PGK1 K6 site succinylation modification and application

Abstract

The invention belongs to the field of biological medicine, and particularly relates to PGK1 K6 site succinylation modification and application. Experiments show that the 6th lysine of the PGK1 protein has succinylation modification (PGK1 K6su), and the existence of the succinylation modification at the 6th lysine is confirmed through immunoprecipitation experiments; cell function experiments prove that the PGK1 K6su enhances lung cancer cell migration and multiplication capacity and promotes lung cancer progression. A small molecule compound diammonium glycyrrhizinate aiming at the PGK1 K6 site is further obtained through computer-assisted screening, and subsequent experiments find that the compound can inhibit proliferation and migration of lung cancer cells by reducing the succinylation modification level of the lung cancer cells PGK1 K6.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and in particular to succinylation modification of PGK1 K6 site and its application. Background Technology

[0002] Globally, lung cancer is the most frequently diagnosed malignant tumor, the leading cause of cancer death in men, and the second leading cause of cancer death in women. Due to the lack of obvious early symptoms and specific diagnostic methods and screening tools, most patients are diagnosed at an advanced stage, missing the optimal treatment window. Lung cancer can be divided into non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC), with NSCLC being the predominant type, accounting for 85% of cases. High-risk groups mainly include smokers, those exposed to smoke, and those in toxic occupational environments. Genetic susceptibility is also a factor; for example, mutations in BRCA2 and CHEK2 increase susceptibility. Lung cancer progression involves alterations in multiple genes; for instance, in recent years, brain metastases from lung adenocarcinoma with epidermal growth factor receptor (EGFR) mutations and EML4ALK1 rearrangements have become increasingly common. Although surgical intervention, radiotherapy, chemotherapy, and targeted therapy have made some progress, the five-year survival rate of lung cancer is among the lowest of all cancer types due to its insidious onset and high metastasis rate. Therefore, by conducting in-depth research on the causes and molecular mechanisms of lung cancer progression, and exploring potential diagnostic and therapeutic targets, more targeted drugs can be developed, thereby improving the treatment effect of the disease.

[0003] Post-translational modifications (PTMs) can occur on specific amino acids within the regulatory domains of target proteins, thereby controlling protein stability. PTMs are covalent, enzymatic, or non-enzymatic bindings of specific chemical groups to amino acid side chains. Although the total number of known types of PTMs far exceeds 300, the most studied non-protein PTMs are enzymatic phosphorylation, acetylation, palmitoylation, glycosylation, and succinylation, as well as non-enzymatic glycosylation and nitrosation. PTMs can also consist of individual polypeptide or protein domains linked by isopeptide bonds. In human diseases, various PTMs regulating protein stability occur sequentially and / or synergistically, playing a crucial role in initiating, terminating, or fine-tuning signaling pathways. Lysine succinylation, which involves adding a succinyl group to a lysine residue, is a chemical group modification. Due to its significant mass transfer, it may have a greater impact on protein structure and function. Succinylation has become a key regulator of metabolic pathways in many organisms. This modification involves the transfer of an ε-amino group (-CO-CH2-CH2-CO-) from succinyl-CoA to a lysine residue of the target protein. The transfer of the succinyl group can be catalyzed by succinyltransferase or a non-enzymatic method.

[0004] Phosphoglycerate kinase 1 (PGK1) is a key enzyme in the aerobic glycolysis pathway. PGK1 catalyzes the reversible phosphate group transfer between 1,3-bisphosphoglycerate and ADP, generating 3-phosphoglycerate and ATP. PGK1 is the only enzyme encoded by the X chromosome and involved in the first step of ATP production in the glycolysis pathway. In aerobic glycolysis in cancer cells, PGK1 and pyruvate kinase M2 (PKM2) are the only two enzymes controlling ATP production. Besides its role in regulating cellular metabolism, PGK1 is also involved in various biological activities, including angiogenesis, autophagy, and DNA repair. Due to its diverse functions, the role of PGK1 in cancer is complex. Therefore, exploring PGK1 targets and potential small molecule inhibitors can provide new strategies for future clinical diagnosis and treatment. Summary of the Invention

[0005] This invention discovered succinylation modification at the K6 site of PGK1 through proteomic analysis of lung cancer cells. PGK1 is a key enzyme involved in the glycolysis pathway, playing a crucial role in intracellular glycolysis and energy metabolism. Investigating the biological function and mechanism of PGK1 succinylation modification in cancer holds promise for providing new targets for the diagnosis and treatment of lung cancer.

[0006] In order to overcome the shortcomings of existing lung cancer treatment methods, this invention provides a target for lung cancer treatment and the application of its corresponding small molecule compound.

[0007] This invention is achieved through the following technical solution: In a first aspect, the present invention provides a succinylation modification at the K6 site of PGK1, wherein the PGK1 protein has a succinylation modification at the 6th lysine residue, PGK1 K6su.

[0008] Secondly, the present invention provides an inhibitor, which is diammonium glycyrrhizate, and diammonium glycyrrhizate targets the succinylation modification of the PGK1K6 site.

[0009] Thirdly, the present invention provides an inhibitor, diammonium glycyrrhizate, which inhibits lung cancer by suppressing succinylation modification at the PGK1 K6 site.

[0010] Fourthly, this invention provides a method for predicting the covalent binding sites and binding modes between the inhibitor diammonium glycyrrhizate and PGK1K6su via covalent docking.

[0011] Fifthly, this invention provides the application of diammonium glycyrrhizate as a covalent probe targeting the PGK1 K6 site.

[0012] Compared with the prior art, the advantages of this invention are that it experimentally discovered that the PGK1 protein has a succinylation modification at the 6th lysine residue (PGK1 K6su), and for the first time confirmed the existence of this modification in a PGK1 K6su-deficient lung cancer cell line by immunoprecipitation of PGK1. Furthermore, it was found that the compound diammonium glycyrrhizate can covalently bind to the PGK1 K6 site, reducing the level of succinylation modification at this site and inhibiting lung cancer progression. Attached Figure Description

[0013] The invention will now be further described with reference to the accompanying drawings.

[0014] Figure 1 To analyze potential succinylation modification sites of PGK1 by immunoprecipitation of endogenous PGK1 in lung cancer cell lines NCI-H157 and NCI-H1299; Figure 2 To reintroduce wild-type PGK1 or its mutant K6R into PGK1 knockdown NCI-H157 and NCI-H1299 cell lines, the expression level of PGK1 was detected by Western blot. Figure 3 To immunoprecipitate PGK1 in NCI-H157 and NCI-H1299 cell lines, a pansuccinylation modification antibody was used, and the expression and succinylation modification level of PGK1 in PGK1 K6su-deficient cells and control cells were detected by Western Blot. Figure 4 Transwell assays were performed using PGK1 knockdown, K6 succinylation modification-deficient, and control cell lines; among which... Figure 4 In Figure A, the number and morphology of migrating cells across the Transwell chamber membrane are observed in NCI-H57 cells. Figure 4 In the middle B, the number and morphology of migrating cells across the Transwell chamber membrane are shown for NCI-H299 cells. Figure 4 The bar chart in section C represents the number of migrating cells crossing the Transwell chamber membrane for NCI-H299 cells. Figure 4 The bar chart in D shows the number of migrating cells that cross the Transwell chamber membrane for NCI-H57 cells. Figure 5 To perform CCK-8 experiments using PGK1 knockdown, K6 succinylation modification-deficient, and control cell lines, among which... Figure 5 Cell A is an NCI-H57 cell. Figure 5 B is an NCI-H299 cell. Figure 6 To determine the effective concentration of the compound acting on PGK1 K6 using IC50 assays; Figure 7 To treat wild-type lung cancer cell lines with screened small molecule compounds and to immunoprecipitate endogenous PGK1 in lung cancer cell lines NCI-H1299 and NCI-H157, the PGK1 succinylation level was detected by pansuccinylation antibody. Figure 8 The compound is glycyrrhizic acid diammonium, which binds to PGK1 K6 in a specific mode; among which, Figure 8 A in the diagram is an overall view showing the binding position of diammonium glycyrrhizate with PGK1. Figure 8 B is a 3D partial view of the position of diammonium glycyrrhizate in the PGK1 structure. Figure 8 China A and Figure 8 In compound B, diammonium glycyrrhizate carbon atoms are shown in green, oxygen atoms in red, nitrogen atoms in blue, sulfur atoms in yellow, and protein carbon atoms in gray. Figure 8 The middle C is a 2D partial view of the position of diammonium glycyrrhizate in the PGK1 structure. The green and blue arrows represent hydrogen bond interactions, and the black solid lines represent covalent bonds. Figure 9 Transwell assays were performed using diammonium glycyrrhizate to treat PGK1 K6su-deficient cells and control cells, respectively; among which... Figure 9 Image A shows the cell morphology of NCI-H57 cells in a Transwell migration assay. Figure 9 Image B shows the cell morphology of NCI-H1299 cells in a Transwell migration assay. Figure 9 The graph in C represents the statistical results of the Transwell migration assay for NCI-H57 cells. Figure 9 D in the middle is a statistical graph of the Transwell migration experiment of NCI-H1299 cells; Figure 10 To perform CCK-8 assays, PGK1 K6su-deficient cells and control cells were treated with diammonium glycyrrhizate, respectively. Figure 10 Cell A is an NCI-H57 cell. Figure 10 B is an NCI-H1299 cell. Detailed Implementation

[0015] The invention will now be further described with reference to the accompanying drawings.

[0016] Example 1

[0017] Identification and analysis of PGK1 succinylation modification sites in lung cancer cells I. Enrichment of PGK1 protein in lung cancer cells by immunoprecipitation Lung cancer cells were lysed using RIPA weak lysis buffer (Beyotime, P0013D), and total protein was extracted. PGK1 antibody (Proteintech, 17811-1-AP) was added to the protein supernatant, and the mixture was incubated overnight at 4°C with shaking. After washing with PBS (pH 7.4) buffer, proteins were separated by SDS-PAGE (polyacrylamide gel electrophoresis). Following electrophoresis, the gel was stained with Coomassie Brilliant Blue rapid staining solution (Yamei, PS111) for 20-30 min, destained, photographed, and the target band was cut for subsequent mass spectrometry analysis. Simultaneously, the expression and enrichment results of endogenous PGK1 were validated by Western blotting using PGK1 antibody.

[0018] II. Identification of succinylation modification sites in PGK1 protein using mass spectrometry (commissioned to BGI Genomics Co., Ltd., Shenzhen). The target band PGK1 was cut off with a scalpel blade, and the gel strip was shredded. The gel was then decolorized using 50% acetonitrile containing 50 mM ammonium bicarbonate (NH4HCO3). The gel was incubated at 37°C for 60 min using a 10 mM dithiothreitol solution. After removing the liquid phase, iodoacetamide was added to a final concentration of 55 mM, and the gel was incubated at room temperature in the dark for 45 min. Finally, the gel was resuspended in 50 mM ammonium bicarbonate containing 10 ng / μL trypsin. The enzymatically digested peptides were extracted sequentially using 50% acetonitrile / 5% formic acid and 100% acetonitrile to extract the gel fragments. The peptide solutions were then freeze-dried and stored for later use. Secondary mass spectrometry data were searched using Proteome Discoverer 2.4. The search parameters were set as follows: the database was set to the target protein sequence; the enzyme digestion method was set to Trypsin / P; the variable modifications were set to methionine oxidation, protein N-terminal acetylation, lysine acetylation, crotonylation, succinylation, ubiquitination, and trihydroxybutyrylation; the peptide ion score was required to be higher than 20, and the identification result peptide confidence was set to High.

[0019] III. Construction of cell lines lacking PGK1 knockdown and K6 succinylation modification (a) Construction of PGK1 knockdown plasmid based on lentivirus technology: shPGK1 knockdown plasmid was designed and constructed based on the analysis of conserved structural functional domains of PGK1 protein.

[0020] (ii) The PGK1 knockdown plasmid constructed above was transfected into lung cancer cells. After 48 hours, puromycin (White Shark, BS111) was added to select cells. After further cell expansion, the cells were harvested and lysed, and the PGK1 knockdown efficiency was detected by Western blotting.

[0021] (III) Construction of lentiviral overexpression plasmids of PGK1 and its K6 site mutation: Forward and reverse amplification primers were designed based on its CDS sequence. The PGK1 expression sequence was obtained by PCR amplification and ligated into the pLVX vector to obtain the lentiviral plasmid pLVX-PGK1 WT expressing PGK1. In addition, PGK1 K6 site mutation primers were designed (forward primer (as shown in SEQ ID NO:1): ATGTCGCTTTCTAACAGGCTGACGCTGGACAAGCTGGAC and reverse primer (as shown in SEQ ID NO:2): AGTCCAGCTTGTCCAGCGTCAGCCTGTTAGAAAGCGACAT) to mutate the lysine at position 6 of PGK1 to arginine, constructing the plasmid pLVX-PGK1 K6R with PGK1K6 succinylation modification deletion.

[0022] (IV) Construction of PGK1 K6 succinylation-deficient cell lines: HEK293T cells were seeded in 10 cm culture dishes and allowed to reach 70-80% confluence. The target plasmid (pLVX-PGK1 WT or pLVX-PGK1 K6R): PSPAX2: PMD2G = 12 μg: 9 μg: 3 μg was dissolved in 1.5 mL of opti-mem medium. Separately, 72 μL of PEI reagent was dissolved in 1.5 mL of opti-mem medium. After standing for 5 min, the two solutions were mixed and stood for 15 min, then added to HEK293T cells. After 48 h, the viral supernatant was collected, filtered through a 0.22 μm filter, and added to the PGK1 knockdown lung cancer cells constructed above. After 12-16 h, the medium was replaced with fresh medium. After culturing for 48 h, puromycin (White Shark, BS111) was added to screen for stable expression cell lines.

[0023] (v) Detection of PGK1 expression level in the above-constructed cell lines: The above-constructed PGK1 K6su-deficient and control cells were lysed using RIPA strong lysis buffer, and total protein was extracted. The expression level of PGK1 was detected by Western Blot experiment.

[0024] The results are as follows Figure 4-5 As shown in the figure, this invention successfully constructed a lung cancer cell line with PGK1 knockdown and K6 succinylation modification deficiency.

[0025] IV. Verification of PGK1 K6 succinylation modification in lung cancer cell lines NCI-H157 and NCI-H1299 PGK1 knockdown, K6, and control cell lines were lysed using RIPA weak lysis buffer. Total protein was extracted, and PGK1 antibody (Proteintech, 17811-1-AP) was added and incubated overnight at 4°C. The cells were washed with PBS and denatured. Western blotting was performed, and PGK1 expression and the level of PGK1 K6su deletion succinylation modification were detected using pansuccinylation antibody (Aibotek, A20503).

[0026] The results are as follows Figure 1-3 As shown in the figure, it can be seen that succinylation modification was found at position K6 of PGK1 in this implementation case, and K6 is the key site for succinylation modification of PGK1.

[0027] Example 2

[0028] The effect of PGK1 K6 succinylation deficiency on lung cancer progression I. Transwell assay to detect the effect of PGK1 K6 succinylation deletion on lung cancer cell migration: PGK1 K6su-deficient cells and control cells in logarithmic growth phase were digested and passaged, and cell counts were performed. Cells were resuspended in serum-free medium and added to the upper chamber of the Transwell apparatus, while complete medium was added to the lower chamber. Cells were incubated at 37°C for 20-24 hours. After the cells passed through the Transwell wells and extended, the medium was discarded, the cells were washed three times with PBS, fixed at room temperature for 30 min, stained with diluted crystal violet solution for 10 min, rinsed with double-distilled water, and allowed to air dry. The number of cells passing through the wells was counted and analyzed.

[0029] The results are as follows Figure 6 As shown in the figure, PGK1 K6 succinylation modification promotes lung cancer cell migration.

[0030] II. CCK-8 and Colony Formation Assays to Detect the Effect of PGK1 K6 Succinylation Deletion on Lung Cancer Cell Proliferation: PGK1 K6su-deficient cells and control cells in logarithmic growth phase were digested and passaged, and cell counts were performed. Cells were then added to 96-well plates and cultured at 37°C. The following procedures were performed at 0, 24, 48, and 72 hours: The culture medium was discarded, the cells were washed three times with PBS, and cultured in medium containing 10% CCK8 for 2 hours. OD450 values ​​were measured using a microplate reader and statistically analyzed. After counting, the cells were added to 6-well plates and cultured at 37°C. Complete culture medium was replaced every 3-5 days. After 14 days, the culture medium was discarded, the cells were washed with PBS, fixed with 4% paraformaldehyde, stained with crystal violet, photographed, and cell colonies were counted.

[0031] The results are as follows Figure 7 As shown in the figure, PGK1 K6 succinylation modification promotes lung cancer cell proliferation. Figure 8 It can be seen that the compound diammonium glycyrrhizate can bind covalently to the K6 site of PGK1.

[0032] Example 3

[0033] The compound diammonium glycyrrhizate inhibits lung cancer progression by reducing the succinylation level of PGK1 K6. I. Processing of target protein structure The PGK1_HUMAN protein structure was optimized using the Protein Preparation Wizard module in Schrödinger software, including bond order optimization, hydrogenation, disulfide bond allocation, and protonation at pH 7.0 using the PROPKA method. OPLS4 force field confinement energy optimization was then performed to eliminate interatomic conflicts, bringing the RMSD of heavy atoms to 0.3 Å. Side chain position optimization yielded a favorable side chain structure. The prepared structure was saved as Protein.pdb and used as the receptor file for subsequent virtual screening.

[0034] II. Preparation of Small Molecule Compound Libraries This virtual screening of the TargetMol compound library (T001) was conducted. First, the Schrödinger algorithm was used. The LigPrep module (LigPrep, Schrödinger, LLC, New York, NY, 2021) in the software processes the compound library, using the Epik method at pH 7.0±2.0 for protonation, desalting, and generation of tautomers while preserving the original atomic chirality. To ensure the global conformation of small molecules during virtual screening, conformation generation is performed on each small molecule, with a maximum of 32 conformations generated per molecule. The prepared compound library is used as a ligand file for subsequent virtual screening.

[0035] III. Screening Process Import the prepared receptor and ligand files, perform covalent docking using CovalentDocking, and set amino acid number 6 (K6) as the reaction residue. There are 12 reactions involving lysine, namely: Michael Addition; Nucleophilic addition to a double bond; Nucleophilic Addition to a Triple Bond Nucleophilic Substitution Boronic Acid Addition Epoxide Opening; Phosphonate Addition; Beta-lactam Addition; Conjugate Addition to Alkene (nitrile activated) Conjugate Addition to Alkyne (carbonyl activated) Conjugate Addition to Alkyne (aryl activated); Disulfide Formation.

[0036] The three reaction types were independently screened, with a maximum of 1000 docking conformations retained. The results were deduplicated to retain the unique structure of the compound in each reaction type, and the results of different reactions were then checked.

[0037] After screening for covalent molecular docking, docking scoring analysis of 12 reaction types yielded results. Only Imine Condensation produced 540 conformations; Nucleophilic Substitution produced 657 conformations, and Ion Pair to Covalent Bond: Lig(-1) / Rec(+1) produced 669 conformations. The remaining reactions failed to dock successfully. Each reaction type was sorted by docking score. After deduplication, the number of conformations was 718. The most numerous were Ion Pair to Covalent Bond: Lig(-1) / Rec(+1) (358 molecules), Imine Condensation (154 molecules), and Nucleophilic Substitution (206 molecules). Molecules with a score less than -3 kcal / mol exhibiting the Michael Addition reaction (58 molecules) have the highest score (lower scores indicate better results). A total of 113 molecules across the 12 reaction types have a score less than -3 kcal / mol.

[0038] This invention employs covalent molecular docking to perform virtual screening of the TargetMol compound library (T001). After deduplication and desalting of molecules, unique structures are retained, and 86 molecules with docking scores less than -5 kcal / mol are output.

[0039] Given that diammonium glycyrrhizate can covalently bind to the PGK1 K6 site without binding to PGK1 K6su, it can serve as a covalent probe targeting the PGK1 K6 site, further supporting proteomics, signaling pathways, and post-translational modification proteomics. Furthermore, to ensure specificity, hydrogen bond donors / receptors are introduced into the diammonium glycyrrhizate backbone. Specifically, after antibody captures serum PGK1 on a solid-phase support, diammonium glycyrrhizate is added for incubation. To avoid non-specific binding of some serum proteins by the solid-phase support, diammonium glycyrrhizate covalently targets the PGK1 K6 site. Structural optimization of the hydrogen bond donor / receptor on the backbone, combined with an experimental procedure of diammonium glycyrrhizate backbone + hydrogen bond anchoring groups + controllable electrophilic reactive groups, enables specific recognition of PGK1 without K6su modification, significantly reducing the background of non-specific binding of serum proteins, thereby distinguishing between K6su-type and K6su-free PGK1.

[0040] The experimental procedure is as follows: Anti-PGK1 antibody was coated onto a solid phase (magnetic beads / 96-well plate); only PGK1 in the serum was captured, followed by rigorous washing to remove most of the free serum proteins; Add a modified diammonium glycyrrhizate covalent probe (with hydrogen bond orientation) It only covalently binds to PGK1 K6; it does not bind to K6su, K6 mutants, or other proteins. Wash again with strong water Wash away all non-covalently adsorbed probes Detection signal (fluorescence / biotin / enzyme labeling) Signal = Unmodified SU's PGK1 K6 level V. The IC50 assay was used to analyze the effective concentration of compounds required to inhibit half of cell viability at different concentrations: PGK1 wild-type cells in logarithmic growth phase were digested and passaged, and cell counts were performed. The cells were then added to 96-well plates and cultured normally at 37°C. After 24 hours, compounds selected based on the scoring above (Sennoside A, Folic Acid, Diammonium Glycyrrhizinate, Rutin) were added to cells in a 0-600 μM concentration gradient, and the cells were cultured normally at 37°C. After 24 hours, the culture medium was aspirated, the cells were washed with PBS, and medium containing 10% CCK8 was added. The cells were incubated for 2 hours, and the OD450 value was measured using a microplate reader to calculate the IC50.

[0041] VI. Screening for compounds that inhibit PGK1 K6 succinylation modification: PGK1 wild-type cells were treated with the four compounds mentioned above. NCI-H157 and NCI-H1299 PGK1 wild-type and PGK1 K6 mutant cell lines were lysed using RIPA weak lysis buffer, and total protein was extracted. PGK1 antibody (Proteintech, 17811-1-AP) was added and incubated overnight at 4°C; followed by washing and denaturation with PBS. Western blotting experiments were performed, and PGK1 expression and PGK1 succinylation levels were detected using pansuccinylation antibody (Aibotek, A20503).

[0042] The results are as follows Figure 7 As shown in the figure, both diammonium glycyrrhizate and Rutin can significantly reduce the PGK1 K6 succinylation level. However, Rutin, as a flavonoid drug, has poor drug-like properties, exhibiting problems such as low bioavailability, rapid metabolism, and poor oral absorption. Therefore, diammonium glycyrrhizate was used as an inhibitor of PGK1 K6 succinylation modification.

[0043] VII. Transwell assay was used to detect the effect of diammonium glycyrrhizinate on the metastatic ability of lung cancer cells: PGK1 cells lacking succinylation modification and in logarithmic growth phase, along with control cells, were digested and passaged. Cell counts were performed, and cells were resuspended in serum-free medium and added to the upper chamber of a Transwell apparatus. Complete culture medium was added to the lower chamber, and the cells were incubated at 37°C for 24 hours. The culture medium was discarded, the cells were washed three times with PBS, fixed at room temperature for 30 min, stained with diluted crystal violet solution for 10 min, rinsed, air-dried, and photographed to count the number of cells that passed through the pores for analysis.

[0044] 8. CCK-8 assay was used to detect the effect of diammonium glycyrrhizate on the proliferation of lung cancer cells: PGK1 K6su-deficient cells and control cells in logarithmic growth phase were digested and passaged, and cell counts were performed. Cells were added to 96-well plates and incubated at 37°C. At time points of 0, 24, 48, and 72 hours, OD values ​​were measured using 10% CCK-8 reagent and a microplate reader at 450 nm.

[0045] The results are as follows Figure 9-10 As shown in the figure, diammonium glycyrrhizate can inhibit the metastasis and proliferation of lung cancer cells by inhibiting PGK1 K6 succinylation modification.

Claims

1. Succinylation modification of PGK1 at the K6 site, characterized in that, The PGK1 protein has a succinylation modification at lysine position 6, PGK1 K6su.

2. An inhibitor, characterized in that, The inhibitor is diammonium glycyrrhizinate, which targets the succinylation modification of the PGK1 K6 site as described in claim 1.

3. The inhibitor according to claim 2, characterized in that, The inhibitor suppresses lung cancer by inhibiting succinylation modification at the PGK1 K6 site.

4. The application of the inhibitor according to claim 2 as a covalent probe, characterized in that, Diammonium glycyrrhizinate targets the PGK1K6 site.

Images