Application of soybean GmPOT coding gene in resisting soybean mosaic virus disease

Abstract

The invention discloses an application of a soybean GmPOT coding gene in resisting soybean mosaic virus diseases. The invention relates to an application of a soybean oligopeptide transporter gene GmPOT as shown in SEQ ID NO.1 in genetic engineering modification of soybean mosaic virus resistance. The over-expression of the gene can significantly improve the resistance of soybeans to soybean mosaic virus diseases. The soybean oligopeptide transporter gene GmPOT disclosed by the invention can be transformed into soybeans through genetic engineering, and the resistance of the soybeans to soybean mosaic virus diseases is finally regulated and controlled.

Description

TECHNICAL FIELD

[0001] The application relates to application of a soybean GmPOT coding gene in resistance to soybean mosaic virus, belongs to the field of genetic engineering, and particularly relates to increasing resistance to soybean mosaic virus by overexpressing a soybean GmPOT in soybeans. BACKGROUND

[0002] Soybean is an important grain and oil crop, and provides high-quality vegetable oil and protein for humans and animals. Soybean is harmed by various diseases and pests during the whole growth period, which seriously affects the yield and quality of soybean. Among them, soybean mosaic virus disease occurs in all soybean production areas in the world, and is caused by soybean mosaic virus (SMV). The leaves of soybeans infected with SMV show symptoms such as yellow mottling, leaf curling, malformation, wrinkling, reduced plant height, reduced branching, growth retardation, brown spots on seeds, pod malformation, and reduced pod number per plant. The resistance of soybean to SMV is divided into resistance to infection and resistance to expansion. Resistance to infection refers to that the pathogen cannot infect the host, and belongs to quality resistance or vertical resistance, which is an extreme resistance. If a single resistant material with this type of resistance is planted for a long time, there is a risk of losing resistance. The pathogen physiological race will produce new variations under high selective pressure, overcome the resistance of the resistant material, and the original resistant material becomes a susceptible material. Resistance to expansion refers to that the pathogen can successfully infect the host and establish a parasitic relationship, but the host can produce a defense response to the pathogen, secrete antitoxin, or inhibit the replication and spread of the pathogen, thereby reducing the reproduction of the pathogen and reducing the damage, which belongs to quantitative resistance or horizontal resistance. A variety with quantitative resistance will not cause selective pressure to the pathogen, and is not prone to losing resistance. In the case of a large outbreak of disease, the variety can still achieve good yield. At present, cultivating soybeans resistant to SMV is the most economical and effective measure to control SMV, and it is crucial to find disease-resistant genes related to the two resistance mechanisms to improve the resistance of soybeans to SMV and cultivate disease-resistant varieties.

[0003] In the early stage, by analyzing the soybean transcriptome induced by SMV, it is found that GmPOT strongly responds to the induction of SMV SC7 strain. It has not been reported whether the GmPOT coding an oligopeptide transporter protein is resistant to soybean mosaic virus disease. SUMMARY

[0004] The purpose of the application is to disclose the application of the SMV-resistant gene engineering of the soybean oligopeptide transporter protein gene GmPOT. The gene can be introduced into soybeans as a target gene to regulate the resistance of soybeans to SMV.

[0005] The purpose of the application can be achieved by the following technical solutions.

[0006] The nucleotide sequence of the soybean oligopeptide transporter protein coding gene GmPOT is shown as SEQ ID NO. 1, and the amino acid sequence is shown as SEQ ID NO. 2.

[0007] The application preferably reduces the accumulation of SMV in soybeans by overexpressing GmPOT in soybeans.

[0008] When using GmPOT to construct a plant overexpression vector, any enhanced promoter or inducible promoter can be added before the transcription initiation nucleotide. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding a selective marker gene (GUS gene, luciferase gene, etc.) in plants. From the safety point of view of transgenic plants, no selective marker gene can be added, and the transformed plants can be screened by stress.

[0009] The soybean oligopeptide transporter protein coding gene GmPOT of the present application can reduce the content of SMV in soybeans by overexpressing the gene after transforming soybeans by genetic engineering.

[0010] The plant overexpression vector carrying the GmPOT of the present application can be used to transform plant cells or tissues by using Ti plasmid, Ri plasmid, plant virus vector, DNA direct transformation, microinjection, electroporation, Agrobacterium-mediated, etc. Conventional biological methods, and the transformed plant tissues are cultivated into plants.

[0011] The soybean oligopeptide transporter protein gene GmPOT can be used in the construction of soybean varieties resistant to SMV.

[0012] The vector overexpressing the soybean GmPOT gene can be used to improve the resistance of soybeans to soybean mosaic virus disease.

[0013] The introduction of the vector overexpressing the soybean GmPOT gene into soybeans can reduce the accumulation of SMV in soybeans.

[0014] Advantages:

[0015] The soybean GmPOT is a gene encoding oligopeptide transporter protein, and we found that the GmPOT gene responds to the induction of SMV in soybeans, and the expression amount is significantly increased in overexpression transgenic soybeans, and the content of SMV is reduced. Therefore, GmPOT can be used for breeding soybean varieties resistant to SMV. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 GmPOT gene responds to the induction of soybean mosaic virus SC7. NJAU_C015: resistant material, Nannong 1138-2: susceptible material. **** represents significant at 0.0001 level, ns represents not significant.

[0017] Figure 2 Detection results of GmPOT overexpression transgenic soybean by EPSPS test strip. A. Detection results of GmPOT overexpression transgenic soybean line OE-5, B. Detection results of GmPOT overexpression transgenic soybean line OE-11. The first on the left of two figures is control Jack, and the rest are GmPOT overexpression transgenic soybean.

[0018] Figure 3 Relative expression of GmPOT gene in overexpression transgenic soybean. Jack is wild type, OE-5 and OE-11 represent two GmPOT overexpression transgenic soybean lines, three biological mean ± standard error (SE), **** represents significant at 0.0001 level.

[0019] Figure 4 Pictures of GmPOT overexpression transgenic soybean inoculated with SMV-SC7 strain after 21 days. Mock control is only smeared with 0.01 mol / l phosphate buffer, SMV is inoculated with SMV SC7 strain virus, leaf white Bar = 2 cm, pot white Bar = 5 cm.

[0020] Figure 5 SMV virus CP protein gene expression determination of GmPOT overexpression transgenic soybean. Jack is wild type, OE-5 and OE-11 represent two GmPOT overexpression transgenic soybean lines. qRT-PCR detects the expression of SMV virus CP gene. Three biological mean ± standard error (SE), *** represents significant at 0.001 level. DETAILED DESCRIPTION

[0021] The application will be further described below in conjunction with the drawings and examples.

[0022] The methods used in the following examples are conventional methods unless otherwise specified.

[0023] Example 1 GmPOT gene response to induction of soybean mosaic virus SC7 strain

[0024] Soybean plants Nanong 1138-2 and NJAU_C015 were inoculated with SC7 strain of soybean mosaic virus at the true leaf stage. The soybean leaf tissues at 0, 2, 8, and 24 hours after inoculation were collected, ground with a mortar, added to a 1.5 mL EP tube containing lysis solution, and fully oscillated before being transferred to a 1.5 mL EP tube. Total RNA was extracted (Total RNA Kit, Tiangen, Beijing, China). The quality of the total RNA was identified by formaldehyde denaturation gel electrophoresis, and the RNA content was determined by spectrophotometer. Tubulin, a constitutive expression gene in soybean, was used as an internal reference. The primer sequences were F: 5'-GGAGTTCACAGAGGCAGAG-3' and R: 5'-CACTTACGCATCACATAGCA-3'. The obtained total RNA was used as a template for reverse transcription according to the instructions of the reverse transcription kit (TaKaRa Primer Script™ RT reagent kit, Japan) provided by Japan TaKaRa Company. After obtaining the first strand of cDNA, a real-time RT-PCR reaction was performed to detect the expression level of GmPOT gene at different time points after inoculation in the two materials. The primer sequences were F: CCACCAAACAACTCCCCTGA and R: ATGCTGAACCATCCGAGGC. The results showed that GmPOT gene in the two materials responded strongly to the treatment of SC7 strain of soybean mosaic virus Figure 1 ).

[0025] Example 2 Genetic engineering application of GmPOT gene

[0026] 1) Cloning of soybean GmPOT

[0027] The mRNA sequence of Glyma.15G017000 (GmPOT) gene in the soybean reference genome Williams82 in the SoyBase database was used as a template to design specific primers. The primer sequences for amplifying the gene were F: 5'-ATGGACAAGGAAGTGGAGCT-3' and R: 5'-TCACCTAGTTAACTCTTCTT-3'. The leaf cDNA of Soybean Ke Feng No. 1 was used as a template for PCR amplification. The total RNA extraction and reverse transcription of the first strand of cDNA were the same as in Example 1. The PCR program was as follows: 95°C pre-denaturation for 30 seconds, 95°C denaturation for 10 seconds, 60°C annealing for 20 seconds, 72°C extension for 30 seconds, a total of 35 cycles, and finally 72°C for 5 minutes. The PCR product was cloned into the PUC19-T vector, and after sequencing, the CDS sequence of the soybean GmPOT gene with a length of 1851 bp was obtained, wherein the coding region sequence is SEQ ID NO. 1, and the amino acid sequence is SEQ ID NO. 2.

[0028] 2) Construction of plant expression vectors

[0029] The GmPOT gene sequence was amplified from the PUC19-T recombinant vector using PCR. The primers were F: 5'-ATGGACAAGGAAGTGGAGCT-3' and R: 5'-TCACCTAGTTAACTCTTCTT-3'. GsIFS2 was ligated into the plant expression vector D60005 (Dabeinong Group) using a non-ligase-dependent one-step cloning kit (ClonExpress® Entry One Step Cloning Kit) to obtain a plant overexpression recombinant vector containing the GmPOT gene, which also included the marker gene EPSPS. The plant transformation vector D60005 contains a strong 2×35S promoter, which strongly initiates the expression of the target gene GmPOT in the recipient. The vector was transformed into Agrobacterium tumefaciens strain EHA105 using a freeze-thaw method, and soybeans were transformed using the soybean cotyledon node transformation method.

[0030] 3) Phenotypic identification

[0031] Two GmPOT overexpressing transgenic soybean lines were obtained and named OE-5 and OE-11. These GmPOT-overexpressing transgenic soybeans were grown in a constant temperature and light incubator. After 7 days, leaves were harvested for EPSPS test strip detection and GmPOT gene expression level assay. The EPSPS test strip results showed that the GmPOT gene had been successfully inserted into the transgenic soybean. Figure 2 Total RNA extraction, reverse transcription, and quantitative real-time PCR were performed as in Case 1. Changes in GmPOT gene expression levels in transgenic soybeans were detected. Figure 3 As can be seen, the expression level of GmPOT in overexpressed transgenic soybeans is significantly higher than that in wild-type (JACK).

[0032] After the first pair of true leaves unfolded, wild-type Jack plants and overexpression lines (OE-5 and OE-11) were inoculated with SMV-SC7 virus. Disease development was observed 21 days after inoculation, and leaf samples were taken to detect the expression level of the viral CP gene. Wild-type Jack plants showed significant leaf wrinkling, while overexpression lines showed slight leaf wrinkling. Figure 4 Analysis of viral CP gene expression levels revealed that the expression levels of the SMV-CP gene in both overexpression lines were significantly lower than those in the wild type. Figure 5 The above results indicate that overexpression of the GmPOT gene reduces the accumulation of soybean mosaic virus and enhances soybean resistance to SMV-SC7. The primer sequences for the CP gene are F: cagatgggcgtggttatga and R: acaatgggtttcagcggata.

Claims

1. A soybean oligopeptide transporter gene GmPOT application in improving the resistance of soybean to SMV, the nucleotide sequence of the soybean oligopeptide transporter gene is SEQ ID NO.

1. GmPOT application in improving the resistance of soybean to SMV, the nucleotide sequence of the soybean oligopeptide transporter gene is SEQ ID NO.

1.

2. Use according to claim 1, characterized in that, Overexpression of the soybean oligopeptide transporter gene in soybean GmPOT , reduce the content of SMV in soybean, and enhance the resistance of soybean material to SMV.

3. The soybean oligopeptide transporter gene as set forth in claim 1 GmPOT In the construction of soybean varieties resistant to SMV.

4. A recombinant expression vector of the gene overexpressing the soybean oligopeptide transporter gene as claimed in claim 1 GmPOT application of the recombinant expression vector of the gene in improving the resistance of soybean to SMV.

5. A recombinant expression vector of the gene overexpressing the soybean oligopeptide transporter gene as claimed in claim 1 GmPOT application of the recombinant expression vector of the gene in constructing soybean varieties resistant to SMV.

Images