Carya illinoensis shell-based carbon quantum dot as well as preparation method and application thereof
By preparing carbon quantum dot nanoparticles derived from PEI-modified thin-shelled pecan shells and binding them with dsRNA to form a stable complex, the problem of dsRNA being easily inactivated in the external environment was solved, achieving a highly efficient and environmentally friendly plant disease control effect.
Patent Information
- Application Number
- CN202511937269.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-22
- Publication Date
- 2026-04-07
AI Technical Summary
In existing technologies, exogenous spraying of dsRNA is easily inactivated by external environmental factors, resulting in poor stability and efficacy of dsRNA in the control of plant diseases. Chemical pesticide control methods lead to pesticide resistance and environmental pollution problems, and there is a lack of highly efficient and environmentally friendly RNA pesticides.
Carbon quantum dot nanoparticles derived from thin-shelled pecan shells modified with PEI, which has small particle size and low cost, are combined with dsRNA targeting the pathogenic gene of fruit anthracnose. Carbon quantum dot nanoparticles are prepared by hydrothermal method, and dsRNA is adsorbed on their surface to form a stable complex.
It improves the stability and efficacy of dsRNA, promotes the absorption of dsRNA by plants, and significantly reduces the leaf spot area after anthracnose infection, thus achieving efficient and environmentally friendly disease control.
Smart Images

Figure CN121801564A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of carbon nanomaterials technology, and relates to a plant disease resistance based on thin-shelled pecan shell carbon quantum dots, its preparation method and application, particularly to a method for preparing PEI-modified carbon quantum dot nanomaterials and their application in plant disease resistance after forming a complex with dsRNA. Background Technology
[0002] Anthracnose is a global plant disease caused by the fungus *Anthracnose*, which has a wide host adaptability and can infect both woody and herbaceous plants. Among them, *Anthracnose spp.* (also known as fruit-bearing anthracnose fungus) Colletotrichum fructicola ) as a complex of collodion anthrax bacteria ( C. gloeosporioides species complex A key member of the *Hymenococcus faecium* family, its host range covers more than 20 economic crops, including apples, pears, peppers, pecans, and camellia oleifera. Pathogen surveys conducted in major producing areas of pecans in Zhejiang, Jiangxi, and Yunnan provinces of my country, using a combination of morphological and molecular biological identification, have for the first time confirmed *Anthracnose spp.* as the causative agent of anthracnose in the local pecan population.
[0003] Spray-induced gene silencing (SIGS) is considered a novel and environmentally friendly method for managing plant diseases and pests. This technology manipulates the expression of endogenous plant genes or target genes of pathogens by applying dsRNA to the plant surface. This technique can specifically control harmful pathogens without the downstream impacts that chemical pesticides may have on the surrounding ecosystem. Therefore, novel biopesticides developed based on SIGS technology are characterized by high efficiency, strong target specificity, and environmental friendliness, making them powerful tools for plant disease and pest control. However, exogenously sprayed dsRNA is easily affected by the external environment; therefore, it is necessary to load it with nanomaterials to ensure that the dsRNA is not easily degraded and inactivated when applied in the field.
[0004] Currently, carbon dots have been studied as RNA delivery carriers in the plant field. For example, carbon dot nanoparticles of different sizes have been used to promote the entry of siRNA into transgenic tobacco and tomatoes, thereby detecting the effect of size on gene silencing and the silencing effect on related proteins. Reports indicate that carbon dots obtained from glucose and sucrose using a solvothermal method were combined with dsRNA to form nanocomposites, which were then sprayed on cucumber leaves. Quantitative analysis of dsRNA in the leaves revealed that the nanocomposites resulted in 50 times higher dsRNA entry than naked dsRNA, confirming that the efficiency of dsRNA entry into plants in nanocomposites is higher than that of naked dsRNA. Currently, chemical pesticides are mainly used for control in production practices, but large-scale application can easily lead to pathogen resistance, pesticide residues, and environmental pollution, seriously affecting the sustainable development of agriculture. Compared with traditional chemical pesticides, RNA pesticides have advantages such as precise control, environmental friendliness, high efficacy, and high public acceptance. Therefore, there is an urgent need to develop an RNA pesticide to control the occurrence of thin-shelled pecan diseases and reduce yield losses. Summary of the Invention
[0005] To address the aforementioned technical problems, this invention provides carbon quantum dot nanoparticles with small particle size and low cost, as well as a method for their preparation. The nanoparticles are combined with dsRNA targeting the pathogenic gene of *Anthracnose fructicus*, aiming to improve the stability and efficacy of RNA-based bacterial agents based on nanomaterials.
[0006] The technical solution provided by this invention is as follows: A method for preparing carbon quantum dot nanoparticles derived from PEI-modified thin-shelled pecan shells includes the following steps: using thin-shelled pecan shell powder as a carbon source, reacting it with PEI in an aqueous solution via a hydrothermal method to prepare the reaction product containing carbon quantum dot nanoparticles.
[0007] Furthermore, the mass ratio of the thin-shelled pecan shell powder to PEI is 1:0.5~2, and the aqueous solution is ultrapure water or RNase-free water.
[0008] Furthermore, the hydrothermal reaction is carried out in a polytetrafluoroethylene-lined reactor at a temperature of 160-190°C for a time of 16-24 hours.
[0009] Furthermore, the preparation method also includes a step of dialysis of the reaction product.
[0010] The thin-shelled hickory shells are ground into powder. The thin-shelled hickory shell powder, PEI and water are mixed in a ratio of 0.8 g to 1 g: 1 mL: 10 mL and reacted at 160-200 ℃ for 18-24 hours to obtain carbon dots.
[0011] More preferably, carbon dots are prepared by mixing thin-shelled pecan shell powder, PEI and water in a ratio of 1 g: 1 mL: 10 mL and reacting at 180 °C for 20 hours.
[0012] Preferably, after the reaction solution cools, it is centrifuged at 8000 rpm for 10 min, the supernatant is collected, and then dialyzed with a dialysis bag with a molecular weight of 10000 Kda for 24 h. After drying at 65 °C, carbon quantum dot powder is obtained.
[0013] The present invention also provides carbon quantum dot nanoparticles derived from PEI-modified thin-shelled pecan shell powder, which are obtained by the above preparation method.
[0014] The present invention also provides the application of the above-mentioned carbon quantum dot nanoparticles derived from PEI-modified thin-shelled pecan shell powder in promoting the absorption of dsRNA by plant leaves.
[0015] The present invention also provides a composite of carbon quantum dot nanoparticles, wherein dsRNA is adsorbed on the surface of the carbon quantum dot nanoparticles derived from the above-mentioned thin-shelled pecan shell powder.
[0016] Furthermore, the dsRNA is a dsRNA targeting *Anthracis cirrhosa* cells, and the sequence of the dsRNA is shown in SEQ ID NO.1 or SEQ ID NO.2.
[0017] The present invention also provides the application of the above-mentioned carbon quantum dot nanoparticles derived from PEI-modified thin-shelled pecan shell powder or the above-mentioned carbon quantum dot nanoparticle composites in the prevention and control of anthracnose in thin-shelled pecans.
[0018] Furthermore, the carbon quantum dot nanoparticles derived from PEI-modified thin-shelled pecan shell powder or the composite of carbon quantum dot nanoparticles are used to reduce the leaf lesion area after anthracnose infection. Beneficial effects
[0019] Carbon dots were prepared using the above method, and their loading capacity was analyzed, clarifying their application as a carrier of double-stranded RNA. Further analysis showed that the carbon quantum dot nanoparticle / double-stranded RNA complex exhibited better stability and disease-preventing effects than double-stranded RNA alone, demonstrating practical potential. Attached Figure Description
[0020] Figure 1 A schematic diagram of a method for preparing carbon quantum dots from thin-shelled pecan shell powder; Figure 2 Image from a transmission electron microscope; Figure 3 Infrared spectrum; Figure 4 This is a zeta potential diagram; Figure 5 Gel electrophoresis images showing the binding capacity of carbon quantum dots to dsRNA at different ratios; Figure 6 Gel electrophoresis image showing the effect of carbon quantum dots on stabilizing dsRNA after nuclease treatment; where A represents dsRNA + RNase A; and B represents dsRNA - CDPs + RNase A. Figure 7 The diagram shows the effect of carbon quantum dots on promoting the absorption of dsRNA in plants; where A represents the YFP-dsRNA group and B represents the YFP-dsRNA / CDPs group. Figure 8 Figure 1 shows the results of enhancing the control efficacy of CDPs / dsRNA complex against fruit anthracnose; where A is a photograph and B is a bar chart. Detailed Implementation
[0021] To make the objectives, technical solutions, and advantages of the present invention clearer, preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings.
[0022] The main reagents used in the preferred embodiment are as follows: thin-shelled pecan shells (raw material origin: Jiangsu Province, Institute of Botany, Chinese Academy of Sciences), 1 mL of polyethyleneimine (PEI), and ultrapure water for the experiment; The main instruments used in the preferred embodiment are as follows: electronic balance, 25 mL polytetrafluoroethylene hydrothermal reactor, electric thermostatic drying oven, high-speed centrifuge, thermostatic incubator, light incubator, transmission electron microscope, and Fourier transform infrared spectrometer.
[0023] The gene sequences used in the preferred embodiments are as follows: CfZ19 Gene sequence: CGGCTACGACATCAACTCCGAGCTCTACGGCTGGCTCCAGCAGGCCAACAAGATCCGCGTCCACGCCGCCAAGGCCAACGCCAACTTCCTGACCACCGAGCGCACCCAGGCTATCTTCTCCTACGGCAGCGACGACCAGAGCCAAGTC ATCGCCTTCCGCAAGGGTCAGCTCTTCTCCATGTACACCAGCGGTGGCGTCAACGCCGCCAACAACGCCATGTTTGCCATCGCCCGCAACGCCCACCTCTTCGCCATCGGCTCCGAGGTCATCGACGTTGTGAACTGCGAGTCCTTCACC (SEQ ID NO.1).
[0024] YFP Gene sequence: ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGA CCCTGAAGTTCATCTGCACC ACCGGCAAGC TGCCCGTGCC CTGGCCCACCCTCGTGACCA CCCTGACCTA (SEQ ID NO. 2). Example 1
[0025] Preparation of carbon quantum dots using thin-shelled pecan shells as a carbon source 1. Preparation of carbon quantum dots Thin-shelled pecan shells were ground into powder using a juicer. 1 g of the thin-shelled pecan shell powder and 1 mL of polyethyleneimine (PEI) were added to 10 mL of deionized water and placed in a 30 mL polytetrafluoroethylene stainless steel reactor. The mixture was reacted at 180 °C for 20 h. The resulting reaction solution was cooled to room temperature, centrifuged at 8000 rpm for 10 min, and the supernatant was collected. The supernatant was dialyzed with a 10000 kDa dialysis bag for 24 h and then dried at 65 °C to obtain carbon quantum dot powder. The carbon quantum dot powder was dissolved in ultrapure water to obtain a carbon quantum dot dispersion of the desired concentration, stored at 4 °C, and named CDPs.
[0026] 2. Characterization of carbon dots Synthesis diagram reference Figure 1 Reference image from a transmission electron microscope. Figure 2 Infrared spectrum reference Figure 3 Zeta potential reference Figure 4 . Example 2
[0027] Detection of the binding affinity between carbon quantum dots and dsRNA CDPs were dissolved in enzyme-free water to prepare a 1000 ng / µL solution. dsRNA solution (sequence SEQ ID NO.1) was added to the CDPs solution, maintaining CDPs to dsRNA mass ratios of 100:1, 50:1, 30:1, 20:1, 10:1, and 5:1, respectively. Enzyme-free water was added to maintain a consistent dsRNA concentration in each tube. A negative control group (containing only dsRNA, without nanomaterials) was also included. The mixture was thoroughly mixed using a high-speed vortex mixer for 1 min, then allowed to stand at room temperature for 15 min. During this time, dsRNA was adsorbed onto the surface of CDPs, forming a stable sCDP-dsRNA complex through the positive electrostatic attraction between the positive charge on the sCDP surface and the negative charge on the dsRNA surface. Prepare a 1.2% agarose gel and allow it to solidify. Add 5 μL of the mixture and 0.5 μL of 10× loading buffer to each well. Perform electrophoresis at 130V for 18 minutes. Observe the results in a gel imaging system after electrophoresis. When no obvious single band flows out of the lane (…),… Figure 5 The value indicates that the dsRNA is completely loaded with sCDP. The optimal fusion ratio is selected as 10:1 based on the electrophoresis results. Example 3
[0028] CDPs stabilize dsRNA after nuclease treatment CDPs were combined with dsRNA at the optimal fusion ratio under the above reaction conditions. After the CDPs / dsRNA complex was prepared, the complex solution was treated with 20 ng / μL RNase A, and a negative control group (dsRNA only, without nanomaterials) was set up and incubated at 37°C for 0, 20, 40, and 60 minutes, respectively. A 1.2% agarose gel was then prepared, and after solidification, 5 μL of the mixture, 0.5 μL of 10× loading buffer, and 0.3% SDS solution were added to each well to depolymerize the dsRNA and nanomaterials. Electrophoresis was performed at 130V for 18 minutes. After electrophoresis, the degradation of dsRNA was observed using a gel imaging system.
[0029] The results showed that naked dsRNA was rapidly degraded under treatment with 20 ng / μL RNase A. Figure 6 (A in the text), while the dsRNA composited with nanomaterials still exhibits a single and bright band ( Figure 6 (B in the text) indicates that CDPs can effectively protect dsRNA from the effects of nucleases. Example 4
[0030] CDPs promote the uptake of dsRNA by plant leaves. Fluorescein-labeled by in vitro synthesis YFP-dsRNA (sequence SEQ ID NO.2) and forms a complex with it using CDPs. After treating the same location on different leaves, the fluorescence signal of pecan leaves at different time points was observed using a regular inverted microscope (dsRNA that was not absorbed by the leaves was treated with nuclease before observation). The results showed that, compared with the single dsRNA, the fluorescence signal of pecan leaves at different time points was significantly enhanced. YFP Compared to the dsRNA-treated group, the fluorescence intensity of the group treated with the dsRNA / CDPs complex was significantly enhanced. This indicates that CDPs can promote the uptake of dsRNA by pecan leaves. Figure 7 ). Example 5
[0031] CDPs / dsRNA complex enhances the efficacy against fruit anthracnose. Newly grown leaves from pecan seedlings were used in the experiment, and the leaves were sprayed with 40 ng / uL of [a specific pesticide / treatment]. CfZ19 -dsRNA (sequence of SEQ ID NO.1), and CfZ19 The dsRNA / CDPs complex was used, with water and CDPs as negative controls. Anthracnose mycelium was inoculated at the same location on the leaves. The leaves were then placed in an incubator and cultured alternately with a 12 / 12 h photoperiod. After one week, the lesion area of the thin-shelled pecan leaves in different treatment groups was observed. The results showed that, compared with the negative control, thin-shelled pecan leaves treated with dsRNA or dsRNA / sCDP complex exhibited smaller lesion areas. Figure 8 This indicates that carbon quantum dots prepared from pecan shell powder, when combined with dsRNA, have a good preventive effect against anthracnose in pecans.
Claims
1. A method for preparing carbon quantum dot nanoparticles derived from PEI-modified thin-shelled pecan shells, characterized in that, Includes the following steps: Carbon-containing quantum dot nanoparticles were prepared by reacting thin-shelled pecan shell powder with PEI in an aqueous solution using a hydrothermal method.
2. The preparation method according to claim 1, characterized in that, The mass ratio of the thin-shelled pecan shell powder to PEI is 1:0.5~2, and the aqueous solution is ultrapure water or RNase-free water.
3. The preparation method according to claim 1, characterized in that, The hydrothermal reaction is carried out in a polytetrafluoroethylene-lined reactor at a temperature of 160-190℃ for 16-24 hours.
4. The preparation method according to any one of claims 1 to 3, characterized in that, The preparation method further includes a step of dialysis of the reaction product.
5. A type of carbon quantum dot nanoparticles derived from PEI-modified thin-shelled pecan shell powder, characterized in that, It is obtained by the preparation method described in any one of claims 1 to 4.
6. The application of PEI-modified thin-shelled pecan shell powder-derived carbon quantum dot nanoparticles as described in claim 5 in promoting the absorption of dsRNA by plant leaves.
7. A composite of carbon quantum dot nanoparticles, characterized in that, dsRNA is adsorbed on the surface of carbon quantum dot nanoparticles derived from thin-shelled pecan shell powder as described in claim 5.
8. The composite of carbon quantum dot nanoparticles according to claim 7, characterized in that, The dsRNA is a dsRNA that targets fruit-bearing anthracnose cells, and the sequence of the dsRNA is shown in SEQ ID NO.1 or SEQ ID NO.
2.
9. The application of the carbon quantum dot nanoparticles derived from PEI-modified thin-shelled pecan shell powder as described in claim 5, or the composite of carbon quantum dot nanoparticles as described in claim 7, in the prevention and control of anthracnose in thin-shelled pecans.
10. The application according to claim 9, characterized in that, The carbon quantum dot nanoparticles or carbon quantum dot nanoparticle composites derived from PEI-modified thin-shelled pecan shell powder are used to reduce the leaf lesion area after anthracnose infection.