, respectively; f through k represent Ashby nitrogen-free solid medium, phosphate-solubilizing medium, silicate hydrochloride medium, CAS medium, cellulase medium, and laccase medium, respectively; I represents IAA detection: CK1: IAA standard solution + Salkowski reagent, CK2: Salkowski reagent, CK3: non-IAA-producing *Trichoderma* + Salkowski reagent, P11: P11 + Salkowski reagent; B represents the morphology of *Trichoderma* hyphae and spores observed under an oil immersion microscope; C represents the constructed phylogenetic tree of *Trichoderma* P11.

[0027] Figure 2 The graph shows the effects of Trichoderma p11 on the incidence, quality, and resistance of root rot. A shows the effects of P11 on the incidence of root rot in continuously cropped soil after sowing (a) and transplanting (b-c); B shows the effects of adding P11 to continuously cropped soil on the survival rate of sown Panax notoginseng and the incidence of root rot in one-year-old Panax notoginseng, with pathogen present (…). F.solaniThe effect of soil P11 addition on the incidence of root rot in one-year-old Panax notoginseng; C represents the effect of P11 on the incidence of three root rot pathogens ( P. cucumerina , F. oxysporum , F.solani The effects of P11 on the incidence of root rot in Panax notoginseng are shown in Figures 1-3; D shows the effects of P11 and conventional inoculants Trichoderma harzianum (Th), Trichoderma longifolium (Tl), and Bacillus subtilis (Bs) on the incidence of root rot in Panax notoginseng; E shows the effects of microbial fertilizers made from P11 with animal-derived organic fertilizer (AOF) and plant-derived organic fertilizer (POF) on the incidence of root rot and fresh root weight in Panax notoginseng; F-G show the effects of P11 on the growth radius of eight common pathogens; H shows the effects of P11 on the content of main saponins, disease resistance-related enzyme activity, and genes in Panax notoginseng; Note: represent P <0.05, represent P <0.01, represent P <0.001;

[0028] Figure 3 The figure shows the indoor antagonistic evaluation of *Trichoderma* P11 and its effects on the fresh weight, root length, and seedling survival rate of *Panax notoginseng* roots. In this figure, A represents the effect of *Trichoderma* P11 on... F. oxysporum , F.solani and P. cucumerina A) Indoor antagonistic evaluation diagram; B) Effect of P11 addition to soil in continuous cropping on plant height and root length of Panax notoginseng after sowing; C) Inoculation F. solani The effects of soil P11 addition on the fresh weight and root length of Panax notoginseng roots were analyzed. D showed the effect of soil P11 addition on the survival rate, plant height, and root length of transplanted Panax notoginseng seedlings after continuous cropping. E showed the effect of P11 on the survival rate of Panax notoginseng seedlings from animal-derived organic fertilizer cow manure (AOF) and plant-derived organic fertilizer marigold straw (POF). F showed the effect of P11 on the survival rate of three root rot pathogens (…). P. cucumerina , F. oxysporum , F.solani The graph shows the impact of P11 on the incidence of root rot caused by various treatments. One pot of Panax notoginseng roots from each treatment was randomly selected and photographed. G represents the effect of P11 on the fresh weight of Panax notoginseng roots compared to other commercially available strains such as *Trichoderma harzianum* (Th), *Trichoderma longifolia* (Tl), and *Bacillus subtilis* (Bs). Note: represent P <0.05, represent P <0.01, represent P <0.001, n≥3;

[0029] Figure 4Microscopic images showing the colonization of Trichoderma p11 in the rhizosphere of Panax notoginseng on days 1, 5, and 7 after its addition to the soil; Brightfield, Fluorescence, and Merge images are brightfield, fluorescence reaction, and composite images, respectively.

[0030] Figure 5 This diagram illustrates the effects of P11 on the redox balance and cell membrane of *Trichoderma harzianum* pathogens. Figure A shows the effects of P11 on the enzyme activities of POD, SOD, and CAT, as well as MDA and H2O2, of the three root rot pathogens. Figure B shows the effect of P11 on the cell membrane integrity of the three root rot pathogens as assessed by the P1 staining method. Note: represent P <0.05, represent P <0.01, represent P <0.001 (one-way ANOVA, Tukey test) n ≥3; where Brightfield and Fluorescence are brightfield and fluorescence reactions, respectively.

[0031] Biological Preservation Instructions

[0032] Thick-skinned Trichoderma P11, Latin name Trichoderma crassum P11 was deposited on April 9, 2024, at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO:M 2024648, located at Wuhan University, Wuhan, China. Detailed Implementation

[0033] This invention provides a strain of Trichoderma p11, with accession number CCTCC NO:M 2024648.

[0034] The *Trichoderma* P11 strain of this invention was screened using rhizosphere soil from the *Gastrodia elata* rhizome in the *Panax notoginseng*-*Gastrodia elata* rotation experimental field in Laotanshan, Lancang County, Pu'er City, Yunnan Province. *Trichoderma* P11 colonies grow rapidly on PDA and CMA media, exhibiting a fluffy morphology, white color, and gradually increasing hyphae density towards the outer edge. *Trichoderma* P11 may possess nitrogen-fixing, phosphorus- and potassium-solubilizing functions, produce hydroxyl-type siderophores, have a certain ability to degrade cellulose, exhibit strong laccase activity, and produce IAA. The spores of *Trichoderma* P11 are oval, with smooth outer walls, approximately 5 μm in length and 3 μm in width. The hyphae are clearly septate, and the sporangia are spherical, with the hyphae protruding in a spherical shape to form sporangia.

[0035] The Trichoderma P11 of this invention has a growth temperature range of 25~30℃. Trichoderma P11 has good rhizosphere colonization ability, and this stable rhizosphere colonization ability can effectively protect the root system from pathogen infection, which is an important biocontrol mechanism of Trichoderma.

[0036] A phylogenetic tree was constructed based on the ITS, RPB2, and TEF1 sequences, and strain P11 was identified as Trichoderma, i.e., Trichoderma P11.

[0037] ITS sequence: (SEQ ID NO. 15).

[0038]

[0039] TEF1 sequence: (SEQ ID NO.17).

[0040] This invention provides a biocontrol agent comprising the *Trichoderma* P11 described in the above technical solution.

[0041] As an optional implementation, the effective viable count of *Trichoderma hygroscopicum* P11 in the biocontrol agent of the present invention is preferably ≥1×10⁻⁶. 7 CFU / mL, more preferably 1×10⁻⁶ 7 CFU / mL ~ 1×10 8 CFU / mL; the effective viable count of *Trichoderma harzianum* P11 in the biocontrol agent of the present invention is preferably ≥1×10⁻⁶. 7 CFU / g, more preferably 1×10 7 CFU / g ~ 1×10 8 CFU / g.

[0042] As an optional implementation, the biocontrol agent of the present invention includes a suspension of Trichoderma p11 spores.

[0043] This invention involves inoculating *Trichoderma* P11 onto a solid culture medium for activation culture to obtain P11 mycelial cakes. The preferred inoculation method is streak inoculation. This invention does not impose specific limitations on the streak inoculation parameters; conventional methods are acceptable. The preferred activation culture temperature is 25-30°C, more preferably 26-29°C, and even more preferably 28°C. In specific embodiments of this invention, the activation culture temperature is preferably 25, 26, 27, 28, 29, or 30°C. The preferred activation culture time is 7-15 days, more preferably 15 days. In specific embodiments of this invention, the activation culture time is preferably 15 days. The solid culture medium preferably includes PDA solid culture medium.

[0044] As an optional implementation method, the present invention inoculates the obtained Trichoderma p11 mycelial cake onto PDA solid culture medium to obtain spores; the spores are then resuspended to obtain a spore suspension. The solution used for resuspension in the present invention is preferably sterile water.

[0045] As an optional implementation, the viable count of the spore suspension of the present invention is preferably ≥1×10⁻⁶. 7 CFU / mL, more preferably 1×10⁻⁶ 7 ~1×10 8 CFU / mL.

[0046] This invention provides a bio-organic fertilizer, comprising a fungal component and a carrier, wherein the fungal component includes *Trichoderma* P11 as described in the above technical solution.

[0047] As an optional implementation, the carrier includes livestock and poultry manure and / or crop straw. As an optional implementation, the livestock and poultry manure includes well-rotted cow manure, and the crop straw includes well-rotted marigold straw.

[0048] As an optional implementation, the preparation method of the bio-organic fertilizer of the present invention includes: sterilizing the carrier, mixing it with *Trichoderma hygroscopicum* P11, and fermenting it to obtain the bio-organic fertilizer. As an optional implementation, the sterilization temperature is 121℃, the pressure is 0.1 MPa, and the time is 25 min. As an optional implementation, the *Trichoderma hygroscopicum* P11 is applied in the form of a spore suspension; the volume ratio of the carrier to the spore suspension is 5:1; the fermentation time is 4-6 days, or 5 days. As an optional implementation, the compost is turned once a day during the fermentation process. As an optional implementation, the bio-organic fertilizer is applied at a rate of 133 kg / mu (approximately 15.5 kg / acre) and mixed thoroughly. The application time is before planting *Panax notoginseng*, and the application frequency is once. The application method involves adding the organic fertilizer to the continuously cropped soil according to the specified ratio and then mixing it thoroughly. The bio-organic fertilizer of this invention promotes plant growth and reduces the incidence of root rot. Among them, the Trichoderma P11 livestock and poultry manure organic fertilizer has a stronger ability to reduce the incidence of root rot than the Trichoderma P11 crop straw organic fertilizer. However, the Trichoderma P11 crop straw organic fertilizer can better increase the fresh weight of Panax notoginseng roots.

[0049] This invention provides the application of the above-described Trichoderma P11, the above-described biocontrol agent, or the above-described bio-organic fertilizer in the control of pathogenic fungi and diseases.

[0050] As an optional implementation, the pathogens of diseases described in this invention include one or more of the following: *Panax notoginseng root rot pathogen*, *Ginseng black spot pathogen*, *Oryza sativa blast pathogen*, *Polygonatum sibiricum* anthracnose pathogen, *Gastrodia elata* and *Alternaria spiralis* pathogens causing tuber rot in *Gastrodia elata*, *Early blight pathogen* of tomato, *Cyclocarya paliurus* pathogen causing rust rot in *Panax notoginseng*, and *Phytophthora capsici*. The root rot pathogens described in this invention include one or more of the following: *Fusarium oxysporum*, *Fusarium solanum*, and *Sphaerocera cucumberis*.

[0051] Plate experiments have demonstrated that *Trichoderma* P11 exhibits antagonistic and inhibitory effects against a total of 11 pathogens, including *Fusarium oxysporum*, *Fusarium solani*, *Scutellaria baicalensis*, *Gastrodia elata*, *Gastrodia elata*, *Gastrodia elata*, *Gastrodia elata*, *Gastrodia elata*, *Gastrodia elata*, *Gastrodia elata*, *Gastrodia elata*, and *Gastrodia elata*.

[0052] This invention provides the application of the *Trichoderma* P11 described in the above-mentioned technical solution, or the biocontrol agent described in the above-mentioned technical solution, or the bio-organic fertilizer described in the above-mentioned technical solution, in improving the expression of genes related to resistance to root rot.

[0053] This invention provides the application of the above-described Trichoderma P11, the above-described biocontrol agent, or the above-described bio-organic fertilizer in improving the activity of enzymes related to resistance to root rot.

[0054] Trichoderma P11 can affect the redox balance of pathogen cells, leading to increased MDA and H2O2 levels, thereby damaging the pathogen's cell membrane and inhibiting its growth. Trichoderma P11 can also increase the levels of disease resistance-related genes in Panax notoginseng root tissue. PnPRPL1, PnPR1, PnDEFL1, PnCAD and PnSN1 The relative expression level of *Trichoderma* P11 increases the activity of disease resistance-related enzymes SOD, POD, and CAT, thus *Trichoderma* P11 may help plants resist pathogen infection by inducing systemic resistance in plants.

[0055] This invention provides the application of the above-described Trichoderma P11, the above-described biocontrol agent, or the above-described bio-organic fertilizer in the prevention and control of plant diseases.

[0056] As an optional implementation, the pathogens of the diseases described in this invention preferably include one or more of the following: root rot pathogens, ginseng black spot pathogens, rice blast pathogens, Polygonatum anthracnose pathogens, Gastrodia elata tuber rot pathogens, Geotrichum candida and Polyspora spiralis, tomato early blight pathogens, Panax notoginseng rust rot pathogens, Phytophthora capsici, and Phytophthora capsici.

[0057] As an optional implementation, the root rot pathogen includes one or more of Fusarium oxysporum, Fusarium solanum, and Cucumber spores.

[0058] The diseases caused by the root rot pathogens described in this invention include root rot; the ginseng black spot pathogen causes Panax notoginseng black spot disease; the rice blast pathogen causes rice blast disease; the Polygonatum anthracnose pathogen causes Polygonatum anthracnose disease; the white ground mold and spiral polyspora cause Gastrodia tuber rot; the tomato early blight pathogen causes tomato early blight; the Panax notoginseng rust rot pathogen, Cyclospora destructosa, causes Panax notoginseng rust rot; and the pepper blight pathogen causes pepper blight.

[0059] As an optional implementation, the plant described in this invention includes Panax notoginseng. In a specific embodiment of this invention, plate experiments and pot experiments were conducted using *Fusarium oxysporum*, *Fusarium solanum*, and *Sphaerocera cucumberis* as examples of the pathogens causing root rot in Panax notoginseng. The *Trichoderma* P11 of this invention can inhibit the growth of the pathogens causing root rot in Panax notoginseng and reduce the incidence of root rot in potted Panax notoginseng.

[0060] This invention provides the application of the above-described Trichoderma P11, the above-described biocontrol agent, or the above-described bio-organic fertilizer in promoting plant growth.

[0061] As an optional implementation, the plant described in this invention includes Panax notoginseng. The plant growth-promoting effects of this invention include increasing one or more of the following: root fresh weight, root length, and seedling survival rate. The Trichoderma p11 of this invention can improve the seedling survival rate, root length, and root fresh weight of Panax notoginseng.

[0062] This invention provides the application of the above-described Trichoderma P11, the above-described biocontrol agent, or the above-described bio-organic fertilizer in increasing the content of plant saponins.

[0063] The saponins described in this invention include one or more of saponins Rg1, R1, and Rb1. The *Trichoderma* P11 of this invention can increase the content of saponins Rg1, R1, and Rb1.

[0064] The preferred method of application described in this invention includes: applying the *Trichoderma p11* or the biocontrol agent described in the above-described technical solution to plants. The preparation method of the biocontrol agent has been discussed above and will not be repeated here.

[0065] This invention provides a method for preventing and controlling plant diseases, which involves applying the above-described technical solution, or the above-described Trichoderma P11, or the above-described biocontrol agent, or the above-described bio-organic fertilizer to the plants.

[0066] As an optional embodiment, the plant described in this invention includes Panax notoginseng. As an optional embodiment, the biocontrol agent of this invention can be applied in the field or in pots. The specific application amounts in the field and in pots are as follows: When used in the field, the application method preferably includes root irrigation or application to the soil; the preferred application amount of the biocontrol agent is 10... 6 CFU / g ~10 7 CFU / g, more preferably 10 7 CFU / g; When used in potted plants, the preferred application amount of the biocontrol agent of this invention is 45-55 mL per plant, more preferably 50 mL. The biocontrol agent of this invention is applied before planting Panax notoginseng, and the application is performed once.

[0067] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0068] To assess the statistical significance of differences between groups, one-way ANOVA combined with Tukey's multiple comparisons was used to test differences between groups, and t-tests were used to verify the significance of specific data group differences. All statistical analyses were performed using IBM SPSS Statistics version 18 (IBM Corp., Armonk, NY, USA), with the significance level set at [value missing]. P <0.05. Data visualization was performed using GraphPad Prism version 10.4 (GraphPad Software Inc., La Jolla, CA, USA).

[0069] The pathogens tested in the following examples are: strains of pathogens preserved in the Key Laboratory of Agricultural Biodiversity and Pest Control of the Ministry of Education, namely, ginseng black spot fungus, rice blast fungus, Polygonatum anthracnose fungus, Gastrodia elata tuber rot pathogens Geotrichum and Polyspora spiralis, tomato early blight fungus, Panax notoginseng rust rot pathogen Pyrodactylus, and Phytophthora capsici.

[0070] Test plant: one-year-old Panax notoginseng seedlings, sourced from the Agricultural University Panax notoginseng planting base at Daheqiao, Xundian (25°31' 8.0" N, 103°16' 41.6" E, H1980m).

[0071] Main equipment: Refrigerated high-speed centrifuge (HITACHI, CR22GⅢ); autoclave (Sanyo, Japan, MLS-3780); clean bench (SW-CJ-2F); analytical balance (BSA124S-CW).

[0072] Test soils: Natural soils that have never been planted with crops and soils that have been continuously planted with Panax notoginseng for 2 years were selected for subsequent treatment.

[0073] Example 1

[0074] 1. Isolation and Identification of Trichoderma

[0075] Fungi in the soil were isolated using the dilution plate method. Soil samples were taken from the rhizosphere soil of *Gastrodia elata* from the *Panax notoginseng*-*Gastrodia elata* rotation experimental field in Laotanshan, Lancang County, Pu'er City, Yunnan Province. 10 g of soil sample was added to 90 mL of sterile water, shaken at 120 rpm for 60 min, and then diluted sequentially to 10⁻⁶. -4 and 10 -5 The sample was evenly spread onto PDA medium and cultured in a constant temperature and light incubator at 28°C. A strain was isolated and named P11.

[0076] (1) Morphological observation and functional qualitative analysis of strain P11

[0077] Morphological media: The P11 mycelial discs were inoculated on different media such as potato dextrose agar (PDA), corn flour agar (CMA), synthetic nutrient medium (SNA), oat flake agar (OA), and Czapek-Dox medium for morphological observation.

[0078] Functional qualitative culture media and reagents: Strain P11 was inoculated into Ashby nitrogen-free solid medium, silicate hydrochloride medium, phosphorus solubilizing medium, CAS medium, laccase medium, cellulase medium, and Salkowski reagent for functional qualitative evaluation.

[0079] See results Figure 1From A, we can see that strain P11 in PDA medium ( Figure 1 (a) of A and CMA medium ( Figure 1 On SNA medium (b), the colonies grow rapidly, are fluffy in shape, white in color, and the hyphae gradually proliferate outwards, which is suitable for the growth of strain P11; strain P11 grows on SNA medium (b). Figure 1 On medium A (c), the colony morphology is fluffy, but the hyphae are sparse; strain P11 on OA medium ( Figure 1 No colonies grew on medium A (d), indicating it was unsuitable for growth; strain P11 grew on CzapaK medium (d). Figure 1 On (e) of A, the colonies are white filamentous with thin and weak hyphae; strain P11 can be cultured on Ashby nitrogen-free solid medium ( Figure 1 f of A), phosphorus solubilizing medium ( Figure 1 (g of A), silicate hydrochloric acid culture medium ( Figure 1 The growth of strain P11 on CAS medium (h) suggests that strain P11 may possess nitrogen fixation, phosphorus solubilization, and potassium solubilization functions. Strain P11 was inoculated onto CAS medium (h). Figure 1 On strain A (i), the color change of the culture medium from blue to orange indicates that it can produce hydroxyl-type siderophores; strain P11 also has a certain ability to degrade cellulose ( Figure 1 (j) of A) has strong laccase activity ( Figure 1 k of A in the middle.

[0080] I represents four specific processes for IAA detection:

[0081] Among them, CK1 is IAA standard solution + Salkowski reagent; CK2 is Salkowski reagent; CK3 is non-IAA-producing Trichoderma + Salkowski reagent; P11 is Salkowski reagent added to the filtrate of strain P11.

[0082] It can be seen that after adding Salkowski's reagent to the filtrate of strain P11, the color of the filtrate turned red, indicating that IAA was produced during its growth. Figure 1 (I of A). Spores of strain P11 are oval, with a smooth outer wall, approximately 5 μm in length and 3 μm in width. Figure 1 In B (a), the hyphae have obvious septa ( Figure 1 (b of B), sporangia spherical ( Figure 1 (c of B), the hyphae protrude into a spherical shape to form sporangia ( Figure 1 (d of B in the middle).

[0083] (2) Identification

[0084] Strain P11 was inoculated onto PDA medium plates and cultured in a 28°C constant temperature and light incubator. After colonies grew, single colonies were picked for pure culture, purified, and then sequenced by Beijing Qingke Biotechnology Co., Ltd. using primers ITS, tef1, and rpb2.

[0085] After obtaining the ITS, tef1, and rpb2 sequences, new DNA sequences for each gene generated from forward and reverse primers were assembled using BioEdit v.7.2.5 to obtain consistent sequences.

[0086] By splicing 12 strains downloaded from NCBI with three gene fragments (ITS:565, RPB2:1073, TEF1:1279) of strain P11 in this invention, a multigene phylogenetic tree of ML and BI was constructed. T.viride (CBS 119325 T) and T.viride (TRS575) is an outgroup. T.viride As outgroup taxonomic units, species in this study are shown in red, and protype strains are indicated by T. The final likelihood value of the maximum likelihood method is -8374.879103. The optimal models for Bayesian analysis were the K2P+I model for ITS, the TNe+G4 model for RPB2, and the HDY+F+G4 model for TEF1. The generated phylogenetic tree is shown below. Figure 1 From C, we can see that P11 is... Trichoderma virens In the composite group, and T.crassum (DAOM 164916, SZMC 243000, BMCC LU555) aggregated at 61% ML and 0.9 BI. Therefore, it is inferred that P11 is *Trichoderma* (…). T.crassum ),See Figure 1 C.

[0087] 2. Assessment of the biocontrol potential of Trichoderma p11

[0088] (1) Assessment of the antagonistic ability of Trichoderma p11

[0089] 1) Flat plate confrontation method: The flat plate confrontation method is used to evaluate antagonistic ability.

[0090] Treatment 1 consisted of Trichoderma p11 and Fusarium oxysporum ( Fusarium oxysporum abbreviation F. oxysporum The flat plate confrontation experiment;

[0091] Treatment 2 consisted of Trichoderma p11 and Fusarium solani ( Fusarium solani, Abbreviation F.solani The flat plate confrontation experiment;

[0092] Treatment 3 consisted of Trichoderma p11 and Cucurbita spp. ( Plectosphaerella cucumerina, Abbreviation P. cucumerinaThe flat plate confrontation experiment;

[0093] Four PDA plates were used for each treatment and incubated at 25°C for four days. The inhibition rate and relative inhibition effect were then calculated. Plate confrontation experiments showed that *Trichoderma harzianum* P11 inhibited... F. oxysporum , F.solani and P. cucumerina The average inhibition rates were 52%, 56%, and 93%, respectively. Figure 3 (Left side of A in the middle)

[0094] The antibacterial rate is calculated using formula (1):

[0095] Inhibition rate (%) = [(control colony radius - confrontation culture colony radius) / control colony radius] × 100%. (1).

[0096] 2) Plate inverting method: Prepare PDA plates. Inoculate one plate with Trichoderma p11 mycelium. At the same time, take the mycelium of the tested pathogen strain activated for 3 days and inoculate it in the center of another PDA plate. Invert the plates and seal them. Use the uninoculated Trichoderma as a control. Calculate the inhibition rate using formula (1).

[0097] 3) Cellophane culture test (non-volatile metabolites): Trichoderma mycelium was inoculated onto PDA medium covered with sterile cellophane, and a control was prepared by inoculating a blank PDA agar block. After 7 days, the cellophane was removed, and pathogen mycelium was inoculated again. The inhibition rate was calculated using formula (1).

[0098] The average inhibition rates of non-volatile metabolites collected on PDAs after isolating the hyphae with cellophane were 71%, 61%, and 61%, respectively, against the three pathogens mentioned above. Figure 3 (See the middle figure in section A). The results from the plate inverted method showed that the average inhibition rates of volatile metabolites were low, at 19%, 9%, and 36%, respectively. Figure 3 (Image on the right side of A in the middle).

[0099] In summary, the non-volatile metabolites of Trichoderma p11 have the following effects: F. oxysporum and F.solani The inhibition rate was higher than that of volatile metabolites, but the P11 hyphae in plate confrontation had a higher inhibition rate than volatile metabolites. P. cucumerina The inhibition rate was highest, followed by its non-volatile metabolites. Therefore, it is speculated that P11 may mainly inhibit bacteria through the antibacterial effects of its non-volatile metabolites.

[0100] (2) Evaluation of Trichoderma biocontrol potential in greenhouses:

[0101] 1) Seeding verification: Collect Trichoderma p11 spores grown on PDA medium and prepare 10 8 CFU / ml spore suspension.

[0102] The biocontrol effect was evaluated using a tissue culture bottle seeding experiment, as detailed below:

[0103] Treatment Group 1 (P11): 50g of continuously cropped soil was dispensed into 200ml sterile culture bottles. The *Trichoderma* P11 spore suspension was diluted to 10⁻⁶. 8 CFU / ml was inoculated into tissue culture flasks, 20ml per flask.

[0104] Control group 1 (CK): Same as treatment group 1, except that the same volume of sterile water was added.

[0105] Six bottles were inoculated in each of the treatment group 1 and the control group 1, with 10 Panax notoginseng seeds sown in each bottle. After three months of cultivation in a glass greenhouse, the germination rate, root fresh weight, plant height, and root length of the plants were measured and recorded.

[0106] After treating continuously cropped soil with Trichoderma P11, Panax notoginseng seeds were sown for biological function evaluation. The results showed that Trichoderma P11 could alleviate continuous cropping obstacles and increase the seedling survival rate by 233%. Figure 2 a in A; Figure 2 (Left side of image B) Plant height increased by 28% ( Figure 3 (Left side of diagram B) Root length increased by 120% ( Figure 3 (See right side of B in the image).

[0107] Treatment group 2 (P11+) F.solani Treatment group 1 was the same as the previous group, except that the continuously cropped soil was replaced with soil containing the pathogen. The method for preparing the pathogen-containing soil was as follows: the continuously cropped soil was sterilized at high temperature, and then *Fusarium solani* (a type of fungus) was added. F.solani ) Spore suspension, to 10 Fusarium spores in the soil. 5 CFU / g.

[0108] Control group 2 ( F.solani (Same as treatment group 2, the only difference being the addition of the same volume of sterilized water).

[0109] Six bottles were inoculated in each of treatment group 2 and control group 2, with 10 Panax notoginseng seeds sown in each bottle. After three months of cultivation in a glass greenhouse, the germination rate, fresh root weight, and root length of the plants were measured and recorded.

[0110] See results Figure 2 China B and Figure 3 From C, it can be seen that both treatment group 2 and control group 2 had Fusarium solani added to the sterilized soil. F.solani After obtaining soil contaminated with pathogens and re-sowing Panax notoginseng seeds, P11 reduced the incidence of root rot in Panax notoginseng by 49%. Figure 2 (See right side of diagram B), increasing fresh root weight by 37% ( Figure 3 (Left side of C diagram) Root length increased by 29% ( Figure 3 (Right side of C in the diagram).

[0111] 2) Seedling Transplanting Verification: One-year-old Panax notoginseng seedlings were selected for potted root irrigation experiments. Trichoderma P11 was inoculated onto PDA solid medium plates, incubated upside down at 28℃ for 15 days, and spores were scraped off to prepare a spore suspension. The spore concentration was counted under a microscope. After root irrigation, the concentration of Trichoderma P11 in the continuously cropped soil was 10. 7 CFU / g; three pathogens ( F. oxysporum, F. solani, P. cucumerina The final soil concentration after root irrigation with the suspension was 10. 5 CFU / g, each treatment was irrigated with only one pathogen. The pathogen was applied first, followed by biocontrol agent P11. A control group was used, inoculated with sterile water but without biocontrol agent P11. Six pots were inoculated for each treatment, each containing 10 Panax notoginseng seedlings. One-year-old Panax notoginseng seedlings were transplanted after inoculation. Three months later, the survival rate of Panax notoginseng seedlings, the incidence of root rot, root fresh weight, root length, and plant height were recorded.

[0112] It can be seen that transplanting one-year-old Panax notoginseng seedlings into continuously cropped soil for further verification still reduces the incidence of root rot (by 40%). Figure 2 The middle image of B and Figure 2 The survival rate of seedlings in A increased by 199% (c). Figure 3 (D in the left image), root length increased by 71% ( Figure 3 (See right side of D), plant height increased by 39% (see...) Figure 3 (The middle image of D).

[0113] 3) Transplant the one-year-old Panax notoginseng seedlings into three types of sterilized soil containing pathogens, and treat them as follows:

[0114] Treatment group A (P11+) F. oxysporum The method for preparing pathogen-infected soil is as follows: After high-temperature sterilization of continuously cropped soil, add a suspension of Fusarium oxysporum spores until the concentration of Fusarium oxysporum spores in the soil is 10. 5 CFU / g.

[0115] One-year-old Panax notoginseng seedlings were selected for a potted root drenching experiment. Trichoderma P11 was inoculated onto PDA solid medium plates and cultured upside down at 28℃ for 15 days. Spores were scraped off and a spore suspension was prepared. The spore concentration was counted under a microscope. After root drenching, the concentration of Trichoderma P11 in the pathogen-infected soil was 10. 7 CFU / g;

[0116] Pathogens ( F. oxysporum The final soil concentration after root irrigation with the suspension was 10. 5CFU / g. The pathogen was first applied followed by biocontrol agent P11. A control group was used, inoculated with sterile water but without biocontrol agent P11. Six pots were inoculated for each treatment, each containing 10 Panax notoginseng seedlings. One-year-old Panax notoginseng seedlings were transplanted after pathogen inoculation. Three months later, the survival rate of Panax notoginseng seedlings, the incidence of root rot, root fresh weight, and root length were recorded.

[0117] Treatment group B (P11+) P. cucumerina ): Same as treatment group A, the only difference being the addition of Cucumber Flocculation Microorganism to the pathogen-infected soil. P. cucumerina The spore suspension was diluted to 10 spores of *Cyclocarya cucumeroides* in the soil. 5 CFU / g. The control group was inoculated with sterile water but not with biocontrol bacteria P11.

[0118] Treatment group C (P11+) F.solani ): Same as treatment group A, the only difference being the addition of Fusarium solani to the diseased soil. F.solani ) Spore suspension, into the soil F.solani 10 spores 5 CFU / g. The control group was inoculated with sterile water but not with biocontrol bacteria P11.

[0119] It can be seen that the P11 treatment can still reduce P. cucumerina , F. oxysporum , F.solani The incidence rates of root rot caused by these diseases decreased by 63%, 72%, and 69%, respectively. Figure 2 C in the middle Figure 3 (F). Experiments were conducted using two common Panax notoginseng cultivation methods, sowing and transplanting, under two soil conditions: continuous cropping soil and disease-infected soil. All results indicate that P11 can alleviate the obstacles of continuous cropping of Panax notoginseng and control root rot.

[0120] Meanwhile, commonly available microbial inoculants, including *Trichoderma harzianum* from Huaneng brand, *Trichoderma longibranchii* from Haomeite brand, and *Bacillus subtilis* from Huikefeng brand, were selected as controls. P11 was compared with these commonly available microbial inoculants, and the inoculation results in a 10% yield when applied to soil continuously cropped with Panax notoginseng. 7 CFU / g, and after 3 months of statistical analysis of agronomic traits, it was found that the incidence of root rot decreased by 46% after P11 treatment of continuously cropped soil. However, there was no statistically significant difference compared with commonly available products such as *Trichoderma harzianum* (Th), *Trichoderma longifolia* (TL), and *Bacillus subtilis* (Bs). Figure 2 The results (D) indicate that P11 can achieve the control level of commercially available strains, but P11 increased root fresh weight (23%~32%) compared to the other three commercial strains. Figure 3 The presence of G indicates that P11 has good potential for disease control and growth promotion, as well as good prospects for market promotion and application.

[0121] In addition, the antagonistic ability was evaluated using the plate confrontation culture method. Four PDA plates were used for each treatment and incubated at 25℃ for four days. The inhibition rate and relative inhibition effect were then calculated. The results showed that P11 significantly inhibited the growth of eight common pathogens: *Phytophthora ginsengis*, *Phytophthora tomatoisense*, *Phytophthora spp.*, *Phytophthora capsici*, *Polygonum aviculare*, *Geotrichum candida*, *Anthracnose spp.*, and *Bacillus oryzae*. This indicates that P11 has universal and broad-spectrum disease inhibition properties and the potential to control other crop diseases (see...). Figure 2 (Middle F~G).

[0122] 4) Production and evaluation of microbial organic fertilizer

[0123] Animal-derived organic fertilizer (AOF) was prepared using well-rotted cow manure: The well-rotted cow manure was placed in a culture bottle and sterilized at 121℃ and 0.1 MPa for 25 minutes. After the cow manure cooled to room temperature, *Trichoderma hygroscopicum* P11 spore suspension was inoculated into the cow manure at a mass-to-volume ratio of 5 g:1 mL. The spore count of the *Trichoderma hygroscopicum* P11 spore suspension was 1.0 × 10⁻⁶. 8 CFU / mL; after inoculation, the mixture was piled up and fermented for 5 days. During the fermentation process, the pile was turned over once a day. After the fermentation was completed, well-rotted cow manure organic fertilizer was obtained.

[0124] Preparation of Plant-Derived Organic Fertilizer (POF) using marigold straw: Marigold straw was placed in a culture bottle and sterilized at 121℃, 0.1 MPa for 25 min. After the marigold straw cooled to room temperature, *Trichoderma hygroscopicum* P11 spore suspension was inoculated into the marigold straw at a mass-to-volume ratio of 5 g: 1 mL. The spore count of the *Trichoderma hygroscopicum* P11 spore suspension was 1.0 × 10⁻⁶. 8 CFU / mL; after inoculation, the mixture was piled and fermented for 5 days. During the fermentation process, the pile was turned over once a day. After the fermentation was completed, well-rotted marigold straw organic fertilizer was obtained.

[0125] Well-rotted cow manure organic fertilizer and well-rotted marigold straw organic fertilizer were added at a ratio of 2% by weight to the soil in a continuous cropping soil where Panax notoginseng had been planted for two years, before replanting Panax notoginseng. The specific treatment is as follows:

[0126] AOF is achieved by applying 2% cow manure;

[0127] AOF+P11 is a microbial organic fertilizer made by fermenting 2% Trichoderma hygroscopicum and cow manure.

[0128] CK is a blank control of continuously cropped soil, without any treatment.

[0129] POF is achieved by applying 2% marigold straw;

[0130] POF+P11 is a microbial organic fertilizer formulated with 2% Trichoderma marigold straw and fermentation.

[0131] Six replicates were set up in each group, with 10 Panax notoginseng seedlings inoculated in each replicate, and the soil weight per pot was 1 kg. After 3 months, the incidence of root rot, fresh root weight, and root length of Panax notoginseng were recorded.

[0132] The results showed that well-rotted cow manure organic fertilizer and well-rotted marigold straw organic fertilizer reduced the incidence of root rot by 73% and 40%, respectively (see...). Figure 2 (E) Animal-derived organic fertilizers have a stronger ability to reduce the incidence of root rot than plant-derived organic fertilizers, but plant-derived organic fertilizers are better at increasing the fresh weight of Panax notoginseng roots (by 65%). Figure 2 (E), while animal-derived organic fertilizer increased by 44% ( Figure 2 Both organic fertilizers (E) and [other organic fertilizers] increased the survival rate of Panax notoginseng seedlings by 256%, but there was no difference in the effect of the two organic fertilizers on the emergence rate. Figure 3 (E)

[0133] 3. Determination of Panax notoginseng saponin content

[0134] In step 2, (2) of step 3), each treatment has 6 pots as replicates, with 10 Panax notoginseng plants in each pot. Three Panax notoginseng plants from each pot are randomly selected for saponin determination. The main root of Panax notoginseng is dried, ground, passed through a 100-mesh sieve, and 0.2g is accurately weighed. 15ml of 75% methanol is added, and the mixture is extracted by ultrasonication for 30min. After centrifugation for 10min (12000r / min), 1ml of the supernatant is placed in a brown sample bottle. The contents of the three saponins R1, Rg1, and Rb1 in Panax notoginseng are detected by liquid chromatography (Shimadzu NEXERA X2 LC-30AD).

[0135] It can be seen that, in addition to controlling root rot, P11 can also improve the medicinal quality of Panax notoginseng, increasing the contents of saponins Rg1, Rb1, and R1 by 17%, 40%, and 24%, respectively (see...). Figure 2 (H).

[0136] 4. Detection of disease-resistant enzyme activities and genes in Panax notoginseng

[0137] Trichoderma spore suspension (1.0×10⁻⁶) 8 After three months of root irrigation treatment with CFU / mL, Panax notoginseng roots were collected, flash-frozen in liquid nitrogen, and stored at -80℃. Three plants were collected from each pot as one replicate, and three pots were collected as three replicates. Sterile water irrigation served as a control. After sampling, the surface soil of the Panax notoginseng was washed, and the root tissue was flash-frozen in liquid nitrogen and stored at -80℃. The activities of SOD, POD, and CAT in the roots were measured using a kit (Suzhou Greenbio Technology Co., Ltd., Suzhou, China). Simultaneously, qPCR detection of disease-resistant genes was performed using the following primers:

[0138] PnPR1 -F:AACCTTGCCTATGGCTTCCC(SEQ ID NO.1)

[0139] PnPR 1-R:TGTTACACCTCGCCCTACCG(SEQ ID NO.2); PnDEFL1 -F:TTCTGTTACTTTGATTGCTGATGATCT(SEQ ID NO.3) PnDEFL1 -R:ATAGTGACCCATGAAATTGCTACTTAG(SEQ ID NO.4)

[0140] PnSN1 -F:CCAAGCAACAGAAACTAACCAAGTG(SEQ ID NO.5)

[0141] PnSN1 -R:GACACAGTTGCACCTGGCACA(SEQ ID NO.6)

[0142] PnDEFL1- F:TTCTGTTACTTTGATTGCTGATGATCT(SEQ ID NO.7)

[0143] PnDEFL1 -R:ATAGTGACCCATGAAATTGCTACTTAG(SEQ ID NO.8)

[0144] PnPRPL1 -F:CCAACAAGCAACACCAAAACCA(SEQ ID NO.9)

[0145] PnPRPL1 -R:AAGATCAACAAGACCTCCCATGAAC(SEQ ID NO.10) PnCHI1 -F:GCAACGGCACAGATTACT(SEQ ID NO.11)

[0146] PnCHI1 -R:CAACCCTACCAAACGAAG(SEQ ID NO.12) PnCAD -F:TCAGTGGTGGAGGGTATGGT(SEQ ID NO.13) PnCAD -R:TGACACCAAAGCTCGAAGCC(SEQ IDNO.14).

[0147] It was found that *Trichoderma* P11 also activated immune system-related enzymes and genes in *Panax notoginseng*, increasing the activities of SOD, POD, and CAT, which are related to plant disease resistance, by 158%, 180%, and 673%, respectively. In addition, the relative expression levels of disease resistance-related genes were also significantly increased. PnPRPL1 , PnPR1 , PnDEFL1 , PnCAD and PnPnSN1 These figures increased by 440%, 169%, 293%, 39%, and 21% respectively, but for PnCHI No impact (see) Figure 2 (H).

[0148] 5. Dynamic observation of Trichoderma p11 rhizosphere

[0149] The roots of one-year-old Panax notoginseng were surface-disinfected with a solution of 75% alcohol and sodium hypochlorite, then rinsed with sterile water, and the Panax notoginseng was soaked in 10... 7 Dilute the Panax notoginseng in a CFU / ml Trichoderma spore suspension for 10 seconds, then remove and place in a sterile petri dish. Cover the Panax notoginseng with sterile soil.

[0150] Treatment 1: Roots were removed on the first day after being covered with sterile soil;

[0151] Treatment 2: Roots were removed and observed on the 5th day after being covered with sterile soil;

[0152] Treatment 3: Roots were removed and observed on the 7th day after being covered with sterile soil;

[0153] Each treatment was set up with three replicate experiments.

[0154] The specific observation procedure was as follows: After removing the roots, rinse them with sterile water and transfer them to a bleaching solution (NaOH) at 60°C for 2 hours. The treated roots were then placed in preheated ddH2O (60°C), cooled to room temperature, and stored at 4°C for 1 day. Subsequently, the roots were transferred to at least 5 ml of a mixed staining solution of methylene blue and solophenyl flavine and soaked at room temperature for 30 minutes. After staining, the roots were rinsed with distilled water for 5 minutes. Finally, the roots were observed under a fluorescence microscope (wavelength 470 nm).

[0155] See results Figure 4 It can be seen that when the roots of Panax notoginseng treated with P11 spores were taken out on days 1, 5, and 7 for fluorescent staining and then observed under a fluorescence microscope, it can be seen from the figures that no colonization of P11 was observed on the first day. On the fifth day, a small amount of Trichoderma colonization was observed in the rhizosphere, but it was not obvious. However, on the seventh day, mycelia were clearly observed to be wrapped around the roots of Panax notoginseng, and they successfully colonized the roots. This may help P11 to effectively compete for ecological niches and protect the health of Panax notoginseng.

[0156] 6. Effects of Trichoderma p11 on pathogen cell membrane permeability and redox balance

[0157] Solution 1: F. oxysporum+ P11: Mix Trichoderma P11 with F. oxysporum Co-culture was performed on PDA plates for 5 days. Control 1 consisted of cultures grown only on PDA plates. F. oxysporum, Incubate for 5 days.

[0158] Solution 2: F. solani+ P11: Mix Trichoderma P11 with F. solani Co-culture was performed on PDA plates for 5 days. Control 2 consisted of cultures only grown on PDA plates. F. solani, Incubate for 5 days.

[0159] Process 3: P. cucumerina+ P11: Mix Trichoderma P11 with P. cucumerina Co-culture was performed on PDA plates for 5 days. Control 3 involved culturing only on PDA plates. P. cucumerina, Incubate for 5 days.

[0160] Cell membrane integrity was determined using propidium bromide (PI) staining. First, pathogenic mycelia obtained from co-culturing treatments 1-3 for 5 days were added to 10 mL of PI staining solution (PI concentration 2.5 μg / mL). The mycelia were stained for 15 min in the dark, and then the staining solution on the surface of the mycelia was rinsed with physiological saline. The staining of the mycelia was then observed immediately under a fluorescence microscope, with normally growing pathogenic bacteria as a control.

[0161] Simultaneously, select pathogens that have confronted Trichoderma p11 in treatments 1-3. F. oxysporum, P. cucumerina, F. solani Edge hyphae were analyzed according to the kit instructions (Suzhou Gres Biotechnology Co., Ltd.) to determine the activities of three enzymes, SOD, POD, and CAT, as well as the contents of MDA and H2O2 in the pathogenic fungal hyphae. Results are shown below. Figure 5 It can be seen that after Trichoderma P11 confronted three types of Panax notoginseng root rot pathogens, the edge hyphae of the pathogens were picked and their redox-related indicators were measured. Trichoderma P11 treatment increased the incidence of bark rot (Fusarium oxysporum). F.solani P11 treatment increased POD activity but decreased SOD activity, while having no effect on CAT activity. Furthermore, P11 treatment of *Trichoderma harzianum* significantly increased MDA and H2O2 content by 40% and 50%, respectively. Simultaneously, PI staining revealed that *Fusarium solani* hyphae turned red, indicating cell membrane rupture and leakage of contents, suggesting that P11 induced membrane lipid peroxidation and cell membrane damage in *Fusarium solani*. P11 treatment of *Fusarium oxysporum* (… F.oxysporumPOD activity increased, SOD activity decreased significantly, CAT activity increased, and MDA and H2O2 contents increased by 14% and 42%, respectively. Similarly, *Fusarium oxysporum* hyphae were stained red by PI dye, indicating membrane peroxidation and cell membrane damage. P11 treatment of *Cucumber spore-forming bacteria* (…) P.cucumerina POD activity increased, SOD activity decreased significantly, only CAT showed a decreasing trend, MDA and H2O2 content also increased, by 168% and 29% respectively, and the difference in brightness of PI staining results was not obvious in terms of sensory perception.

[0162] In summary, the results of this invention are as follows:

[0163] (1) The disease control and growth promotion effects of Thiamectite were clearly demonstrated for the first time.

[0164] This invention verified the biocontrol effect of Trichoderma p11 through multiple experiments over two consecutive years. Firstly, Panax notoginseng seeds were sown. Because the root system of seed germination is relatively tender and more sensitive to continuous cropping obstacles in the soil, it is easier to quickly evaluate the biocontrol potential of Trichoderma. Therefore, the incidence of root rot and the survival rate of seedlings are important indicators for judging whether the biocontrol fungus can alleviate continuous cropping obstacles. This invention used continuously cropped soil and soil that had been sterilized and then inoculated with the pathogen for sowing experiments. The results showed that both improved the survival rate of Panax notoginseng and reduced the incidence of root rot. In actual production, purchasing and transplanting one-year-old Panax notoginseng is also a common practice in Panax notoginseng production. Therefore, this invention also used one-year-old Panax notoginseng seedlings to conduct further experiments to evaluate the biocontrol effect of P11. Simultaneously, continuously cropped soil and soil sterilized and then inoculated with three different pathogens were used. P.cucumerina, F.oxysporum, F.solani Soil tests were conducted, and the results showed that P11 significantly reduced the incidence of root rot. Finally, this invention compared P11 with commercially available microbial agents (Trichoderma harzianum, Trichoderma longifolia, and Bacillus subtilis). The results showed that P11 could achieve the biocontrol effect of commercially available strains, and compared with commercially available microbial agents (Trichoderma harzianum, Trichoderma longifolia, and Bacillus subtilis), it had a better ability to promote the increase of fresh weight of Panax notoginseng roots. Since Panax notoginseng is used medicinally as its root, the fresh weight of Panax notoginseng roots is a key agronomic trait determining the yield of Panax notoginseng and farmers' income. Therefore, P11 has good prospects for market promotion and field application.

[0165] Trichoderma spores introduced into the soil tend to lyse before germination, and due to the lack of a continuous nutrient supply, the germinating spores fail to grow. This significantly limits the application of Trichoderma spores in controlling soil-borne diseases. Adding organic matter to the soil can keep Trichoderma viable and achieve better biocontrol effects. Therefore, mixing organic substrates with microbial agents is widely used. This invention ferments P11 with marigold straw and cow manure to produce microbial organic fertilizers, both of which significantly improve their control efficacy, facilitating market promotion and application.

[0166] The results of this invention also show that P11 treatment increased the activity of antioxidant enzymes (SOD, POD, CAT) in Panax notoginseng. Furthermore, Pn PRPL1 Tolerance to *Fusarium solani* can be enhanced by increasing the balance of oxidative stress response and callosity deposition; this gene showed a significant upregulation of relative expression in the results of this invention. Overexpression PnPR1 The gene enhances resistance to Fusarium solani, is a positively correlated gene for disease resistance, and is also significantly upregulated; the chitinase gene... PnCHI1 It participated in the defense response of Panax notoginseng against root rot pathogens, and also showed an upregulation trend, but there was no statistical difference; the defensein-like protein gene of Panax notoginseng ( PnDEFL1 It has an inhibitory effect on the germination of Fusarium solani spores and is also significantly upregulated; Panax notoginseng PnCAD It was also significantly upregulated; Panax notoginseng snakin antimicrobial peptide gene ( PnSN1 It can also inhibit the germination of Fusarium solani spores, and this gene is also significantly upregulated. Based on the above enzyme activity assays and qPCR results, P11 may induce systemic resistance in Panax notoginseng to resist infection by root rot fungi.

[0167] (2) Trichoderma p11 can colonize the rhizosphere

[0168] Although *Trichoderma* P11 is widely used in biocontrol, its control efficiency in disease prevention or root development promotion is often slow and unstable. This limitation can be attributed to various factors, including the complexity of the soil microbial community, environmental conditions, and the interaction between the fungus and the host plant. When *Trichoderma* is used as an invasive microorganism in the field, its colonization ability is affected by soil physicochemical properties and existing microbial populations, which significantly impacts the establishment and effectiveness of *Trichoderma* in the soil environment. However, once *Trichoderma* successfully colonizes in the rhizosphere, it can effectively limit pathogen development by occupying ecological niches. Therefore, this invention uses fluorescent staining, a visual method, to evaluate its colonization ability. Thus, *Trichoderma* P11 can effectively colonize in the rhizosphere and is a potential biocontrol mechanism.

[0169] (3) Trichoderma p11 inhibits the growth of pathogens by interfering with the redox balance of cells.

[0170] This invention demonstrates that *Trichoderma* P11 treatment induced an increase in MDA content and a decrease in SOD activity in all three pathogenic fungi. Conversely, P11 treatment increased CAT activity in *Fusarium*, with the same decreasing trend observed only in *C. cucumberis*. This indicates that *Trichoderma* P11 can interfere with *Fusarium* growth by affecting cellular reactive oxygen species (ROS) metabolism. PI staining is a commonly used method for assessing cell membrane integrity. In this invention, P1 staining was performed on the three strains after confrontation. All *Fusarium* strains appeared red under a fluorescence microscope, with *Fusarium solani* showing the strongest fluorescence, followed by *Fusarium oxysporum*, and *C. cucumberis* showing the weakest. This indicates that the pathogenic cell membranes were damaged. In conclusion, P11 can inhibit pathogen growth by affecting the redox balance of *Fusarium* cells, increasing ROS content, and disrupting cell membrane integrity.

[0171] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A strain of Trichoderma chlamydophyllum ( Trichoderma crassum P11, the accession number of Trichoderma P11 is CCTCC NO:M2024648, and the depositary institution is China Center for Type Culture Collection.

2. A biocontrol agent, characterized in that, Includes the *Trichoderma* P11 as described in claim 1.

3. The biocontrol agent according to claim 2, characterized in that, The biocontrol agent contains ≥1×10⁻⁶ viable Trichoderma P11 bacteria. 7 CFU / mL or ≥1×10 7 CFU / g.

4. The biocontrol agent according to claim 2, characterized in that, The biocontrol agent includes a suspension of Trichoderma p11 spores.

5. A bio-organic fertilizer, characterized in that, It includes a fungal component and a carrier, wherein the fungal component includes the Trichoderma p11 of claim 1.

6. The bio-organic fertilizer according to claim 5, characterized in that, The carrier includes livestock and poultry manure and / or crop straw.

7. The use of the Trichoderma p11 of claim 1, or the biocontrol agent of any one of claims 2-4, or the bio-organic fertilizer of claim 5 or 6, in at least one of the following: 1) Control of the pathogen causing root rot in Panax notoginseng, wherein the pathogen causing root rot in Panax notoginseng is Fusarium oxysporum (… Fusarium oxysporum Fusarium solani () Fusarium solani ) and Cucumber Scale ( Plectosphaerella cucumerina One or more of the following; 2) Promoting the growth of Panax notoginseng, wherein promoting the growth of Panax notoginseng includes increasing one or more of the following: fresh root weight, root length and seedling survival rate; 3) Increase the content of Panax notoginseng saponins; the saponins include one or more of saponins Rg1, Rb1 and R1.

8. A method for preventing and controlling root rot in Panax notoginseng, characterized in that, include: The *Trichoderma* P11 of claim 1, or the biocontrol agent of any one of claims 2-4, or the bio-organic fertilizer of claim 5 or 6, is applied to *Panax notoginseng*; the pathogen of *Panax notoginseng* root rot is one or more of *Fusarium oxysporum*, *Fusarium solanum*, and *Sphaerocera cucumberis*.

Citation Information

Patent Citations

  • Penicillium photosporum LZ-3, fungicide and application of penicillium photosporum LZ-3 in biological control and growth promotion of panax notoginseng root rot

    CN119120222A

  • Trichoderma harzianum, trichoderma graminearum, trichoderma graminearum and application thereof in agriculture

    CN119161991A