Application of ACLY gene medicine in preparation of medicine for treating and preventing cardiomyopathy

By developing a recombinant adeno-associated virus (AAV9-cTnt-ACLY), which specifically expresses the ACLY gene in cardiomyocytes and targets and regulates acetyl-CoA metabolism, the shortcomings of existing gene therapy strategies are overcome, significantly improving cardiac function and making it suitable for the treatment of cardiomyopathy.

CN121695299APending Publication Date: 2026-03-20ANHUI PROVINCIAL HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202512037104.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-31
Publication Date
2026-03-20

AI Technical Summary

Technical Problem

Existing gene therapy strategies based on AAV9 have shortcomings in terms of cardiomyocyte-specific expression efficiency, long-term in vivo safety, and precise regulation of complex metabolic pathways. Furthermore, traditional views suggest that ACLY may have a negative impact on cardiac metabolism, and there is no therapeutic approach that intervenes in mitochondrial acetyl-CoA metabolism by targeting and regulating ACLY expression.

Method used

To develop an ACLY gene drug targeting mitochondria, a recombinant adeno-associated virus (AAV9-cTnt-ACLY) was used to specifically express the ACLY gene in cardiomyocytes. By targeting and regulating ACLY expression, mitochondrial protein acetylation and ROS production were reduced, thus preparing a drug for treating cardiomyopathy.

Benefits of technology

It significantly improves cardiac function in mice, inhibits mitochondrial protein acetylation and ROS production in cardiomyocytes, and is used to prevent and treat cardiac dysfunction caused by isoproterenol or thoracic aortic coarctation. Its efficacy is comparable to that of standard first-line drugs, with no obvious side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121695299A_ABST
    Figure CN121695299A_ABST
Patent Text Reader

Abstract

The invention provides application of an ACLY gene medicine in preparation of a medicine for treating and preventing cardiomyopathy. The sequence of the ACLY gene is SEQ ID NO.1, and the cardiomyopathy comprises cardiac dysfunction caused by isoprenaline and thoracic aorta constriction. A cardiomyopathy drug AAV9-cTnT-ACLY taking ACLY in mitochondria as a drug target is developed by researching the relationship between ACLY and the occurrence mechanism of cardiomyopathy, the drug is based on an AAV9 adeno-associated virus vector, an ACLY gene segment is inserted into the vector, and finally animal experiments are performed to verify the effect of the drug. It is found that the high-expression mitochondrial targeting ACLY can significantly improve the expression and activity of ACLY in myocardial cells, inhibit mitochondrial protein acetylation and significantly improve the heart function of mice, and has very high clinical value.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of biological medicine, in particular to application of an ACLY gene drug in preparation of a drug for treating and preventing cardiomyopathy. BACKGROUND

[0002] Heart failure (HF) is a major disease with high morbidity and mortality worldwide. Its pathological mechanism is complex, involving myocardial cell metabolic disorder, oxidative stress, mitochondrial dysfunction and pathological remodeling. Although the current clinical application of first-line drugs such as beta blockers, angiotensin receptor-angiotensin enzyme inhibitors and SGLT2 inhibitors can alleviate the clinical symptoms of patients to a certain extent, the long-term efficacy is limited and is accompanied by obvious side effects, and it cannot fundamentally reverse the progression of myocardial injury. Therefore, there is an urgent need to develop new targeted treatment strategies for the core pathological mechanism of heart failure.

[0003] In recent years, the role of post-translational modification such as acetylation in heart disease has attracted much attention. Acetylation is involved in cardiac remodeling by regulating mitochondrial function, oxidative stress and energy metabolism. Excessive acetylation of mitochondrial proteins can inhibit the activity of antioxidant enzymes such as superoxide dismutase, leading to accumulation of reactive oxygen species, and further exacerbating myocardial cell injury and fibrosis. Acetyl-CoA, as a key substrate for acetylation, is significantly increased in the heart of heart failure patients. Studies have found that non-enzymatic acetylation of acetyl-CoA in mitochondria may be an important source of driving pathological protein acetylation, which provides a clear direction for targeted therapy of heart failure.

[0004] Among them, ATP-citrate lyase (ACLY) is a key enzyme that catalyzes the cleavage of citrate into acetyl-CoA and oxaloacetate. For a long time, it has been considered as a regulatory target of liver lipid metabolism. Lipid-lowering drug Bempedoic Acid reduces cholesterol synthesis by inhibiting liver ACLY, but its effect on the heart has not been fully studied. The traditional view is that ACLY promotes lipid synthesis by generating acetyl-CoA, which may have a negative impact on cardiac metabolism, and its specific molecular mechanism in myocardial injury still needs to be further analyzed.

[0005] In the field of gene therapy, adeno-associated virus vectors (such as AAV9) are considered as potential tools for gene delivery of heart diseases due to their natural high heart tropism. However, existing AAV9-based gene therapy strategies still have obvious deficiencies in myocardial cell-specific expression efficiency, long-term in vivo safety and precise regulation of complex metabolic pathways. Meanwhile, the feasibility and treatment effect of ACLY gene fragment in treating cardiomyopathy have not been studied, and the treatment idea of targeting and regulating ACLY expression to intervene in mitochondrial acetyl-CoA metabolism, inhibit pathological protein acetylation and ROS production has not been experimentally verified. Summary of the Invention

[0006] This invention investigates the relationship between ACLY and the pathogenesis of cardiomyopathy, and further conducts molecular experiments to develop a cardiomyopathy drug targeting mitochondria. Animal experiments were conducted to verify its efficacy, and it was found that high expression of mitochondrial-targeted ACLY significantly improves cardiac function in mice.

[0007] The technical solution is as follows: On the one hand, the application of an ACLY gene drug in the preparation of drugs for the treatment and prevention of cardiomyopathy is characterized in that the sequence of the ACLY gene is shown in SEQ ID NO.1, and the ACLY gene drug is a recombinant adeno-associated virus named AAV9-cTnt-ACLY.

[0008] Furthermore, AAV9-cTnt-ACLY contains the ACLY gene or a protein encoded by the ACLY gene.

[0009] Furthermore, in the preparation of AAV9-cTnt-ACLY, PCR amplification primers were designed based on the ACLY gene sequence, namely AAV-m-ACLY-F and AAV-m-ACLY-R.

[0010] Furthermore, the nucleotide sequence of AAV-m-ACLY-F is SEQ ID NO: 2, and the nucleotide sequence of AAV-m-ACLY-R is SEQ ID NO: 3.

[0011] Furthermore, the vector for AAV9-cTnt-ACLY is adeno-associated virus AAV9, and the promoter is cTnt.

[0012] Furthermore, the viral titer of AAV9-cTnt-ACLY is 7-8 × 10⁻⁸. 13 vg / mL.

[0013] Furthermore, AAV9-cTnt-ACLY targets ACLY in the mitochondria of cardiomyocytes, specifically expressing ACLY in cardiomyocytes, thereby reducing mitochondrial protein acetylation and ROS production, and can be used to prepare drugs for treating cardiomyopathy.

[0014] Furthermore, the preparation of drugs for the treatment and prevention of cardiomyopathy includes the preparation of drugs for the treatment of isoproterenol and / or drugs for the treatment of cardiac dysfunction caused by thoracic aortic coarctation.

[0015] Furthermore, medications for the treatment and prevention of cardiomyopathy include pharmaceutically acceptable carriers.

[0016] Furthermore, the drug also contains pharmaceutically acceptable excipients, and the dosage forms include tablets, capsules, granules, pills, gels, suppositories, ointments, emulsions, mixtures, suspensions, injections, and solutions.

[0017] Furthermore, the routes of drug administration include oral administration, injection administration, inhalation administration, topical administration, sublingual administration, and rectal administration.

[0018] The beneficial effects of this invention are as follows: This invention uses myocardial-specific ACLY knockout (cKO) mice to experimentally verify the relationship between ACLY and cardiac function. Experiments show that the AAV9-cTnt-ACLY provided by this invention can enhance ACLY protein expression in cardiomyocytes, target cardiomyocyte mitochondria, and promote the synthesis of citrate from acetyl-CoA through a feedback mechanism, thereby reducing acetyl-CoA levels and inhibiting mitochondrial protein acetylation and ROS production in cardiomyocytes. It can be used to prevent and treat cardiac dysfunction caused by isoproterenol or thoracic aortic coarctation, and can be used to treat heart failure, with effects comparable to standard first-line drug treatment. Simultaneously, it can alter cardiac ACLY protein or activity levels, improving cardiac function, and has high clinical value for the treatment of heart diseases. Attached Figure Description

[0019] Figure 1 Comparative figures of experimental data on myocardial function and structural changes in myocardial mice with myocardial specific ACLY knockout (cKO) mice; Western blot of ACLY expression (A); Comparative figure of quantitative analysis of ACLY expression (B); Echocardiography (C); Comparative figures of left ventricular ejection fraction (LVEF) analysis (D) and fractional shortening (FS) analysis (E); Comparative figures of left ventricular end-diastolic diameter (LVIDs) analysis (F); Comparative figures of left ventricular end-systolic volume (LVESV) analysis (G); Comparative figures of wheat lectin staining (H); Comparative figures of Masson staining (H); Comparative figures of Western blot of atrial natriuretic peptide (ANP) expression (K) and comparative figure of quantitative analysis of atrial natriuretic peptide (ANP) expression (L); Figure 2 Comparison of data from validation experiments on ACLY expression in the liver and kidneys of myocardial-specific ACLY knockout (cKO) mice; Western blot comparison of ACLY expression in the liver (A); Comparison of quantitative analysis of ACLY expression in the liver (B); Comparison of Western blot comparison of ACLY expression in the kidneys (C); Comparison of quantitative analysis of ACLY expression in the kidneys (D). Figure 3Comparison of experimental data for each group of mice; experimental design diagram (A); echocardiography (B); left ventricular ejection fraction (LVEF) analysis comparison diagram (C); left ventricular fraction of death (FS) analysis comparison diagram (D); left ventricular end-systolic diameter (LVIDs) analysis comparison diagram (E); wheat germ lectin (WGA) staining and Masson staining diagram of cardiomyocytes (F); quantitative analysis comparison diagram of cardiomyocyte cross-sectional area (G); quantitative analysis comparison diagram of cardiomyocyte collagen content (H); Western blot comparison diagram of ACLY and atrial natriuretic peptide (ANP) expression in cardiomyocytes (I); comparison diagram of ACLY enzyme activity in cardiomyocytes (L); comparison diagram of exercise endurance in mice (M). Figure 4 Experimental flowcharts for the control group, ISO group, ACLY group, and S group (A); echocardiographic images of cardiac tissues for each group (B); bar charts comparing cardiac function and structural parameters for each group (A, B, and S); left ventricular ejection fraction (LVEF) comparison (C), left ventricular fractional shortening (FS) comparison (D), E / e' comparison (E), E / A comparison (F), left ventricular end-systolic volume (LVESV) comparison (G), and left ventricular end-systolic diameter (LVIDs) comparison (H); histological staining images of cardiac tissues from each group (I); comparison charts of WGA quantitative analysis of cardiac tissues from each group (J), Masson staining quantitative analysis of cardiac tissues (K), and exercise endurance (L). Figure 5 The images show the protein expression and activity of ACLY in different experimental groups. The comparison of ACLY protein expression by Western blot in the control group, ISO group and ACLY group is shown in Figure (A). The comparison of quantitative analysis of ACLY protein expression is shown in Figure (B) and ACLY activity is shown in Figure (C). Figure 6 The diagram shows the omics analysis and ROS level of ACLY acetylation, the statistical analysis of the number of differentially expressed proteins in the control group, ISO group and ACLY group (A) and the volcano plot (B), the subcellular localization analysis of differentially expressed proteins (C), and the KEGG pathway enrichment analysis of each group (D). Figure 7 Comparison of ROS fluorescence (A) and average fluorescence intensity (C) among the control group, ISO group, and ACLY group; comparison of ROS detection, ROS fluorescence (B), average fluorescence intensity (D), and ROS generation rate (G) among the control group, PE group, and ACLY group. Figure 8Figure 1 shows the experimental results of the molecular mechanism related to SOD2; Figure 2 shows the comparison of changes in SOD2 K122 acetylation in the control group, ISO group and ACLY group (A); Figure 3 shows the comparison of ACLY protein expression in the Ad-ACLY group and Ad-EV group (B) and quantitative analysis (C); Figure 4 shows the comparison of SOD activity (D); Figure 5 shows the comparison of SOD activity in the control group, PE group and ACLY group (E); Figure 6 shows the comparison of Western blots in the control group, ISO group and ACLY group (F); Figure 7 shows the comparison of quantitative analysis of SOD2-K122 expression (G) and ANP expression (H); Figure 8 shows the comparison of Western blots in the control group, PE group and ACLY group (I); Figure 9 shows the comparison of quantitative analysis of SOD2-K122 expression (J) and ANP expression (K). Figure 9 The images show fluorescence staining under different experimental treatments in the control group, ISO group, and ACLY group (A) and a comparison of average fluorescence intensity (B); and fluorescence staining under different experimental treatments in the control group, PE group, and ACLY group (C) and a comparison of average fluorescence intensity (D). Figure 10 Figure 1 shows the experimental results of the effect of ACLY on SOD2; Figure 2 shows the comparison of SOD activity between the control group, ISO group and ACLY group (A); Figure 3 shows the comparison of SOD activity between the control group, PE group and ACLY group (B); Figure 4 shows the comparison of SOD activity between the sham operation group (Sham group), TAC group and ACLY group (C); Figure 5 shows the comparison of protein expression between the sham operation group (Sham group), TAC group and ACLY group (D); Figure 6 shows the comparison of quantitative analysis of SOD2-K122 expression between the sham operation group (Sham group), TAC group and ACLY group (E). Figure 11 Figure 1 shows the experimental results of the effects of ACLY on mitochondrial metabolism, protein acetylation, and enzyme activity; acetylation expression, mitochondrial acetylation expression, lactate content, and citrate synthase activity; pyruvate content, lactate content, and citrate synthase activity in cardiomyocytes of the sham-operated group (Sham group), TAC group, and ACLY group. Figure 2 shows a comparison of mitochondrial acetyl-CoA levels in cardiomyocytes of the control group, ISO group, and ACLY group (A); Figure 3 shows a comparison of mitochondrial acetyl-CoA levels in the sham-operated group (Sham group), TAC group, and ACLY group (B). Comparison of Western blot diagrams (C) and quantitative analysis diagrams (D) of protein acetyl groups in the control group, ISO group, and ACLY group; comparison of Western blot diagrams (E) and quantitative analysis diagrams (F) of mitochondrial components in the control group, ISO group, and ACLY group; quantitative analysis diagrams (G) of lactate in the sham operation group (Sham group), TAC group, and ACLY group, (H) of pyruvate and (I) of citrate synthase; quantitative analysis diagrams (J) of lactate in the control group, ISO group, and ACLY group and (K) of citrate synthase. Detailed Implementation

[0020] The technical solution of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0021] Laboratory animal sources In the gene knockout mouse experiment, the ACLY gene-flox heterozygous mice that can be conditionally knocked out and the heart-specific Ckmm-Cre mice were both obtained from Shanghai Southern Biotechnology Co., Ltd.

[0022] Other laboratory animals were obtained from Jiangsu Jicui Yaokang Biotechnology Co., Ltd., strain: C57BL / 6JGpt, genotype: (C57BL / 6JGpt)wt / wt, male mice 8 weeks old, production license number: SCXK (Su) 2023-0009.

[0023] All mice were housed under specific pathogen-free (SPF) conditions with free access to food and water. This study was approved by the Ethics Committee of the First Affiliated Hospital of the University of Science and Technology of China (Program Nos.: 2023-N(A)-0123 and 2024-N(A)-101).

[0024] Cell line source Rat H9c2 cells were purchased from Procell and cultured in complete medium (DMEM medium + 10% serum + 1% penicillin-streptomycin) at 37°C in a 5% CO2 cell culture incubator. The final concentration of isoproterenol for cell stimulation was 10 µmol / L for 24 h, and the final concentration of phenylephrine (PE) for cell stimulation was 100 µmol / L for 24 h.

[0025] Construction of adeno-associated virus AAV9-cTnt-ACLY: The sequence of the ACLY gene is shown in SEQ ID NO: 1: Adeno-associated virus (AAV)-MARCH2 was constructed by Shandong Weizhen Biotechnology Co., Ltd. PCR amplification primers were designed based on the ACLY gene sequence, and the primer sequences are shown below: The nucleotide sequence of AAV-m-ACLY-F is GCGATCGCCACCATGTCAGCCAAGGCAATTTC (SEQ ID NO: 2); The nucleotide sequence of AAV-m-ACLY-R is ACGCGTTTACATGCTCATGTGTTCTGG (SEQ ID NO: 3); The source of AAV9-MARCH2 is not strictly required. Using conventional plasmid construction methods, the fragment expressing the ACLY gene was inserted into the adeno-associated virus vector to obtain recombinant adeno-associated virus AAV9-cTnT-ACLY, with a viral titer of 7.97 × 10⁻⁶. 13 vg / mL.

[0026] In subsequent experiments, mice injected with AAV9-cTnt-ACLY received a fixed total injection volume of 5 × 10⁻⁶ per mouse. 11 vg / mouse; Specific operating steps: Before injecting mice with AAV9-cTnt-ACLY, dilute 10μL of stock solution with sterile PBS to 100μL. It should be prepared and used immediately to avoid prolonged storage of the virus after dilution (especially at room temperature, which may affect its activity). After dilution, mix gently to avoid the formation of bubbles.

[0027] The experimental testing steps are as follows: Echocardiography: Mice were anesthetized using an isoflurane inhalation anesthesia machine and fixed in a supine position on an ECG plate with their tails facing the operator. An anesthesia mask was placed over the mice's mouth and nose, and their paws were taped to conductive adhesive-coated electrode pads, arranged in a "T" shape. Subsequently, hair was removed from the mice's chest area using depilatory cream, and coupling gel was applied before echocardiography. For M-mode echocardiography, the probe was positioned at the 2 o'clock position, with the angle between the probe and the horizontal plane being acute on the left and obtuse on the right, so that the mouse's papillary muscles were located at the 4 o'clock position in the ultrasound image, and the sampling line was placed at the largest point of the heart chamber. For diastolic function testing, the probe was positioned at the 3 o'clock position, with the angle between the probe and the horizontal plane being acute on the right and obtuse on the left, and the sampling frame was placed in the left ventricle, with the sampling point located at the mitral valve orifice. The opening and closing of the mitral valve reflects the heart's pumping process. The E-wave represents the velocity of blood flowing from the left atrium to the left ventricle after the mitral valve closes, while the A-wave represents the velocity of blood flowing out of the left ventricle. In tissue Doppler imaging, based on diastolic function testing, the sampling point is placed at the junction of the mitral valve annulus and the atrium, i.e., the area that continuously opens and closes, to detect the early diastolic myocardial motion velocity at the mitral valve annulus.

[0028] Exercise endurance testing: Before the experiment, mice underwent 10 minutes of acclimatization training on a treadmill with a 5° incline at a speed of 5 m / min for three consecutive days. On the day of the experiment, mice first warmed up on the treadmill at a speed of 5 m / min for 4 minutes, then increased the speed to 14 m / min and continued for 2 minutes, before increasing the speed to 16 m / min, and so on. The speed was increased by 2 m / min every 2 minutes until the mice reached exhaustion, and the maximum distance traveled was recorded. Exhaustion was defined as the mouse's inability to resume running 10 seconds after contact with the electrical stimulation grid. The electrical current was set to 0.4 mA, and the exhaustion range was set to 18 shocks per 10 seconds.

[0029] Wheat germ lectin staining: Mice were euthanized by cervical dislocation, and the thoracic cavity was opened. Cardiac arrest was induced by perfusion with 0.1 mol / L KCl solution. The mouse heart was then removed, washed with pre-cooled PBS solution, and transversely divided into three parts. The atrioventricular junction tissue was fixed in 4% paraformaldehyde solution, while the remaining parts were cryopreserved at -80°C. After fixation in 4% paraformaldehyde for 24 hours, the heart tissue was dehydrated, cleared, and paraffin-embedded. It was then placed in a mold and embedded in melted paraffin to form a paraffin block. The paraffin block was then sliced ​​into thin sections using a microtome, and the sections were attached to absorbent slides. The sections were then stained with wheat germ lectin (WGA) and the cell nuclei were stained with DAPI. After staining, the tissue was washed, covered with mounting medium, and then covered with a coverslip. Finally, images of the tissue sections were acquired using a fluorescence microscope.

[0030] Masson trichrome staining: After fixing the heart tissue for 24 hours, it was removed, dehydrated, cleared, and paraffin-impregnated. It was then placed in a mold and embedded in melted paraffin to form a wax block. Next, it was sectioned using a microtome, mounted on an absorbent glass slide, and stained with Masson's Trichrome Stain (Masson). At the same time, the cell nuclei were stained with DAPI stain. After washing, the tissue was covered with a mounting medium, covered with a coverslip, and finally the image was acquired using a microscope.

[0031] Protein immunoblotting: When extracting total protein from cells or tissues, first prepare a mixed lysis buffer of IP lysis buffer and PMSF at a volume ratio of 100:1. For H9c2 cells cultured in a six-well plate, discard the culture medium, wash with pre-cooled PBS, air dry, add 150µL of the mixed lysis buffer to each well, scrape cells from the bottom of the well with a cell scraper, and transfer the mixed lysis buffer containing cell debris to a centrifuge tube. For mouse tissue, cut tissue frozen at -80℃ and weigh it, place it in a centrifuge tube with steel balls, then add 10µL of the mixed lysis buffer for every 1mg of tissue, and grind it in a tissue homogenizer. After scraping / grinding, shake rapidly on ice for 30min, centrifuge at 12000rpm for 15min at 4℃, collect the supernatant, and add 5× protein loading buffer at a ratio of lysis buffer: loading buffer = 4:1, mix well by pipetting, and heat in a metal bath at 100℃ for 10min. Polyacrylamide gels were then prepared using a rapid gel mixing kit. Electrophoresis buffer and pre-cooled transfer buffer were prepared, followed by sample loading, electrophoresis (200V, 35min), and transfer to a PVDF membrane (300mA, 90min or 200mA, 75min). The membrane was blocked with rapid protein-free blocking buffer for 20min, washed with 1×PBST, and incubated overnight at 4°C with primary antibody (1:1000 dilution). The next day, the membrane was removed and incubated (10min / time) with the corresponding secondary antibody (1:10000 dilution) at room temperature for 1h. After incubation, the membrane was washed three times with 1×PBST. Finally, the membrane was placed in a developing apparatus, and 1:1 chemiluminescent solution was added for exposure and observation of protein expression.

[0032] ACLY activity assay: The ATP-citrate lyase activity assay kit (Solarbio, BC4245) was used. The ratio of V extraction buffer 1 to V extraction buffer 2 was 990:1. 10 µL / mg of mouse heart tissue was added to the extraction buffer to prepare tissue protein samples. The extraction method was the same as that for protein immunoblotting. After sample preparation, protein quantification was performed using the Bradford method. The Bradford protein quantification kit (Sangon Biotech, C503031) was used. First, a standard curve was prepared, and the protein sample was diluted 200 times and added to a 96-well plate. 20 µL of PBS was added to the blank wells. Then, 200 µL of Bradford reagent was added to all wells. The plates were incubated at 25 °C for 5 min, and the OD value at wavelength A595 was detected using a microplate reader. To detect ACLY activity, preheat the microplate reader to 37°C and the reagent bath to 37°C. Prepare 190µL of mixed reagent per well (prepare fresh for each use; 190µL = 152µL Reagent 1 + 4µL Reagent 2 + 20µL Reagent 3 + 4µL Reagent 4 + 1µL Reagent 5). Zero the 96-well plate with 200µL of distilled water. Add 10µL of distilled water to the blank wells and 10µL of sample to the sample wells. When adding samples, first add the mixed reagent to the 96-well plate, then add 10µL of sample before measurement. Immediately measure the absorbance at 340nm, repeating every 10s for a total of 20 minutes. Finally, calculate the ACLY activity (U / mgProt) = (5359*△A / CPr) / T, where T is the temperature in minutes, and △A > 0.01. Definition of unit: One unit of enzyme activity is defined as 1 nmol NADH consumed per minute per mg of protein in the reaction system.

[0033] 1. Cardiac cell-specific knockout of ACLY impairs cardiac function in mice By ACLY fl / fl Mice were crossed with Ckmm-Cre mice to generate cardiomyocyte-specific ACLY knockout (cKO) mice.

[0034] This study employed conditional gene knockout technology and homologous recombination principles to modify the ACLY gene by flanking it with a loxP site through homologous recombination in fertilized eggs. The specific procedure was as follows: First, Cas9 mRNA and gRNA were obtained via in vitro transcription. Then, an in-fusion cloning method was used to construct a homologous recombination vector containing a 3.0kb 5' homologous arm, a 0.8kb flotation region, and a 3.0kb 3' homologous arm. Next, the Cas9 mRNA, gRNA, and donor vector were microinjected into fertilized eggs of C57BL / 6J mice to obtain F0 generation mice. Positive F0 generation mice were identified by PCR amplification and sequencing, and then mated with C57BL / 6J mice to obtain positive F1 generation mice. Finally, mice with the ACLY gene flanked by a loxP site were obtained through hybridization of the F1 generation mice. flox / flox Hereinafter referred to as ACLY fl / fl) .

[0035] Then we will ACLY fl / fl Transgenic mice that specifically express Cre recombinase in cardiomyocytes (Ckmm-Cre, hereinafter referred to as Cre) + They are crossed to obtain F2 offspring. The expected genotype of these F2 offspring is ACLY. fl / + And Cre + Next, the F2 generation ACLY fl / + And Cre + Mice were crossbred to produce cardiomyocyte-specific ACLY gene knockout mice (ACLY). fl / + And Cre + (hereinafter referred to as cKO) and control mice (ACLY) fl / fl And Cre - By extracting tail samples from newborn mice and performing PCR identification, cardiomyocyte-specific ACLY gene knockout mice (cKO) and control mice (ACLY) were screened. fl / fl And Cre - ), ACLY fl / fl The primer sequences for mouse PCR identification are shown in Table 1, ACLY. fl / fl The mouse PCR identification reaction system is shown in Table 2. ACLY fl / fl The mouse PCR identification reaction procedure is shown in Table 3. Cre + The primer sequences for mouse PCR identification are shown in Table 4. + The mouse PCR identification reaction system is shown in Table 5, and the Cre+ mouse PCR identification reaction procedure is shown in Table 6. Table 1 ACLY fl / fl Mouse PCR identification primer sequence ; Table 2 ACLY fl / fl Mouse PCR identification reaction system ; Table 3 ACLY fl / fl Mouse PCR identification reaction procedure ; Table 4 Cre + Mouse PCR identification primer sequence ; Table 5 Cre + Mouse PCR identification reaction system ; Table 6 Cre + Mouse PCR identification reaction procedure .

[0036] ACLY expression was validated in myocardial-specific ACLY knockout (cKO) mice and (flox) control mice. Various cardiac function analyses, cardiomyocyte and fibrosis analyses, and validation of myocardial hypertrophy markers were performed. Experimental results are as follows: Figures 1-2 As shown, among these cKO mice, compared with control mice (ACLY) fl / fl Cre - In contrast, ACLY protein expression was significantly reduced in the heart, while no significant changes were observed in the liver and kidneys. Echocardiographic evaluation showed a significant decrease in left ventricular ejection fraction (LVEF) and fractional shortening (FS) in cKO mice. In addition, the left ventricular end-systolic diameter (LVIDs) was significantly increased, and the left ventricular posterior systolic wall (LVPWs) was reduced. Histological analysis using wheat germ agglutinin (WGA) and Masson trichrome staining showed that cardiomyocytes in cKO mice exhibited hypertrophy and significant fibrosis, as well as increased atrial natriuretic peptide (ANP) protein expression. Therefore, cardiomyocyte-specific knockout of ACLY leads to impaired cardiac function in mice.

[0037] 2. AAV9-cTnt-ACLY enhances cardiac function in mice after TAC. The purpose of this experiment was to investigate whether AAV9-cTnt-ACLY could improve cardiac dysfunction after transcatheter arterial surgery (TAC). Ten-week-old male C57BL / 6J mice were anesthetized using an isoflurane inhalation anesthesia machine. Hair was then removed from the chest, and the mice were fixed in a supine position with their heads facing the operator. After alcohol disinfection, the surgery was performed under bright light. First, a 10mm longitudinal skin incision was made at the axillary line, and the skin was dissected to expose the ribs. Next, the middle rib was transversely cut above the second rib, and the connective tissue was dissected with forceps to observe the location of the thymus. After locating the two white thymus glands, they were bluntly dissected from the middle with forceps to expose the aortic arch and the left and right common carotid artery branches between the two white thymus glands. A 4-0 suture was inserted around the aortic arch between the two common carotid artery branches. Then, a 26G constricting needle was inserted into the mouse's chest cavity and ligated to the aortic arch with suture. After ligation, the needle was withdrawn, creating a narrowed area. The thoracic cavity was then sutured, followed by suturing the mouse skin. A small amount of erythromycin ointment was applied to the suture wound, and the mouse was given an intramuscular injection of 100 μL of levofloxacin sodium chloride solution. After the surgery, the mouse was placed on an electric blanket to prevent hypothermia and awaited recovery. The sham group (mice in the sham surgery group) underwent the same procedures as the ligation group, except that the aortic arch was not ligated. At 4 or 8 weeks post-surgery, the ligation group mice were divided into the TAC group and the ACLY group. The ACLY group received a dose of 5 × 10⁻⁵ mg / L via tail vein injection. 11 Mice were injected with vg / mouse with AAV9-cTnT-ACLY. Mice in the Sham and TAC groups were injected with the same amount of AAV9-cTnT-GFP. Six weeks after injection, the cardiac function of mice in each group was assessed. After the experiment, the mice were euthanized by anesthesia, and heart and liver tissues were collected for various experiments.

[0038] Experimental results are as follows Figure 3 As shown, echocardiography revealed that TAC group mice had decreased ejection fraction (EF) and fractional shortening (FS), reduced left ventricular posterior wall thickness (LVPWs), and increased left ventricular internal diameter (LVIDs). After injection of ACLY, the pathological changes were significantly alleviated. Therefore, AAV9-cTnt-ACLY can alleviate TAC-induced cardiac dysfunction in mice.

[0039] 3. AAV9-cTnt-ACLY exerts a cardioprotective effect in mice with chronic β-adrenergic receptor activation. The objective of this experiment was to further investigate the effects of AAV9-cTnT-ACLY on cardiomyopathy. We induced cardiac dysfunction in mice by administering isoproterenol (ISO, 10 mg / kg / day for 4 weeks). Eight-week-old male C57BL / 6J mice were selected and subcutaneously injected with isoproterenol (ISO) 10 mg / kg / day, while the control group received an equal volume of saline. After 4 weeks, except for the control group, the remaining mice were randomly divided into the isoproterenol model group (ISO group), AAV9-cTnT-ACLY group (ACLY group), empagliflozin group (E group), sacubitril / valsartan group (S group), and metoprolol group (M group). After grouping, the ACLY group mice were injected with 5 × 10 mg / kg / day via the tail vein. 11 Mice in the E group received 20 mg / kg / day empagliflozin via gavage; mice in the S group received 60 mg / kg / day sacubitril / valsartan via gavage; and mice in the M group received 100 mg / kg / day metoprolol via gavage. All mice received the same volume of solvent. In addition, except for the control group, all other groups continued to receive 5 mg / kg / day ISO subcutaneously until the end of the experiment. After 6 weeks of treatment, cardiac function was assessed in each group. After the tests, the mice were euthanized under anesthesia, and cardiac tissue was collected for subsequent experimental analysis.

[0040] Drug preparation method (prepare immediately before use): (1) ISO (10mg / kg / day): 17.5mg isoproterenol powder was dissolved in 7mL of physiological saline, and 100µL was subcutaneously injected into 25g mice daily; (2) Empagliflozin (20mg / kg / day): First, dissolve 0.5g of CMC-Na powder in 100mL of double-pure water under high pressure and store at 4℃. Then, dissolve 10mg of empagliflozin in 2mL of CMC-Na and administer 100µL to 25g mice by gavage daily. (3) Sacubitril / valsartan (60mg / kg / day): 100mg / tablet, take 1 tablet of sacubitril / valsartan, grind it evenly, and then dissolve it in 6.7mL of physiological saline. Administer 100µL to 25g mice by gavage daily. (4) Metoprolol (100mg / kg / day): 25mg / tablet. Take 2 tablets of metoprolol, grind them evenly, and then add 2mL of physiological saline to dissolve them. 25g mice are given 100µL by gavage daily.

[0041] AAV9-cTnt-ACLY was administered intravenously, with empagliflozin, sacubitril, valsartan, and metoprolol serving as positive controls. After 6 weeks of treatment, various experiments were conducted, and the results were as follows: Figures 4-6 As shown, echocardiography revealed that ISO treatment in mice resulted in decreased ejection fraction (EF) and fractional shortening (FS), increased early mitral orifice velocity to early mitral annulus velocity ratio (E / e') and early to late mitral orifice velocity ratio (E / A), decreased left ventricular posterior wall thickness (LVPWs), increased left ventricular intraventricular diameter (LVIDs), enlarged cardiomyocytes, and significant fibrosis. This indicates that ISO treatment disrupted the systolic and diastolic functions of the mouse heart. AAV9-cTnt-ACLY, empagliflozin, sacubitril, valsartan, and metoprolol all significantly alleviated the effects of ISO-induced vasoconstriction. The pathological changes were observed. In addition, ISO-treated mice showed decreased exercise endurance. The above treatment significantly improved the pathological index. AAV9-cTnt-ACLY was comparable to three first-line drugs for heart failure in enhancing cardiac function. More importantly, empagliflozin, sacubitril, valsartan, and metoprolol had no significant effect on cardiac ACLY expression and enzyme activity. AAV9-cTnt-ACLY treatment increased ACLY protein expression and activity in cardiac tissue, suggesting that AAV9-cTnt-ACLY may provide benefits beyond existing heart failure drugs.

[0042] 1. Employing acetylated proteomics to reveal the cardioprotective mechanism of AAV9-cTnt-ACLY In vitro experimental procedures: Rat H9c2 cells were purchased from Procell and cultured in complete medium (DMEM medium + 10% serum + 1% penicillin-streptomycin) at 37℃ in a 5% CO2 cell culture incubator. The Ad-ACLY+ISO and ISO groups were stimulated with isoproterenol at a final concentration of 10 µmol / L for 24 h. The Ad-ACLY+PE and PE groups were stimulated with phenylephrine at a final concentration of 100 µmol / L for 24 h. The Ad-EV groups were stimulated with the control solvent. Ad-ACLY indicates that the ACLY protein in the cells has been overexpressed by adenovirus, and Ad-EV indicates that the cells have been treated with a control virus (empty vector). The specific experimental steps are as follows: First, adenovirus amplification experiments were performed using 293A cells. 5-10 µL of the viral stock solution was inoculated into 6 cm cell culture dishes. After 72 h, the cell status was observed. Some cells detached, while most cells remained adherent but showed morphological changes of becoming rounder and brighter. The cell suspension was then collected into a 15 mL centrifuge tube and centrifuged at 5000 rpm for 5 min. After discarding the supernatant, the cell pellet was resuspended in 100 µL of basal culture medium and transferred to a 1.5 mL centrifuge tube. The sample was frozen at -80°C for 30 min, followed by thawing at room temperature for 2 min. This freeze-thaw cycle was repeated three times. Finally, the sample was centrifuged at 10000 rpm for 2 min at 4°C, and the supernatant was collected and stored at -80°C for later use. For experimental use, the viral supernatant was added directly to the cell culture dish. Ad-ACLY was used for the overexpression group, and Ad-EV was used for the control group. The overexpression of the target protein could be detected after 24 h, and changes in the acetylation level of proteins in the cells were analyzed using acetylated proteomics technology.

[0043] The results are as follows Figures 7-8As shown, acetyl-CoA is an essential substrate for the acetylation of histone and non-histone proteins, and AAV9-cTnt-ACLY increases acetyl-CoA by enhancing cardiac ACLY expression and activity. The cardioprotective effect of AAV9-cTnt-ACLY may involve its regulation of protein acetylation. Acetylated proteomics analysis of mouse heart tissue showed that ISO treatment significantly altered acetylation levels, with 617 protein sites showing increased acetylation and 219 showing decreased acetylation compared to the control group. In contrast, AAV9-cTnt-ACLY treatment significantly increased acetylation at 222 protein sites and decreased acetylation at 720 sites compared to the ISO group. This suggests that ISO generally promotes protein acetylation, while AAV9-cTnt-ACLY tends to reduce it. The proteins with significantly altered acetylation in responses to ISO and AAV9-cTnt-ACLY were primarily located in the cytoplasm (including mitochondria). KEGG pathway analysis revealed that signaling pathways enriched by reduced acetylation sites after AAV9-cTnt-ACLY treatment included those associated with diabetic cardiomyopathy, reactive oxygen species (ROS), hypertrophic and dilated cardiomyopathy, oxidative phosphorylation, and muscle contraction. In vitro, ISO or PE stimulation increased ROS levels, which were inhibited by Ad-ACLY. Consistently, AAV9-cTnt-ACLY also suppressed the increase in ROS in mouse hearts after TAC.

[0044] 2. ACLY overexpression inhibits ROS levels by activating SOD2. Construction of aortic arch constriction (TAC) mouse model: Ten-week-old male C57BL / 6J mice were anesthetized using an isoflurane inhalation anesthesia machine. Hair was removed from the chest, and the mice were fixed in a supine position with their heads facing the operator. After alcohol disinfection, the surgery was performed under strong light. First, a 10mm longitudinal skin incision was made at the axillary line, and the skin was dissected to expose the ribs. Next, the middle rib was transversely cut above the second rib, and the connective tissue was dissected with forceps to observe the location of the thymus. After locating the two white thymus glands, they were bluntly dissected from the middle with forceps to expose the aortic arch and the left and right common carotid artery branches between the two white thymus glands. A 4-0 cotton suture was inserted around the aortic arch between the two common carotid artery branches. Then, a 26G constriction needle was inserted into the mouse's thoracic cavity and ligated to the aortic arch with cotton suture. After ligation, the needle was withdrawn, forming a constricted area. Afterwards, the thoracic cavity was sutured, followed by the mouse skin. A small amount of erythromycin ointment was applied to the suture wound, and the mouse was injected intramuscularly with 100 μL of levofloxacin sodium chloride solution. After the surgery, the mouse was placed on an electric blanket to prevent hypothermia, and the mouse was allowed to recover. The procedures performed on the sham-operated group (Sham group) were identical to those in the ligation group, except that the aortic arch was not ligated.

[0045] Eight weeks post-surgery, mice that underwent ligation were randomly divided into the TAC group and the ACLY group. The ACLY group received a dose of 5 × 10⁻⁶ via tail vein injection. 11 Mice were injected with vg / mouse with AAV9-cTnT-ACLY. Mice in the Sham and TAC groups were injected with the same amount of AAV9-cTnT-GFP. Six weeks after injection, the cardiac function of mice in each group was assessed. After the experiment, the mice were euthanized by anesthesia, and heart and liver tissues were collected for subsequent experiments.

[0046] Experimental procedures for detecting reactive oxygen species (ROS) in cells: The level of ROS in cells was measured using the fluorescent probe 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA). DCFH-DA can penetrate the mitochondrial membrane and is hydrolyzed by esterases to form non-fluorescent DCFH. Subsequently, DCFH is oxidized by ROS to produce fluorescent DCF. The probe was diluted 1:12000 with PBS. The cell culture medium was removed, and an appropriate volume of diluted DCFH-DA was added. The cells were incubated at 37°C for 30 min. The cells were washed three times with PBS, and then DAPI staining solution was added to stain the cell nuclei. The cells were incubated at 37°C for 20 min, washed three times with PBS, and finally observed using a confocal microscope. The excitation wavelength of the DCFH-DA probe was 488 nm, and the emission wavelength was 525 nm; the excitation wavelength of DAPI was 350 nm, and the emission wavelength was 460 nm.

[0047] Experimental procedures for detecting reactive oxygen species (ROS) content in tissues: The CheKine™ Mitochondrial Reactive Oxygen Species (ROS) Production Rate Fluorescence Assay Kit (Abbkine, catalog number: KTB1911) was used. The rate of increase in 2',7'-dichlorofluorescein fluorescence intensity is directly proportional to the ROS production rate. Fresh heart tissue or cell mitochondria were extracted and mixed with the assay reagent in 96-well plates, then incubated at 37°C in the dark for 15 min. After incubation, fluorescence values ​​were measured over 10 min using a multi-mode microplate reader. The excitation wavelength was 488 nm, and the emission wavelength was 525 nm. The instrument temperature was maintained at 37°C, and the fluorescence value changes over 10 min were recorded. Linear regression fitting was performed on the changes in fluorescence intensity over time, and the regression coefficient, i.e., the slope of the line (k), was calculated. The actual mitochondrial ROS production rate is equal to the slope of the linear regression line of the sample fluorescence intensity over time (s) (k measured) minus the slope of the linear regression line of the background fluorescence intensity over time (k empty), where k = (RFU10min - RFU0min) / 600. (Protein quantification uses the Bradford method) Experimental procedures for superoxide dismutase (SOD) activity assay: The CheKine™ Superoxide Dismutase (SOD) Activity Assay Kit (Abbkine, catalog number: KTB1030) was used. SOD activity is negatively correlated with formazan production. Animal tissue samples: 0.1 g of tissue was weighed and homogenized in 1 mL of pre-chilled 1×Lysis Buffer. After homogenization, the sample was centrifuged at 12000 g for 5 min at 4°C, and the supernatant was collected for assay. Cell samples: 5 × 10⁶ cells were collected. 6Cells were washed with pre-chilled PBS, centrifuged at 800g for 2 min, and the supernatant was discarded. 1 mL of pre-chilled 1×Lysis Buffer was added to suspend the cells, and the cells were incubated on ice for 10 min. Then, the cells were centrifuged at 12000g for 5 min at 4°C, and the supernatant was collected for detection. The sample and reagents were thoroughly mixed in a 96-well plate, incubated at 37°C for 30 min, and the absorbance (A) of each well was measured at 450 nm. The plate was zeroed with deionized water, and the results were calculated from the measured values. (Protein quantification was performed using the Bradford method.) Since superoxide dismutase 2 (SOD2) is mainly found in mitochondria, mitochondria from cells and tissues are extracted first. The mitochondrial extraction method is as follows: Weigh approximately 0.1g of tissue or collect 5 million cells, add 1mL Extraction Buffer and 10µL L-eagent II, homogenize in an ice bath, centrifuge at 600g, 4℃ for 5min, collect the supernatant to a new centrifuge tube, and discard the precipitate. Centrifuge the supernatant again at 11000g, 4℃ for 10min; the precipitate is the extracted mitochondria. Discard the supernatant, resuspend the precipitate in 200µL L-eagent I, and place on ice for testing. Then, using an SOD activity kit, thoroughly mix the sample and detection reagent in a 96-well plate, incubate at 37℃ for 30min, and measure the absorbance (A) of each well at 450nm. Zero the plate with deionized water, and finally calculate the result from the measured value. (Protein quantification uses the Bradford method.) Experimental steps for siRNA transfection; Before starting the experiment, add cell suspension (2 mL / well) to the six-well plate. After the cells adhere and reach a suitable density, begin transfection. First, centrifuge the siRNA powder at 4000 rpm for 1 min, then prepare a 20 µM siRNA solution with DEPC water. For the experiment, prepare solution A (125 µL basal medium + 4 µL Lipo8000™) and solution B (125 µL basal medium + 5 µL siRNA) for each well. After standing for 5 min, mix solutions A and B, and let stand for another 20 min. Finally, add 259 µL of the mixed solution to all the wells and incubate in a cell culture incubator. The negative control wells are cultured in the same way. Subsequent experimental detection can be performed 48 h after transfection.

[0048] The si-SOD2 sequence 1 is as follows (5' to 3'): Justice Chain: GGAGAAUGUUAGCCAAAGA; Antonyms: UCUUUGGCUAACAUUCUCC; Test results as follows Figure 9As shown, acetylation analysis revealed changes in SOD2 acetylation at the K122 site. In H9c2 cells, ACLY overexpression rescued ISO or PE-induced SOD2 activity reduction. ACLY overexpression also inhibited ISO or PE-induced SOD2-K122 acetylation and ANP protein expression in H9c2 cells. Furthermore, SOD2 siRNA knockdown in H9c2 cells counteracted ACLY adenovirus-mediated ISO or PE-induced ROS inhibition. Among differentially acetylated proteins, we observed a significant increase in SOD2-K122 acetylation in the ISO group and a significant decrease in the AAV9-cTnt-ACLY group. In vitro studies also showed increased SOD2-K122 acetylation and ANP protein expression in the ISO or PE groups, and decreased expression in the Ad-ACLY group. Consistently, SOD2 activity and total SOD activity increased in the ISO or PE groups and decreased in the Ad-ACLY group. Similarly, in the TAC group, increased acetylation at the SOD2-K122 site and decreased SOD activity were observed, while in the AAV9-cTnt-ACLY group, decreased acetylation at the SOD2-K122 site and increased SOD activity were observed. Furthermore, in vitro siRNA knockdown of SOD2 attenuated the inhibitory effect of ACLY overexpression on ISO and PE-induced ROS. These findings suggest that ACLY overexpression enhances SOD2 activity by reducing acetylation at the SOD2-K122 site, thereby inhibiting the upregulation of pathological ROS.

[0049] 3. ACLY overexpression reduces mitochondrial acetyl-CoA and protein acetylation. Acetyloginomics data showed that AAV9-cTnt-ACLY treatment generally reduced protein acetylation, a finding that seems contradictory to the role of ACLY in acetyl-CoA production. Given that differentially acetylated proteins are primarily located in mitochondria, and considering that ACLY is located outside the mitochondria and catalyzes the conversion of citrate to acetyl-CoA, we hypothesized that increased ACLY activity might lead to increased citrate consumption. Since mitochondrial citrate production requires acetyl-CoA, we proposed that ACLY overexpression might reduce mitochondrial acetyl-CoA levels, leading to the following experiments.

[0050] Construction and grouping of an ISO-induced mouse cardiomyopathy model: Eight-week-old male C57BL / 6J mice were selected and subcutaneously injected with isoproterenol (ISO) 10 mg / kg / day, while the control group received an equal volume of saline. After 4 weeks, except for the control group, the remaining mice were randomly divided into the isoproterenol model group (ISO group), AAV9-cTnT-ACLY group (ACLY group), empagliflozin group (E group), sacubitril / valsartan group (S group), and metoprolol group (M group). After grouping, ACLY group mice were injected with 5 × 10 mg / kg / day via the tail vein. 11 Mice in the E group received 20 mg / kg / day empagliflozin via gavage; mice in the S group received 60 mg / kg / day sacubitril / valsartan via gavage; and mice in the M group received 100 mg / kg / day metoprolol via gavage. All mice received the same volume of solvent. In addition, except for the control group, all other groups continued to receive 5 mg / kg / day ISO subcutaneously until the end of the experiment. After 6 weeks of treatment, cardiac function was assessed in each group. After the tests, the mice were euthanized under anesthesia, and cardiac tissue was collected for subsequent experimental analysis.

[0051] Drug preparation method (prepare immediately before use): The preparation method is as described in Example 2.

[0052] The Acetyl-CoA Assay Kit (Sigma, catalog number: MAK039) is used to determine the concentration of acetyl-CoA by a coupled enzyme assay, which produces a fluorescent assay product (λex=535nm, λem=587nm) that is proportional to the acetyl-CoA concentration.

[0053] Preparation of the standard curve and measurement range: Dilute 10 μL of 10 mM acetyl-CoA standard solution with 990 μL of water to prepare a 0.1 mM standard solution. Dilute 10 μL of 0.1 mM standard solution with 490 μL of water to prepare a 2 μM standard solution. Add 0, 10, 20, 30, 40, and 50 μL of diluted acetyl-CoA standard to appropriate replicates in a 96-well plate to generate 0 (blank), 20, 40, 60, 80, and 100 pmol / well standards. Add acetyl-CoA assay buffer to each well to bring the volume to 50 μL.

[0054] Sample preparation: Take 1000 mg of tissue sample, rapidly freeze and pulverize it, and deproteinize the sample by perchloric acid precipitation. Add 2 μL of 1M perchloric acid / mg sample, keep the sample cool, and thoroughly homogenize or sonicate. Centrifuge the sample at 10000×g for 10 min to remove insoluble substances (deprecipitate), neutralize the supernatant with 3M potassium bicarbonate solution, add equal aliquots of 1 μL / 10 μL of supernatant, and vortex until bubble formation stops (5 aliquots). Cool on ice for 5 min, use 1 μL of sample to verify that the pH value is 7, and then rotate for another 2 min to precipitate potassium bicarbonate. Discard the cell culture medium, wash the cells with pre-chilled PBS, add an appropriate amount of IP lysis buffer (containing PMSF), scrape off the cells, transfer them to centrifuge tubes, shake rapidly on ice for 30 min, then centrifuge at 12000 rpm, 4°C for 10 min. Transfer the supernatant to a new centrifuge tube; this supernatant is the cell lysis buffer. Deproteinize the sample by perchloric acid precipitation, adding 100 µl of 2-NPCA per 500 µl of sample, and neutralize the supernatant with 3M potassium bicarbonate solution. For mitochondrial acetyl-CoA extraction, first extract the mitochondria, then perform the above operations.

[0055] Determine the reaction and calculate the results. Add two 10 μL samples to each well of a 96-well plate, and bring the sample volume to a final volume of 50 μL using acetyl-CoA assay buffer (A). Also prepare blank sample wells (containing sample, but without convertase C in the reaction). To correct for background from free CoA and succinyl-CoA, add 10 μL of acetyl-CoA quencher (F) to each sample, standard, and blank well, incubate at room temperature for 5 min, then add 2 μL of quench restorer (G), mix well, and incubate for another 5 min. Then, according to the table below, add 50 μL of the corresponding reaction mixture to each well (preparation method shown in Table 7), mix thoroughly, and incubate at 37°C in the dark for 10 min. Finally, measure the fluorescence intensity (λex = 535 nm, λem = 587 nm). Calculate the acetyl-CoA content in the sample from the standard curve. Table 7. Preparation method of reaction mixture .

[0056] The results are as follows Figure 10 As shown, ISO stimulation increased these levels, while ACLY overexpression decreased them. Consistent with this, mitochondrial acetyl-CoA levels increased in the TAC group and decreased in the AAV9-cTnt-ACLY group. Furthermore, in vitro ACLY overexpression not only inhibited ISO-induced mitochondrial protein acetylation but also alleviated ISO-induced overall protein acetylation.

[0057] This study aimed to verify the effects of pyruvate and lactate levels, as well as citrate synthase activity, on acetyl-CoA. Pyruvate, derived from glycolysis, can be converted into lactate or enter the mitochondria to produce oxaloacetate and acetyl-CoA, which are then converted into citrate by citrate synthase. ACLY overexpression occurs outside the mitochondria, and the consumption of citrate may stimulate intramitochondrial citrate synthesis, leading to increased acetyl-CoA consumption. To further investigate this, we evaluated pyruvate and lactate levels, as well as citrate synthase activity.

[0058] Pyruvate content detection: The CheKine™ Pyruvate (PA) content detection kit (Abbkine, catalog number: KTB1121) was used. The principle is that pyruvate in the sample reacts with 2,4-dinitrophenylhydrazine, and the resulting red compound has a maximum absorption peak at 520 nm. Within a certain concentration range, the pyruvate content is linearly related to the absorbance at 520 nm. Fresh cell or tissue samples were taken, and an appropriate amount of Extraction Buffer was added for homogenization. The mixture was allowed to stand for 30 min, then centrifuged at 4000g at room temperature for 10 min. The supernatant was collected and placed on ice for testing. A standard curve was prepared according to the given standards. The microplate reader was zeroed with deionized water. 75 µL of sample / standard / Extraction Buffer was added to each well of a 96-well plate. 25 µL of Chromogen A was added to each well, mixed, and allowed to stand at room temperature for 2 min. Then, 125 µL of Chromogen B was added to each well and mixed. The absorbance of each well was measured at 520 nm. Calculate the relative absorbance ΔAmeasured = Ameasured - Ablank, and ΔAstandard = Astandard - Ablank. Finally, use a standard curve to calculate the pyruvate content based on sample quality or cell count.

[0059] Lactate content detection: The CheKine™ Lactate (Lactate) Content Detection Kit (Abbkine, catalog number: KTB1100) was used. The principle is that lactate is oxidized by lactate dehydrogenase, producing a product that interacts with the tetrazolium salt WST-8 dye, forming a colored product proportional to the lactate concentration in the sample, with a maximum absorption peak at 450 nm. Fresh cell or tissue samples were taken, and an appropriate amount of LactateAssayBuffer was added for homogenization on ice. The samples were centrifuged at 12000g, 4℃, for 5 min. The supernatant was collected and placed on ice for testing. A standard curve was prepared according to the given standards. The microplate reader was zeroed with deionized water. 50 µL of sample / standard / LactateAssayBuffer was added to each well of a 96-well plate, followed by 50 µL of Working Reagent. After mixing, the plate was incubated at 37℃ in the dark for 30 min. The absorbance at 450 nm was measured. Blank wells were labeled A-blank, standard wells A-standard, and assay wells A-test. Calculate using the formula: ΔAtest = Atest - Ablank, ΔAstandard = Astandard - Ablank. Finally, calculate the lactic acid content of the sample based on the protein concentration using the standard curve. (Protein quantification uses the Bradford method.) Citrate synthase activity assay: The CheKine™ Citrate synthase (CS) activity assay kit (Abbkine, catalog number: KTB1023) was used. The principle is that CS can catalyze the reaction of acetyl-CoA and oxaloacetic acid to produce citrate-CoA, which is further hydrolyzed to produce citrate. This reaction causes the colorless DTNB to be converted into yellow TNB. TNB has a characteristic absorbance value at 412 nm. The activity of citrate synthase can be calculated by detecting the rate of increase in light absorption at 412 nm. Take fresh cell or tissue samples, add appropriate amounts of Extraction Buffer and Reagent II (volume ratio 100:1), homogenize on ice, centrifuge at 600g, 4℃ for 5 min, collect the supernatant to a new centrifuge tube, centrifuge again at 11000g, 4℃ for 10 min, and obtain the supernatant and precipitate separately. The supernatant is the cytoplasmic extract, and the precipitate is the mitochondrial precipitate. Since citrate synthase is mainly found in the mitochondrial matrix, take the precipitate and add 1 / 4 of the original lysis volume of Reagent I and Reagent II (volume ratio 100:1) and mix well for mitochondrial CS assay; zero the microplate reader with deionized water; preheat the working reagent at 37℃ for 5 min; add 220µL of working reagent and 10µL of working reagent to a 96-well plate. For Reagent VI, add 10 µL of sample, mix quickly, and detect at 412 nm. Record the absorbance values ​​at 20 s and 2 min 20 s, denoted as A1 and A2, respectively. Calculate ΔA = A2 - A1. Finally, calculate citrate synthase activity based on sample mass or cell number. Unit definition: One unit of enzyme activity is defined as the oxidation of 1 nmol TNB per minute per gram of tissue / 10,000 cells in the reaction system.

[0060] In vitro experimental procedures: Rat H9c2 cells were purchased from Procell and cultured in complete medium (DMEM medium + 10% serum + 1% penicillin-streptomycin) at 37°C in a 5% CO2 cell culture incubator. The Ad-ACLY+ISO and ISO groups were stimulated with isoproterenol at a final concentration of 10 µmol / L for 24 h. The Ad-ACLY+PE and PE groups were stimulated with phenylephrine at a final concentration of 100 µmol / L for 24 h. The Ad-EV groups were stimulated with the control solvent. Ad-ACLY indicates that the cells have undergone adenovirus overexpression treatment for ACLY protein, and Ad-EV indicates that the cells have been treated with a control virus (empty vector). All experiments were performed.

[0061] Experimental results are as follows Figure 11As shown, in the TAC group, pyruvate and lactate levels increased in the mouse heart, while citrate synthase activity decreased; however, AAV9-cTnt-ACLY treatment reversed these changes (GI). Similarly, in ISO-stimulated H9c2 cells, the changes of increased lactate content and decreased citrate synthase activity were also reversed by ACLY adenovirus treatment. These results suggest that ACLY overexpression in cardiomyocytes may deplete citrate, providing a feedback mechanism to enhance citrate synthesis from acetyl-CoA, thereby promoting pyruvate entry into mitochondria and reducing lactate production.

[0062] The technical means disclosed in this invention are not limited to those described above, but also include technical solutions composed of any combination of the above technical features. The above descriptions are specific embodiments of this invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of this invention, and these improvements and modifications are also considered within the scope of protection of this invention.

[0063] Finally, it should be noted that the above embodiments are only used to illustrate the present invention and are not intended to limit the technical solutions described in the present invention; those skilled in the art should understand that modifications or equivalent substitutions can still be made to the present invention; and all technical solutions and improvements that do not depart from the spirit and scope of the present invention should be covered within the scope of the claims of the present invention.

Claims

1. The application of an ACLY gene-based drug in the preparation of drugs for the treatment and prevention of cardiomyopathy, characterized in that, The sequence of the ACLY gene is shown in SEQ ID NO.1, and the ACLY gene drug is a recombinant adeno-associated virus named AAV9-cTnt-ACLY.

2. The application according to claim 1, characterized in that, The AAV9-cTnt-ACLY contains the ACLY gene or a protein encoded by the ACLY gene.

3. The application according to claim 1, characterized in that, In the preparation of AAV9-cTnt-ACLY, PCR amplification primers were designed based on the ACLY gene sequence. The primers were AAV-m-ACLY-F and AAV-m-ACLY-R. The nucleotide sequence of AAV-m-ACLY-F is SEQ ID NO: 2, and the nucleotide sequence of AAV-m-ACLY-R is SEQ ID NO:

3.

4. The application according to claim 1, characterized in that, The vector for AAV9-cTnt-ACLY is adeno-associated virus AAV9, and the promoter is cTnt.

5. The application according to claim 1, characterized in that, The viral titer of AAV9-cTnt-ACLY is 7-8 × 10⁻⁸. 13 vg / mL.

6. The application according to claim 1, characterized in that, The AAV9-cTnt-ACLY targets ACLY in the mitochondria of cardiomyocytes, specifically expressing ACLY in cardiomyocytes, thereby reducing mitochondrial protein acetylation and ROS production, and can be used to prepare drugs for treating cardiomyopathy.

7. The application according to claim 1, characterized in that, The preparation of drugs for the treatment and prevention of cardiomyopathy includes the preparation of drugs for the treatment of isoproterenol and / or drugs for the treatment of cardiac dysfunction caused by thoracic aortic coarctation.

8. The application according to claim 1, characterized in that, The drugs for treating and preventing cardiomyopathy include pharmaceutically acceptable carriers.

9. The application according to any one of claims 1-8, characterized in that, The dosage forms of the drugs for treating and preventing cardiomyopathy include tablets, capsules, granules, pills, gels, suppositories, ointments, emulsions, mixtures, suspensions, injections, and solutions.

10. The application according to any one of claims 1-8, characterized in that, The routes of administration for the drugs for treating and preventing cardiomyopathy include oral administration, injection administration, inhalation administration, topical administration, sublingual administration, and rectal administration.