Kit for breast cancer drug resistance detection and application thereof

By detecting NOL7 gene expression using a kit, the challenge of detecting chemotherapy resistance in breast cancer has been solved, providing a sensitive and accurate assessment tool suitable for assessing the risk of chemotherapy resistance in large batches of samples.

CN121852546AActive Publication Date: 2026-04-14JILIN SECOND PEOPLES HOSPITAL (JILIN CANCER HOSPITAL)
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202610329147.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-18
Publication Date
2026-04-14
Estimated Expiration
2046-03-18

AI Technical Summary

Technical Problem

In the current technology, the problem of chemotherapy resistance in breast cancer patients, especially triple-negative breast cancer (TNBC), has not been effectively solved. The specific relationship between the NOL7 gene and chemotherapy resistance in breast cancer has not been reported, and there is a lack of effective detection methods.

Method used

A kit is provided that contains primer pairs for amplifying the NOL7 gene and primer pairs for the internal reference gene β-actin, combined with reverse transcription reaction and real-time PCR technology, to detect the expression level of the NOL7 gene in order to assess the risk of chemotherapy resistance in patients.

Benefits of technology

By detecting the expression level of the NOL7 gene, a sensitive and accurate tool is provided that can specifically detect the expression of NOL7 in tumor samples, assess the risk of chemotherapy resistance in patients, and has broad application prospects. It is also easy to operate and suitable for large-scale sample testing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121852546A_ABST
    Figure CN121852546A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to a kit for breast cancer drug resistance detection and application of the kit. The kit comprises a primer pair for amplifying the NOL7 gene, an upstream primer sequence of the primer pair for amplifying the NOL7 gene is as shown in SEQ ID NO. 1, and a downstream primer sequence is as shown in SEQ ID NO. 2. Experiments prove that high expression of the NOL7 gene is related to breast cancer drug resistance, and the NOL7 gene can be used as a marker for breast cancer drug resistance detection. Meanwhile, the marker for breast cancer drug resistance detection is applied to preparation of the kit, and the kit can specifically, sensitively and accurately detect the expression level of NOL7 in a tumor sample, so that a brand new tool is provided for clinically evaluating the chemotherapy drug resistance risk of a patient, and the application prospect is wide.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a reagent kit for detecting drug resistance in breast cancer and its application. Background Technology

[0002] Breast cancer is a common malignant tumor in women, with its incidence rate increasing year by year and showing a trend towards affecting younger women, seriously threatening women's lives and health. In my country, breast cancer has the highest incidence rate among malignant tumors in women, and its incidence rate is more than twice the global rate. Breast cancer can be classified into Luminal A, Luminal B, human epidermal growth factor receptor 2 (HER2) overexpression type, and triple-negative breast cancer (TNBC). Generally, Luminal A and hormone receptor (HR) positive, HER2 negative Luminal B are collectively referred to as luminal type (HR). + / HER2 - HER2-positive breast cancer accounts for 70% of all breast cancer cases. The prognosis and treatment response of this subtype of breast cancer are significantly heterogeneous, and conventional treatment mainly relies on endocrine therapy. Anti-HER2 therapy is a key approach to the treatment of HER2-positive breast cancer. TNBC accounts for 15-20% of all breast cancers. Compared with other subtypes, TNBC patients have a poorer prognosis, with a 40% mortality rate within 5 years of diagnosis and a high metastasis rate, with approximately 46% of patients developing distant metastases. Because TNBC lacks estrogen receptor (ER), progesterone receptor (PR), and HER2, it is insensitive to endocrine therapy or HER2 molecularly targeted therapy. Currently, commonly used treatment regimens for TNBC include anthracyclines, taxanes, and platinum-based chemotherapy drugs.

[0003] However, existing treatment systems still face many challenges. Current treatments generally suffer from problems such as the development of drug resistance. Tumor cell drug resistance is a major obstacle to further improving the survival of breast cancer patients. In recent years, research on breast cancer drug resistance has revealed the underlying mechanisms from multiple perspectives, such as breast cancer cells and the tumor microenvironment. These mechanisms also include increased drug efflux, alteration of drug targets, DNA damage repair, and activation of other signaling pathways. Therefore, exploring the regulatory mechanisms of tumor drug resistance and identifying targeted regulatory molecules is a crucial research direction and development area. The protein encoded by the NOL7 gene is located in the nucleolus, maintaining nucleolar structure and cell growth rate. As a tumor suppressor, NOL7 influences tumor growth by regulating the balance between pro-angiogenic and anti-angiogenic factors. Furthermore, this gene is also regulated by hypoxia-inducible factor-1α and may be involved in the expression regulation of platelet response protein-1. However, current research on the NOL7 gene is insufficient. Its specific relationship and mechanism of action with breast cancer, especially with chemotherapy resistance, remains a blank in existing technology, with no reports found.

[0004] To achieve the above objectives, the present invention provides a kit for detecting drug resistance in breast cancer and its application. Summary of the Invention

[0005] The primary objective of this invention is to provide a kit for detecting drug resistance in breast cancer.

[0006] A second objective of this invention is to provide a kit for detecting drug resistance in breast cancer and its application in the preparation of products for detecting chemotherapy resistance in breast cancer.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A kit for detecting drug resistance in breast cancer, the kit comprising a primer pair for amplifying the NOL7 gene; the upstream primer sequence of the primer pair for amplifying the NOL7 gene is shown in SEQ ID NO.1, and the downstream primer sequence is shown in SEQ ID NO.2.

[0008] Furthermore, the kit also includes a primer pair for amplifying the internal reference gene β-actin; the upstream primer sequence for amplifying the internal reference gene β-actin is shown in SEQ ID NO.3, and the downstream primer sequence is shown in SEQ ID NO.4.

[0009] Furthermore, the kit also includes a reverse transcription reaction system and a real-time PCR reaction system.

[0010] Furthermore, the detection method of the kit includes the following steps: (1) RNA was extracted from the sample; (2) The RNA extracted in step (1) is reverse transcribed into cDNA using a reverse transcription reaction system; (3) The cDNA obtained in step (2) is used in a real-time PCR reaction system to detect the expression level of the NOL7 gene by using primer pairs for amplifying the NOL7 gene and primer pairs for amplifying the internal reference gene β-actin.

[0011] Furthermore, the sample is breast cancer tissue or cells.

[0012] The above-described kit for detecting drug resistance in breast cancer is used in the preparation of products for detecting chemotherapy resistance in breast cancer.

[0013] Furthermore, the product is a paclitaxel-resistant product.

[0014] Compared with the prior art, the main advantages of the present invention are as follows: (1) This invention reveals for the first time through experiments that high expression of the NOL7 gene is associated with drug resistance in breast cancer and can be used as a molecular marker for paclitaxel resistance detection. At the same time, the combination of breast cancer drug resistance detection markers with the preparation of diagnostic kits can specifically, sensitively and accurately detect the expression level of NOL7 in tumor samples through qPCR technology, thus providing a new tool for clinical assessment of patients' chemotherapy resistance risk, with broad application prospects.

[0015] (2) The kit provided by this invention is based on RT-qPCR technology, which has the advantages of high sensitivity and accurate quantification. Compared with conventional protein level detection methods such as Western blotting, qPCR has higher throughput, is more convenient to operate, and is more suitable for clinical application in the detection of large numbers of samples. Attached Figure Description

[0016] Figure 1 IC50 values ​​for NOL7 knockdown, NOL7 overexpression, and empty control cells 50 value; Figure 2 This represents the relative expression level of the NOL7 gene; Figure 3 The diagnostic value of NOL7 expression level in breast cancer drug resistance detection was analyzed using ROC curve analysis. Detailed Implementation

[0017] The technical solution of the present invention will be further described below with reference to specific embodiments. However, those skilled in the art should understand that the following embodiments are only for illustrating the present invention and should not be regarded as limiting the present invention. Specific conditions not specified in the embodiments are performed according to conventional conditions or conditions recommended by the manufacturer. Unless otherwise specified, the reagents or instruments used are all conventional products obtained through commercial channels.

[0018] Example 1 (1) Lentiviral vector construction and packaging: A DNA fragment containing the coding sequence of the human NOL7 gene was cloned into the lentiviral expression vector pCDH to construct an overexpression vector. Simultaneously, a short hairpin RNA sequence designed for the human NOL7 gene was cloned into the pLKO.1 lentiviral vector to construct a knockdown vector. The nucleotide sequence of the NOL7 gene is shown in SEQ ID NO.5. Subsequently, the overexpression vector, knockdown vector, and helper packaging vector were simultaneously transfected into HEK293T cells. Forty-eight hours after transfection, the cell supernatant was collected and filtered through a 0.45 μm filter to remove cell debris. The filtered viral supernatant was centrifuged at 4°C and 11000g for 4 hours. The supernatant was discarded, and the viral pellet was resuspended in 200 μL of sterile PBS to obtain a concentrated viral solution.

[0019] SEQ ID NO.5: ATGGTGCAGCTCCGACCGCGAGCGTCTCGCGCCCCGGCGTCGGCGGAGGCGATGGTGGACGAGGGCCAGCTGGCCTCGGAGGAGGAGGAGGCGGAGCACGGGCTGTTGCTCGGGCAGCCCAGCAGCGGCGCGGCCGCCGAGCCCCTGGAGGAAGACGAGGAAGGGGACGATGAGTTTGACGATGAGGCCCCGGAGGAGCTGACTTTCGCCAGCGCCCAGGCGGAAGCGAGAGAAGAGGAGCGGCGAGTGCGGGAGACCGTGCGCAGGGATAAAACGCTCCTGAAGGAGAAGAGGAAGCGACGCGAGGAGCTGTTCATCGAACAGAAGAAAAGAAAACTCCTTCCAGACACTATTTTGGAGAAGTTAACCACAGCTTCACAGACTAACATCAAGAAATCGCCAGGAAAGGTGAAAGAAGTTAATTTGCAAAAGAAAAATGAAGACTGTGAAAAAGGAAATGACTCCAAGAAAGTTAAAGTACAAAAAGTACAGTCTGTCAGCCAGAATAAAAGCTACTTGGCCGTAAGGCTAAAAGACCAAGATCTGAGAGATTCAAGGCAACAAGCAGCACAAGCCTTCATACATAATTCATTATATGGGCCAGGAACCAACAGGACTACTGTAAATAAGTTCCTGTCTCTTGCCAACAAGAGGTTACCAGTGAAAAGAGCTGCTGTCCAGTTTTTGAATAATGCTTGGGGAATCCAAAAAAAACAAAATGCCAAGAGGTTTAAAAGACGGTGGATGGTCAGAAAGATGAAAACTAAGAAGTAA。

[0020] (2) Screening of stable cell lines: The concentrated virus solution obtained in step (1), namely NOL7 overexpression virus, NOL7 knockdown virus and corresponding empty control virus, was used to infect breast cancer cells MCF-7. After 24 hours of infection, the medium was replaced with normal complete medium to remove the virus. When the cell density increased to about 90%, the cells were passaged, and the appropriate antibiotics (puramomycin for the pLKO.1 system and blast fungicide for the pCDH system) were used for continuous screening to finally obtain stable infected cell lines.

[0021] (3) Infection efficiency verification: The expression levels of NOL7 gene at the mRNA and protein levels in stably infected NOL7 overexpressing cells, NOL7 knockdown cells, and empty vector control cells were identified by Western blotting and quantitative real-time PCR. The expression level of NOL7 in the overexpression group was significantly upregulated, while the expression level of NOL7 in the knockdown group was effectively inhibited. There was no significant difference in expression levels between the empty vector control group and wild-type cells. Further experiments were conducted.

[0022] (4) Drug sensitivity test: 3000 cells per well were seeded from each group of stable cells (NOL7 overexpression, NOL7 knockdown, and empty vector control) in 96-well plates. After complete cell adhesion, the original culture medium was discarded and replaced with fresh culture medium containing different concentration gradients of taxane drug paclitaxel, and incubated for 48 hours. Subsequently, 10 μL of CCK-8 solution was added to each well, and the cells were returned to the incubator for another 3 hours. Finally, the absorbance (OD value) at 450 nm was measured using a microplate reader. Cell viability was calculated based on the OD value, and a dose-response curve was fitted using nonlinear regression to calculate the half-maximal inhibitory concentration (IC50) for NOL7 knockdown, NOL7 overexpression, and empty vector control cells. 50 (value), the result is as follows Figure 1 As shown.

[0023] The results are as follows Figure 1 As shown, the IC50 values ​​for NOL7 knockdown cells, NOL7 overexpression cells, and empty vector control cells are presented. 50 Value. (By) Figure 1 It can be seen that, compared with the empty control group, NOL7 overexpressing cells showed significantly reduced sensitivity to paclitaxel, with an IC50 value of [missing value]. 50 The value increased to 12.4 ± 1.1 nM. In contrast, NOL7 knockdown cells showed enhanced sensitivity to paclitaxel, with an IC50 value of 12.4 ± 1.1 nM. 50 The value decreased to 4.8 ± 0.4 nM. The IC50 value for empty control cells was [not specified]. 50 The value was 6.7 ± 0.7 nM. This result demonstrates that the expression level of the NOL7 gene positively regulates the resistance of breast cancer cells to paclitaxel, meaning that high NOL7 expression is a key factor leading to paclitaxel resistance.

[0024] Example 2 RNA extraction MCF-7 samples of NOL7 overexpressing cells, NOL7 knockdown cells, and empty vector control cells prepared in Example 1 were collected, and total RNA was extracted from each sample. The specific steps are as follows: ① Cell lysis: Discard the culture medium and wash the cells twice with pre-cooled PBS. Add 1 mL of Trizol lysis buffer directly to each well of a six-well plate and incubate at room temperature for 5 minutes, repeatedly pipetting during this time to ensure complete cell lysis. Transfer the lysis buffer to RNase-free centrifuge tubes.

[0025] ② Phase separation: Add chloroform (1 / 5 the volume of Trizol, i.e., 0.2 mL) to the centrifuge tube containing the Trizol lysis buffer, tighten the cap, and shake vigorously for 20 seconds to ensure complete emulsification. Let stand at room temperature for 5 minutes. Then, centrifuge at 12,000 rpm for 15 minutes at 4°C.

[0026] ③ RNA precipitation: After centrifugation, the mixture separates into three layers: a colorless aqueous supernatant, a middle protein layer, and a pink organic phase. Carefully aspirate approximately 70% of the volume of the aqueous supernatant into a new RNase-free centrifuge tube, being careful to avoid touching the protein layer. Then, add an equal volume of pre-chilled isopropanol to the aqueous phase, gently invert to mix, and incubate on ice for 10 minutes to precipitate the RNA. Afterward, centrifuge at 12,000 rpm for 15 minutes at 4°C; a white gel-like RNA precipitate will be visible at the bottom of the tube.

[0027] ④ RNA washing: Carefully discard the supernatant, avoiding contact with the precipitate. Add an equal volume of pre-cooled 75% ethanol (prepared with DEPC water) to the precipitate, and gently vortex or pipette to suspend the precipitate. Centrifuge at 12,000 rpm for 5 minutes at 4°C.

[0028] ⑤ RNA Dissolution: Carefully discard the ethanol, and place the open end of the centrifuge tube in a clean bench at room temperature for about 5 minutes until the precipitate is translucent and has no ethanol odor. Be careful not to over-dry. Finally, dissolve the RNA precipitate in 20 μL of LDPPC-treated water or RNase-free water.

[0029] ⑥ Quality Control: The concentration and purity of RNA were measured using a Nanodrop 2000 UV spectrophotometer. A qualified RNA sample should have an A260 / A280 ratio between 1.8 and 2.1, and an A260 / A230 ratio greater than 2.0. After passing the tests, the RNA solution was stored at -70°C for subsequent reverse transcription experiments.

[0030] Example 3 RNA is reverse transcribed into cDNA: Total RNA extracted in Example 2 was reverse transcribed into cDNA using an RNA reverse transcription kit. The configuration of the reverse transcription reaction system is shown in Table 1. Reverse transcription was performed on a PCR instrument using the reverse transcription reaction conditions shown in Table 2. The reverse-transcribed cDNA was stored at -20°C for later use in real-time quantitative PCR detection in Example 1.

[0031] Table 1 Reverse transcription reaction system Table 2 Reverse transcription reaction conditions Experimental Example 1 qPCR was used to verify the expression of NOL7 in NOL7 knockdown cells, NOL7 overexpressing cells, and empty vector control cells. To verify at the molecular level whether the expression of the NOL7 gene was successfully regulated in the cell model constructed in Example 1, real-time quantitative PCR was used to detect differences in mRNA expression. Using cDNA from NOL7 overexpressing, NOL7 knockdown, and empty vector control cells prepared in Example 3 as templates, qPCR was performed using the SYBR Green method. The upstream primer sequence for amplifying the NOL7 gene is shown in SEQ ID NO.1, and the downstream primer sequence is shown in SEQ ID NO.2; the upstream primer sequence for the internal reference gene β-actin is shown in SEQ ID NO.3, and the downstream primer sequence is shown in SEQ ID NO.4. The quantitative PCR system is shown in Table 3, the quantitative PCR reaction procedure is shown in Table 4, and the sequence information is shown in Table 5. Each sample had three technical replicates. The relative expression level of NOL7 was calculated using the 2^(-ΔΔCt) method. The specific steps were: ΔCt = Ct(NOL7) - Ct(β-actin); ΔΔCt = ΔCt(experimental group) - ΔCt(empty control group); relative expression level = 2^(-ΔΔCt). The results were presented as bar charts using Prism software. Figure 2 As shown.

[0032] Table 3. Real-time PCR reaction system Table 4. Quantitative Real-Time PCR Reaction Procedure Table 5 Sequence List The results are as follows Figure 2The figure shows the relative expression level of the NOL7 gene. qPCR results showed that, compared to the empty vector control group, the mRNA level of NOL7 in NOL7-overexpressing cells was significantly upregulated by approximately 5.8-fold; while in NOL7-knockdown cells, its mRNA level was effectively suppressed. These results fully confirm the successful construction of the stable NOL7 cell line model at the mRNA level, providing direct molecular biological evidence for the altered paclitaxel sensitivity observed in Example 1.

[0033] Experimental Example 2 ROC curve evaluation of the diagnostic value of NOL7 in breast cancer drug resistance detection: To further evaluate the diagnostic value of paclitaxel chemotherapy resistance in breast cancer patients, 60 samples were tested for breast cancer drug resistance. These included 30 paraffin-embedded (FFPE) tumor tissue samples from patients confirmed to be paclitaxel resistant through clinical efficacy evaluation, and 30 FFPE tissue samples from paclitaxel-sensitive patients. RNA was extracted from the samples and reverse transcribed to obtain cDNA. The expression level of the NOL7 gene was then detected using quantitative real-time PCR, with β-actin as an internal control, and the relative expression level was calculated using the 2^(-ΔΔCt) method. ROC curves were plotted based on the relative NOL7 expression levels obtained from qPCR, and the AUC value was calculated to evaluate its diagnostic value in distinguishing between paclitaxel-resistant and paclitaxel-sensitive patients.

[0034] The results are as follows Figure 3 As shown, the ROC curve analysis reveals the diagnostic value of NOL7 expression level in breast cancer drug resistance detection. The ROC curve analysis indicates that the AUC value for NOL7 expression level in predicting paclitaxel resistance is 0.93. An AUC above 0.7 indicates good model classification ability, demonstrating that NOL7 expression level can specifically distinguish between paclitaxel-resistant and paclitaxel-sensitive patients, providing a solid basis for its clinical application as a predictive biomarker.

[0035] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. The basic principles and main features of the present invention have been described above with specific implementation schemes. Based on the present invention, some modifications or substitutions can be made, but these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of protection claimed by the present invention.

Claims

1. A kit for detecting drug resistance in breast cancer, characterized in that, The kit includes a primer pair for amplifying the NOL7 gene; the upstream primer sequence of the primer pair for amplifying the NOL7 gene is shown in SEQ ID NO.1, and the downstream primer sequence is shown in SEQ ID NO.

2.

2. The kit for detecting drug resistance in breast cancer according to claim 1, characterized in that, The kit also includes primer pairs for amplifying the internal reference gene β-actin; the upstream primer sequence for amplifying the internal reference gene β-actin is shown in SEQ ID NO.3, and the downstream primer sequence is shown in SEQ ID NO.

4.

3. The kit for detecting drug resistance in breast cancer according to claim 1, characterized in that, The kit also includes a reverse transcription reaction system and a real-time PCR reaction system.

4. The kit for detecting drug resistance in breast cancer according to claim 3, characterized in that, The detection method of the kit includes the following steps: (1) RNA was extracted from the sample; (2) The RNA extracted in step (1) is reverse transcribed into cDNA using a reverse transcription reaction system; (3) The cDNA obtained in step (2) is used in a real-time PCR reaction system to detect the expression level of the NOL7 gene by using primer pairs for amplifying the NOL7 gene and primer pairs for amplifying the internal reference gene β-actin.

5. A kit for detecting drug resistance in breast cancer according to claim 4, characterized in that, The sample is breast cancer tissue or cells.

6. The use of the kit for detecting drug resistance in breast cancer according to any one of claims 1-5 in the preparation of products for detecting chemotherapy resistance in breast cancer.

7. The application according to claim 6, characterized in that, The product in question is a paclitaxel-resistant product.

Citation Information

Patent Citations

  • Preserving solution for maintaining activity of mesenchymal stem cells in transportation and preparation method thereof

    CN107372464A

  • Marker for breast cancer docetaxel chemotherapy resistance and detection kit

    CN113528655A

  • Methods and kits for determining the risk of breast cancer recurrence

    US20230143295A1