Plant active substance bacteriostatic agent for microbial control of earthen ruins and screening method thereof
By screening and combining citral, citronellol, and geraniol, a model of antibacterial agents for earthen sites was constructed, which solved the problems of insufficient targeting and long-term effectiveness in the prevention and control of microorganisms in earthen sites. It achieved a highly efficient and stable antibacterial effect, avoided the environmental risks of traditional chemical agents, and promoted the green development of cultural relic protection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-13
- Publication Date
- 2026-06-02
Smart Images

Figure CN122123373A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of cultural relic protection technology, specifically to a plant-based active antibacterial agent for the prevention and control of microorganisms in earthen sites and its screening method. Background Technology
[0002] Earthen sites, as important cultural heritage sites, are often susceptible to mold growth due to damp environments, leading to soil degradation. While traditional chemical agents (such as ethylene oxide and methyl bromide) are effective, they pose environmental and health risks.
[0003] With the rise of green conservation concepts, plant-derived extracts have gradually gained attention in the field of heritage protection due to their natural origin, biodegradability, and good environmental compatibility. Existing research shows that some plant active ingredients have inhibitory effects on common molds, and there are reports in the literature on their application in mold prevention exploration of earthen sites. However, existing technologies still have significant limitations: on the one hand, most studies have not yet established a targeted screening system for pathogenic bacteria specific to earthen sites, resulting in a lack of scientific rigor and specificity in the selection of antimicrobial agents; on the other hand, existing plant-derived antimicrobial agents often suffer from insufficient durability and poor stability, making it difficult to achieve long-term protection under complex environmental conditions, thus limiting their large-scale promotion and application.
[0004] Therefore, in the current field of microbial control of earthen archaeological sites, there is an urgent need to further develop green protective agents with specific microbial targets, high efficiency, and long-lasting antibacterial effects, based on existing research on plant-derived antibacterial agents, and to establish a systematic method for screening and evaluating the efficacy of active substances. This invention aims to construct a screening model targeting typical pathogens affecting earthen archaeological sites, systematically evaluate the antibacterial efficacy and persistence of natural plant active substances, thereby addressing the shortcomings of existing technologies in terms of specificity, long-term effectiveness, and methodological system, and promoting the scientific and systematic development of green antibacterial technology for earthen archaeological sites. Summary of the Invention
[0005] The purpose of this invention is to provide a plant-based antibacterial agent for the prevention and control of microorganisms in earthen sites and its screening method. This antibacterial agent uses citral as the main active ingredient, supplemented with other plant-based active substances, and ensures high efficiency and long-lasting antibacterial effect through systematic screening. The screening method includes identification of microbial diseases, comparison of antibacterial agent efficacy, determination of minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC), and assessment of antibacterial durability.
[0006] To achieve the above objectives, this invention provides a plant-based active antibacterial agent for the prevention and control of microorganisms in earthen sites and its screening method, comprising the following steps: S1 Microbial disease identification step, which includes sample collection and preservation, microbial isolation and purification, and DNA extraction and molecular identification; S2 Antibacterial material screening and efficacy evaluation step, which includes initial screening of antibacterial agents and determination of key efficacy indicators; S3 Durability evaluation step of the optimal antibacterial agent, which includes simulated time-effect testing; wherein, the S3 durability evaluation step of the optimal antibacterial agent further includes constructing a simulation system and setting five concentrations of citral solution (50%, 25%, 12.5%, 6%, and 3%) in the constructed simulation system. The prepared standard bacterial suspension is spread on BPA plates, and then the corresponding concentration of citral solution is evenly sprayed using a spray bottle. Three parallel plates (LCZ1 and LCZ2) are set for each concentration group and placed in corresponding glass covers; the plates are then incubated at room temperature.
[0007] The optimal antibacterial concentration is determined based on whether and how bacterial colonies grow on each plate.
[0008] As a further improvement to this technical solution, the sample collection and preservation process includes clearly defining the sampling target as the visible moldy area of the tidal gate channel soil layer inside the exhibition hall of the Yangzhou Grand Canal Museum of China. This involves preparing sterile swabs, sterile sealed containers, and labeling tools to ensure no external microbial contamination throughout the process. A certain area is horizontally wiped across the moldy surface with a moistened sterile swab. This operation is repeated to collect multiple samples at different locations, labeled H1, H2, and H3 respectively. The collected swabs are immediately placed in a sterile container and sealed. The sampling location, date, and other information are recorded in detail. The samples are then quickly sent to the laboratory and stored in a -20°C freezer to inhibit microbial growth and maintain DNA integrity.
[0009] As a further improvement to this technical solution, the microbial isolation and purification process includes adding 1 mL of bacterial culture to 9 mL of physiological saline, mixing thoroughly, and obtaining 10... -1 The diluent; take another 1 mL from this solution and add it to 9 mL of physiological saline to obtain 10. -2 Diluent, and so on up to 10 -3 For higher dilutions, take 0.1 mL of each dilution and spread it evenly on the surface of PDA (potato dextrose agar) medium. Perform three replicates for each dilution.
[0010] As a further improvement to this technical solution, the microbial isolation and purification process also includes inverting the coated plates and placing them in a 28°C incubator for 3-4 days to allow the microorganisms to form single colonies. Using a sterile inoculation loop, single colonies of different morphologies are picked from the plates and streaked onto new BPA (beef extract peptone agar) plates. The plates are then incubated again at 28°C.
[0011] The isolation and purification process was repeated multiple times until a single, pure colony with consistent morphology was obtained on the plate. Finally, two pure strains were obtained, denoted as LCZ1 and LCZ2.
[0012] As a further improvement to this technical solution, the DNA extraction and molecular identification process includes scraping 20-30 mg of bacterial cells (rich in spores) from mature bacterial colonies, disrupting the cells using liquid nitrogen grinding, extracting total DNA using a commercial genomic DNA extraction kit, and detecting the concentration and purity of the extracted DNA (e.g., A260 / A280 ratio) using a micro spectrophotometer to ensure that the DNA quality meets the requirements of subsequent experiments. Qualified samples are stored long-term in an ultra-low temperature freezer at -80℃.
[0013] As a further improvement to this technical solution, the DNA extraction and molecular identification process also includes using universal primers ITS1 and ITS4 for the fungal ribosome ITS region to perform PCR amplification on the DNA template to obtain a target gene fragment of about 600 bp. The PCR program includes pre-denaturation, 30 cycles of denaturation-annealing-extension, and final extension. The PCR product is detected by 1% agarose gel electrophoresis. After confirming successful amplification and the absence of nonspecific bands, the product is purified.
[0014] As a further improvement to this technical solution, the DNA extraction and molecular identification process also includes sending the purified PCR product to a sequencing company for Sanger sequencing.
[0015] The obtained gene sequences were compared with BLAST in the NCBI database, and the bacterial species were determined based on sequence homology and coverage.
[0016] As a further improvement to this technical solution, the initial screening of antibacterial agents includes preparing solutions of five antibacterial agents: geraniol, citronellol, citronellol, linalool, and citral. BPA solid medium is prepared, and purified LCZ1 and LCZ2 strains are inoculated into LB liquid medium and cultured with shaking until the logarithmic growth phase. The bacterial concentration is adjusted to the standard range using PBS buffer. 0.5 mL of standard bacterial suspension is evenly spread on a BPA plate. 6 mm diameter, heat-sterilized filter paper is immersed in different antibacterial agent solutions, dried, and then placed in the center of the plate with the bacterial solution. The plate is incubated at 27°C for 2-3 days, and the diameter of the inhibition zone (the transparent zone around the filter paper where no bacteria grow) is measured. The antibacterial activity is evaluated by comparing the size of the inhibition zones. The results show that citral has the largest inhibition zone diameter against both bacteria, indicating the best antibacterial effect.
[0017] As a further improvement to this technical solution, the key efficacy index determination process includes serially diluting citral and citronellol in LB liquid medium to prepare drug-loaded media with concentration gradients of 50%, 25%, 12.5%, 6%, 3%, and 1.5%. A certain amount of standard bacterial suspension is added to each concentration gradient media, and the media are incubated at 28°C with shaking for 4 days. The lowest drug concentration that completely inhibits visible microbial growth is defined as the MIC. The experimental results were all 25%. Culture medium was taken from tubes where no growth was observed in the MIC experiment and spread onto fresh BPA solid plates. The plates were incubated at a suitable temperature for several days. The lowest drug concentration at which no colonies grow on the plate is defined as the MBC. The results show that the MBC of citral against LCZ1 is 25%, and the MBC for other conditions is 50%.
[0018] As a further improvement to this technical solution, the simulation time-effectiveness test includes determining the failure time of the antibacterial effect of different concentrations of citral based on the observation results. The conclusion is that a concentration of ≥6% can provide complete inhibition for at least 7 days, while a concentration of 3% fails within 3-5 days.
[0019] A plant-based antimicrobial agent for the prevention and control of microorganisms in earthen sites is described. This method employs a screening approach for plant-based antimicrobial agents used in the prevention and control of microorganisms in earthen sites. It includes five candidate plant-derived extracts: geraniol, citronellol, citronellol, linalool, and citral. By measuring key indicators such as the diameter of the inhibition zone, the minimum inhibitory concentration (MIC), and the minimum bactericidal concentration (MBC), each antimicrobial agent exhibits clear efficacy characteristics. Based on the MIC and MBC measurement results, one of the five candidate plant-derived extracts is selected.
[0020] This invention further provides an antibacterial composition comprising citral, citronellol, and geraniol. The mass ratio of citral, citronellol, and geraniol is 6-8:3-5:1-2. This antibacterial composition exhibits minimal damage to earthen sites, long-lasting effect, and low risk of drug resistance.
[0021] The present invention also provides a method for preparing an antibacterial agent solution, wherein, optionally, the antibacterial agent solution is a microcapsule emulsion, and the preparation method includes the following steps:
[0022] (1) Preparation of microcapsule wall material solution: β-cyclodextrin and gum arabic are added to deionized water and stirred at 60~70℃ until the wall material is completely dissolved. The mass ratio of β-cyclodextrin, gum arabic and deionized water is 3:1:20.
[0023] (2) Preparation of core material solution: Citral, citronellol and geraniol are mixed evenly to obtain a mixed solution;
[0024] (3) Microcapsule encapsulation: Under stirring conditions, the mixture was slowly added dropwise to the wall material solution. After the addition was completed, stirring was continued for 40 minutes to form a stable emulsion.
[0025] (4) Spray drying to obtain microcapsule powder;
[0026] (5) Formulation: The microcapsule powder is uniformly dispersed in deionized water to obtain the product.
[0027] Optionally, the antibacterial agent solution is a Pickering emulsion, and its preparation method includes the following steps:
[0028] (5) Preparation of aqueous phase: Nano silica and Tween-80 are uniformly dispersed or dissolved in deionized water to obtain a stable aqueous phase; wherein the mass ratio of nano silica, Tween-80 and deionized water is 3:1:83.
[0029] (6) Preparation of oil phase: Citral, citronellol and geraniol are mixed evenly to obtain a homogeneous oil phase;
[0030] (7) Emulsion preparation: Under stirring conditions, the oil phase is slowly added dropwise to the aqueous phase. After the addition is complete, a high-speed shearing machine is used to shear at high speed to form a preliminary emulsion. The rotation speed of the high-speed shearing is 10,000-20,000 r / min, and the shearing time is 10-15 min.
[0031] (8) Emulsion stabilization: Adjust the pH of the system to 5.8-6.2 and defoam to obtain a stable Pickering emulsion.
[0032] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0033] 1. This invention, through rigorous sampling, isolation, purification, and ITS rDNA sequence analysis, identified 99.9% of the two main pathogenic bacteria found at the Yizheng tidal gate riverbed earthen site as *Alternaria alternata* and *Mucorcircinelloides*, laying a solid scientific foundation for subsequent targeted remediation. Based on this, the study systematically screened five plant-derived antibacterial materials and determined citral to be the most effective antibacterial agent. This not only identified a highly efficient antibacterial agent but, more importantly, provides a green and safe alternative, avoiding the potential environmental and human hazards of traditional chemical fumigants (such as ethylene oxide), embodying the advanced concepts of "preventive protection" and "minimal intervention" in cultural relic preservation.
[0034] 2. This invention discovers that citral concentrations of ≥6% can provide complete antibacterial effect for at least 7 days in a simulated sealed environment. In practical protection, a 6% concentration of citral can be sprayed once every half month to achieve effective antibacterial effect. The effects and limitations of lower concentrations (such as 3%) are also quantified, providing cultural relic protection workers with a decision-making basis based on scientific evidence.
[0035] 3. This invention screened a formulation system with citral (6%-8%) as the core, citronellol (3%-5%) as an auxiliary, and geraniol (1%-2%) as an optional synergistic ingredient. Among them, antibacterial agent 2 (6% citral + 5% citronellol + 2% geraniol) showed the best antibacterial effect, with an inhibition zone diameter of 3.386±0.802 cm against Alternaria alternata (LCZ1) and 2.765±0.688 cm against Mucor rotundifolia (LCZ2), which was significantly better than single ingredients and other compound groups. The three ingredients did not have antagonistic effects. The mechanisms of action of citral and citronellol were complementary, and geraniol could further expand the antibacterial spectrum while effectively reducing microbial resistance. This solved the technical problems of narrow antibacterial range and easy drug resistance with long-term use of single antibacterial ingredients.
[0036] 4. This invention addresses the technical pain points of existing plant-derived antibacterial agents, such as uneven antibacterial effects, poor stability of antibacterial active ingredients like citral in water, short antibacterial duration, and susceptibility to drug resistance. Through scientific screening of ingredient ratios and optimization of formulation processes, a series of highly efficient, stable, and long-lasting antibacterial compositions have been obtained. These compositions maintain good stability under storage conditions, extending product shelf life and reducing the loss of active ingredients during storage and transportation.
[0037] 5. The technical solution of this invention covers the entire process from "pathogen identification → material screening → efficacy quantification → timeliness verification," providing a classic example for dealing with biological diseases in other similar environments (such as museum storage, archaeological site sites, etc.). This methodological innovation emphasizes targeted treatment and data-driven approaches, effectively avoiding blind spots in conservation work. The research results have powerfully promoted the application of plant-derived natural products in cultural relic protection, providing successful case support and scientific backing for the entire industry to shift towards a more environmentally friendly and sustainable development direction. It has a broad industry demonstration effect and profound social significance. Attached Figure Description
[0038] Figure 1 This is a flowchart illustrating the method for screening plant-based active substances for microbial control of earthen sites according to the present invention. Detailed Implementation
[0039] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0040] The following embodiments of the present invention provide a flowchart illustrating a method for screening antibacterial plant active substances for microbial control in earthen archaeological sites. Figure 1 . Example 1
[0041] The sampling target was the visible moldy area in the tidal barrier channel of the Grand Canal Museum of China in Yangzhou. Sterile swabs, sterile sealed containers, and labeling tools were prepared to ensure no external microbial contamination throughout the process. A certain area of the moldy surface was swabbed horizontally with a moistened sterile swab. This operation was repeated to collect multiple samples at different locations, labeled H1, H2, and H3 respectively. The collected swabs were immediately placed in sterile containers and sealed. The sampling location, date, and other information were recorded in detail. The samples were then quickly sent to the laboratory and stored at -20°C to inhibit microbial growth and maintain DNA integrity.
[0042] The samples from the diseased area contained a rich variety of microorganisms, so the microbial community was isolated and purified. After the microorganisms were revived, 1 mL of bacterial suspension was added to 9 mL of physiological saline and mixed thoroughly to obtain 10... -1 The diluent; take another 1 mL from this solution and add it to 9 mL of physiological saline to obtain 10. -2 Diluent, and so on up to 10 -3For higher dilutions, take 0.1 mL of bacterial suspension from each dilution and spread it evenly on the surface of PDA (potato dextrose agar, weigh 46.0 g of PDA, add to 1000 ml of distilled water, autoclave at 115°C for 20 min) medium. Perform three replicates for each dilution. Then, invert the spread plates and incubate them at 28°C for 3-4 days to allow single colonies to form. Using a sterile inoculation loop, pick single colonies with different morphologies from the plates and streak them onto a new BPA (beef extract peptone agar, 3 g beef extract, 10 g peptone, 5 g NaCl, 15 g-25 g agar, 1000 ml water, pH adjusted to 7.4 with dilute hydrochloric acid) plate. Incubate again at 28°C. Repeat the isolation and purification process multiple times until uniform, pure single colonies are obtained on the plates. Finally, two pure bacterial strains are obtained, designated LCZ1 and LCZ2.
[0043] Using liquid nitrogen grinding, 20-30 mg of bacterial strain samples scraped from mature spores in BPA medium were powdered for later use. DNA was then extracted from the obtained bacterial samples using the Ezup column-based fungal genomic DNA extraction kit (SK8259), and the concentration and purity of the extracted DNA were subsequently determined. Samples that passed the tests were stored at -80℃. To ensure the complete extraction of the microbial community from the surface of the sedimentary soil layer in the tidal barrier channel, the ITS gene fragment was amplified and sequenced. Two sets of primers were used for sequencing each sample: fungal primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC). The PCR reaction conditions were as follows: pre-denaturation, 94℃ for 4 min; denaturation, 94℃ for 45 s; annealing, 55℃ for 45 s; extension, 72℃ for 10 min; the denaturation-extension cycle was repeated for 30 cycles, with a final extension at 72℃ for 10 min. Amplified products of equal concentration were mixed and purified using Agencourt. The amplified PCR products were detected by 1% agarose gel electrophoresis at 150V, 100mA, for 20 min to purify the amplified products. The purified PCR products were sent to a sequencing company for Sanger sequencing to obtain the base sequence information of the DNA fragments. These sequences were compared with microbial sequences in the NCBI database to obtain information on strains with varying similarities to the tested PCR samples. Based on the sequence alignment score and similarity, the microbial strain with the highest matching degree to the test sample was determined and identified as the species of the target strain. The obtained gene sequences were then subjected to BLAST alignment in the NCBI database, and the bacterial species were determined based on sequence homology and coverage. The colony morphology of the two strains was observed, and molecular identification was performed by further analysis of their ITS rDNA sequences, with the amplified fragment length being approximately 600 bp. The ITS rDNA sequences of the two successfully sequenced strains were subjected to BLAST analysis using NCBI. LCZ 1 was identified as *Alternaria*, suspected to be *Alternaria alternata*; LCZ 2 was identified as *Mucor*, suspected to be *Mucor circinelloides*.
[0044] Table 1. Results of fungal strain identification
[0045] Example 2
[0046] The antifungal efficacy was tested using the inhibition zone method. 6 mm diameter filter paper discs were sterilized by dry heat and then immersed in different concentrations of antibacterial agent solutions for 1 hour. After drying, they were stored for later use. Three injections of purified bacterial strain were transferred to LB liquid medium (25.0 g of LB broth was dissolved in 1000 ml of distilled water, dispensed, and autoclaved at 121℃ for 15 min). After shaking and centrifugation, the culture was resuspended in PBS buffer to prepare a bacterial suspension. 0.5 mL of the bacterial suspension was inoculated onto BPA medium, spread evenly, and filter paper discs soaked in different concentrations of antibacterial solution were placed in petri dishes. The culture was incubated at 27℃ for 2-3 days, and the growth of the bacterial strain was observed. The radius of the inhibition zone at different concentrations was measured. Three parallel plates were prepared for each antibacterial agent concentration.
[0047] In this embodiment, five plant-derived extracts—geraniol (≥98%), citronellol (≥95%), citronellol (≥85%), linalool (≥98%), and citral (≥97%)—were selected for antibacterial material screening. Using 9.0 cm diameter plates, 6 mm filter paper discs impregnated with the five different antibacterial agents were placed on the same plate, and three parallel experiments were conducted for each strain. Based on the criteria of inhibition zone diameter percentages of 10%, 20%, 30%, and 50%, essential oils with inhibition zone diameters exceeding 0.9 cm, 1.8 cm, 2.7 cm, and 4.5 cm, respectively, were analyzed to evaluate the antibacterial activity of different essential oils; the results are shown in Table 2.
[0048] Table 2. Diameter of inhibition zones (cm) of plant-active substances against Alternaria alternata and Mucor.
[0049]
[0050] LCZ 1, when treated with citral, formed an inhibition zone diameter exceeding 30%, demonstrating a strong antibacterial effect, but not reaching 50%; while the other four antibacterial agents showed relatively limited antibacterial efficacy. For LCZ 2, antibacterial agents with inhibition zone diameters exceeding 10% included citral, citronellol, bergamot, and geraniol, with citral forming an inhibition zone diameter exceeding 20%. Comparing the antibacterial activity of the five plant-based active substances, citral exhibited the best antibacterial effect, followed by citronellol, while linalool showed the weakest antibacterial effect, slightly inferior to citronellol and geraniol.
[0051] Based on experimental data, the antibacterial effects of citral and citronellol were further studied, and their minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) were determined.
[0052] The minimum inhibitory concentration (MIC) is the lowest amount of antibiotic required to completely inhibit the growth of microorganisms, reflecting the sensitivity of microorganisms to that antibiotic. This study used a dilution method to determine the MIC of each antibiotic. MIC determination: Two selected antibiotics were serially diluted in autoclaved LB broth to prepare drug-loaded media at concentrations of 50%, 25%, 12.5%, 6%, 3%, and 1.5%, with at least three media prepared for each concentration. 1 × 10⁻⁶ ppm was used as the concentration. 8 A bacterial suspension of CUF / mL was added to agar plates and incubated at 28°C for 4 days using a shaking incubator. The microbial growth on the plates was then observed. The minimum concentration at which no microbial growth was observed is the MIC.
[0053] The minimum bactericidal concentration (MBC) refers to the concentration of a drug that kills fungi in the disk diffusion method. Similar to the MIC, the MBC is the lowest drug concentration that can completely kill fungi after treatment. The determination of the minimum bactericidal concentration involves determining the effective concentration range of the drug based on the MIC. Within the concentration range above and below the MIC, select plates capable of growing fungi, evenly spread the culture medium on the plates, add the appropriate concentration of drug solution (ensuring uniform distribution), inoculate with a fungal suspension, and incubate at 22°C under constant humidity for 3 days. Observe the growth of fungi on each plate to find the lowest drug concentration that can completely kill fungi, i.e., the MBC.
[0054] Experimental Results: In the experiment, drug-loaded culture media with concentrations of 50%, 25%, 12.5%, 6%, 3%, and 1.5% were prepared, respectively. By observing the turbidity of the bacterial suspension in the EP tubes, the minimum inhibitory concentrations (MICs) of citral and citronellol against LCZ 1 and LCZ 2 strains were determined to be 25%.
[0055] Plant bioactive substance bacterial suspensions were plated at concentrations of 50%, 25%, and 12.5% and cultured. Results showed no bacterial growth on plates treated with 25% and 50% citral and 50% citronellol, while colony formation was observed on plates treated with 12.5% citral and 12.5% and 25% citronellol. Therefore, it was inferred that the minimum bactericidal concentration (MBC) of citral against LCZ 1 was 25%, and that of citronellol against LCZ 1 was 50%. Simultaneously, the MBC of both citral and citronellol against LCZ 2 was 50%. These results indicate that citral exhibits stronger bactericidal activity against LCZ 1 than citronellol, while there was no significant difference in bactericidal effect between the two against LCZ 2. Example 3
[0056] Antimicrobial agent durability assessment
[0057] First, bacterial suspensions were prepared. The purified LCZ 1 and LCZ 2 target strains were inoculated into LB liquid medium and cultured with shaking at a suitable temperature until the bacterial suspension reached the logarithmic growth phase. After culturing, the bacterial cells were collected, and the bacterial concentration was adjusted to 1.0 × 10⁻⁶ using PBS buffer. 6 A standardized bacterial suspension was prepared at CFU / mL. This standardized bacterial suspension was then precisely pipetted and evenly spread onto the surface of BPA solid medium, ensuring an equal initial inoculum size across all culture dishes to minimize experimental error.
[0058] Different concentrations of citral solution were uniformly sprayed onto the surface of the culture medium inoculated with the strain using a spray bottle of fixed volume. The concentration gradient of the citral solution was set at five levels: 50%, 25%, 12.5%, 6%, and 3% (mass fraction). Five treatment groups were established, each corresponding to a different citral concentration, and each was housed in a 30 cm x 30 cm x 30 cm acrylic glass dome to create an independent microenvironment. Within each glass dome, six culture dishes treated with the corresponding concentration of citral were placed parallel to each other, including three parallel samples inoculated with LCZ 1 strain and three parallel samples inoculated with LCZ 2 strain. All culture devices were sealed with glass domes and continuously incubated at room temperature. During the incubation period, the growth of the two strains in each treatment group was carefully observed and recorded daily to evaluate the immediate antibacterial effect of different concentrations of citral and its antibacterial persistence over time.
[0059] During the seven days of the experiment, no significant colony growth was observed in any of the citral treatment groups at concentrations of 6% and above (covering four concentration gradients: 50%, 25%, 12.5%, and 6%), regardless of whether the medium was inoculated with either LCZ 1 or LCZ 2 strains. This preliminary result indicates that, during this observation period, citral concentrations of 6% and above exhibited complete inhibition against both tested strains, demonstrating good short-term antibacterial ability.
[0060] In contrast, the 3% citral treatment group failed to sustainably inhibit the growth of both strains. Specifically, colonies were observed in cultures inoculated with LCZ 2 strain starting on day 3 post-treatment, indicating that the effective inhibition time of 3% citral on LCZ 2 strain was within 3 days. In contrast, colonies appeared in cultures inoculated with LCZ 1 strain starting on day 5 post-treatment, showing that its effective inhibition time was within 5 days. This phenomenon not only demonstrates the limited antibacterial durability of 3% citral but also preliminarily suggests that under 3% citral stress, LCZ 2 strain may break through inhibition earlier than LCZ 1 strain, exhibiting relatively faster growth recovery or slightly stronger tolerance to this concentration.
[0061] Based on the experimental data observed on day 7, it can be preliminarily inferred that citral concentrations of 6% and above showed sustained effective inhibition for at least 7 days under the experimental conditions, while a 3% concentration gradually lost its ability to control the target strain within 3 to 5 days.
[0062] Based on preliminary data analysis after 7 days of experimentation, the core conclusions of this simulated time-limited effect test are as follows: Citral exhibits a significant concentration-dependent characteristic in its antibacterial durability against the tested LCZ 1 and LCZ 2 strains. In the current observation phase, concentrations of 6% and above of citral demonstrated complete inhibition for at least 7 days, indicating good sustained antibacterial potential. In contrast, the antibacterial effect of 3% citral was relatively short-lived, with effective inhibition against both strains lasting less than 5 days. Furthermore, strain LCZ 2 showed a faster growth breakthrough, suggesting that this low concentration is unlikely to provide reliable long-term protection. Example 4
[0063] This embodiment provides a bacteriostatic agent that causes minimal damage to earthen sites, has a long-lasting effect, and avoids drug resistance. It is composed of citral, citronellol, and geraniol. The concentrations are: citral 6%-8%, citronellol 3%-5%, geraniol 1%-2%, and deionized water as the solvent. The agent is ultrasonically mixed before use. The antibacterial activity and antibacterial durability were tested according to the method in Example 3.
[0064] Table 3. Diameter of the inhibition zone (cm) of plant-based active compositions
[0065] Example 5
[0066] To reduce the cost of mold prevention and protection for earthen archaeological sites, further improve the long-lasting effect of antibacterial agents, and enhance the stability of antibacterial agent solutions, a stable and long-lasting antibacterial agent solution was prepared using antibacterial agent 2 as an example. Specific preparation steps:
[0067] 1. Preparation of microcapsule wall material solution: Weigh 6 parts β-cyclodextrin and 2 parts gum arabic, add 40 parts deionized water, place in a 60℃ constant temperature water bath, stir at 400r / min for 20min until the wall material is completely dissolved, and cool to 25℃ for later use.
[0068] 2. Preparation of core material solution: Weigh 6 parts citral, 5 parts citronellol, and 2 parts geraniol, mix them evenly to obtain a mixed solution;
[0069] 3. Microencapsulation: The mixture was slowly added dropwise to the wall material solution at a rate of 0.8 mL / min. During the addition, the stirring speed was continuously 350 r / min. After the addition was completed, stirring was continued for 40 min to form a stable emulsion.
[0070] 4. Spray drying: The emulsion is fed into a spray dryer, with the inlet air temperature set to 160℃, the outlet air temperature to 80℃, the feed rate to 5mL / min, and the atomization pressure to 0.3MPa. After drying, the microcapsule powder is collected with an average particle size of 1-5μm.
[0071] 5. Add the microcapsule powder to 39 parts of deionized water and stir at 250 r / min for 15 min to ensure that the microcapsules are evenly dispersed without agglomeration, thus obtaining the solution of antibacterial agent 2. Example 6
[0072] This embodiment provides a method for preparing a long-acting antibacterial agent. The specific preparation steps are as follows:
[0073] 1. Take a clean and sterile reaction vessel, add 83 parts of deionized water, weigh 3 parts of nano silica and 1 part of Tween-80, place them in a 25°C constant temperature water bath, stir at 400 r / min for 20 min until the nano silica is uniformly dispersed and the Tween-80 is completely dissolved to obtain a stable aqueous phase;
[0074] 2. Weigh out 6 parts of citral, 5 parts of citronellol, and 2 parts of geraniol, mix them evenly to obtain a homogeneous oil phase;
[0075] 3. Slowly add the oil phase to the aqueous phase while stirring during the addition process at a speed of 500 r / min. After the addition is complete, use a high-speed shearing machine to shear at a speed of 10000 r / min for 15 min to homogenize and form a preliminary emulsion.
[0076] 4. Place the preliminary emulsion in a constant temperature water bath (25℃), stir at low speed (200r / min) for 30min, adjust the pH of the system to 5.8-6.2, let it stand at room temperature for 2h, remove the air bubbles, and obtain a stable Pickering emulsion of antibacterial agent 2.
[0077] The number of days of complete inhibition of the antibacterial agent solutions prepared in Examples 5 and 6 was determined according to the method in Example 3. The antibacterial agent solutions prepared in Examples 5 and 6 were stored at 25°C for 30 days, and the citral retention rate was measured; the results are shown in Table 4.
[0078] Table 4. Study on the long-lasting antibacterial properties and stability of antibacterial agent solutions.
[0079]
[0080] Example 5: Microcapsules formed from β-cyclodextrin and gum arabic can encapsulate antibacterial active ingredients such as citral, isolating them from the aqueous environment and reducing oxidative degradation. Simultaneously, they enable the slow release of antibacterial components, significantly prolonging the antibacterial effect and making them suitable for long-term antibacterial applications. The preparation process is mature, the microcapsules have good dispersibility, and are easy to store and use. Example 6: Nano-silica, as a Pickering emulsion stabilizer, forms a dense adsorption layer at the oil-water interface, encapsulating antibacterial active ingredients, isolating them from the aqueous environment, and significantly improving the stability of citral. The emulsion system can slowly release antibacterial components, prolonging the antibacterial effect. Furthermore, the emulsion has good dispersibility and strong stability, the preparation process is simple, and it is suitable for various application scenarios such as coating and spraying.
[0081] In simulated time-dependent testing, the combined solution exhibited a more stable antibacterial effect within an acrylic glass enclosure, reducing the frequency of application, lowering labor costs, and minimizing disturbance to the archaeological site. Furthermore, optimized formulation enhances its practicality. Operationally, the spraying method is easy to implement, suitable for large-scale application in museum exhibition halls or archaeological sites. The combined antibacterial agent is readily prepared and easy to store, improving overall efficiency. The combination of citronellol with citral and geraniol provides an optimized solution for microbial control at earthen archaeological sites. The antibacterial agent provided by this invention offers advantages in terms of safety, durability, and stability. In practical applications, the combined antibacterial agent can be extended to similar environments such as museum storage rooms or archaeological sites, demonstrating a broad industry demonstration effect.
[0082] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely preferred examples and are not intended to limit the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of the present invention is defined by the appended claims and their equivalents.
Claims
1. A plant-based antibacterial agent for the prevention and control of microorganisms in earthen archaeological sites, characterized in that, Including citral, citronellol, and geraniol.
2. The plant-based antibacterial agent for microbial control of earthen sites according to claim 1, characterized in that, The mass ratio of citral, citronellol, and geraniol is 6-8:3-5:1-2.
3. The plant-based antibacterial agent for microbial control of earthen sites according to claim 1, characterized in that, The method for preparing the antibacterial agent includes the following steps: (1) Preparation of microcapsule wall material solution: β-cyclodextrin and gum arabic are added to deionized water and stirred at 60~70℃ until the wall material is completely dissolved. The mass ratio of β-cyclodextrin, gum arabic and deionized water is 3:1:
20. (2) Preparation of core material solution: Citral, citronellol and geraniol are mixed evenly to obtain a mixed solution; (3) Microcapsule encapsulation: Under stirring conditions, the mixture was slowly added dropwise to the wall material solution. After the addition was completed, stirring was continued for 40 minutes to form a stable emulsion. (4) Spray drying to obtain microcapsule powder; (5) Formulation: The microcapsule powder is uniformly dispersed in deionized water to obtain the product.
4. The plant-based antibacterial agent for microbial control of earthen sites according to claim 1, characterized in that, The method for preparing the antibacterial agent includes the following steps: (1) Preparation of aqueous phase: Nano silica and Tween-80 are uniformly dispersed or dissolved in deionized water to obtain a stable aqueous phase; wherein, the mass ratio of nano silica, Tween-80 and deionized water is 3:1:83; (2) Preparation of oil phase: Citral, citronellol and geraniol are mixed evenly to obtain a homogeneous oil phase; (3) Emulsion preparation: Under stirring conditions, the oil phase is slowly added dropwise to the aqueous phase. After the addition is complete, a high-speed shearing machine is used to shear at high speed to form a preliminary emulsion. The rotation speed of the high-speed shearing is 10,000-20,000 r / min, and the shearing time is 10-15 min. (4) Emulsion stabilization: Adjust the pH of the system to 5.8-6.2 and defoam to obtain a stable Pickering emulsion.
5. The method for screening plant-based antibacterial agents for microbial control of earthen sites according to any one of claims 1-4, characterized in that, Includes the following steps: The S1 microbial disease identification steps include sample collection and preservation, microbial isolation and purification, and DNA extraction and molecular identification. S2 antibacterial material screening and efficacy evaluation steps include the initial screening of antibacterial materials, determination of key efficacy indicators, and identification of the optimal antibacterial material. The durability assessment steps for the S3 optimal antimicrobial agent include a simulated time-limited testing step; The persistence evaluation steps for the S3 optimal antibacterial agent also include constructing a simulation system and setting up five optimal antibacterial agent solutions with mass fractions of 50%, 25%, 12.5%, 6%, and 3% in the simulation system; spreading the prepared standard bacterial suspension on culture medium plates, uniformly spraying the corresponding concentration of the optimal antibacterial agent solution, and placing them in the corresponding glass covers; incubating at room temperature; and determining the optimal antibacterial concentration based on whether and how the colonies grow on each plate.
6. The method for screening antibacterial plant active substances for microbial control of earthen sites according to claim 5, characterized in that: The initial screening of antibacterial agents includes preparing solutions of five antibacterial agents: geraniol, citronellol, citronellol, linalool, and citral; preparing BPA solid medium; inoculating the purified bacterial strains into LB liquid medium; shaking and culturing until the logarithmic growth phase; adjusting the bacterial concentration to the standard range with PBS buffer; evenly spreading 0.5 mL of standard bacterial suspension onto BPA plates; immersing heat-sterilized filter paper discs into different antibacterial agent solutions; drying them; and attaching them to the center of the plates with bacterial suspensions. The plates are then incubated at 27°C for 2-3 days, after which the diameter of the inhibition zone is measured, and the antibacterial activity is evaluated by comparing the size of the inhibition zones.
7. The method for screening antibacterial plant active substances for microbial control of earthen sites according to claim 6, characterized in that: The key performance indicators are MIC and MBC.
8. The method for screening antibacterial plant active substances for microbial control of earthen sites according to claim 5, characterized in that: The simulated time-effectiveness test includes determining the failure time of the antibacterial effect of the optimal antibacterial material at different concentrations based on the observation results.