Method for inducing and amplifying pMHC specific homologous TSCM
By inducing and expanding pMHC-specific homologous TSCM in vitro, the problem of TSCM cell expansion was solved, achieving highly efficient adoptive immunotherapy and GVHD relief, and providing a highly efficient source of TSCM cells for tumor or viral therapy.
Patent Information
- Application Number
- CN202411465220.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-18
- Publication Date
- 2026-04-21
AI Technical Summary
Existing technologies make it difficult to expand TSCM cells with good adoptive immunotherapy effects in sufficient quantities in vitro, while overcoming or alleviating GVHD. Furthermore, the use of autologous TSCM cells for adoptive immunotherapy has problems such as immune tolerance and poor treatment efficacy.
By preparing pMHC that presents a single antigenic peptide, the antigenic peptide is presented on the surface of monocytes using the HLAⅠ/IgG Fc fusion protein. The cells are then co-cultured with lymphocytes. The pMHC-specific homologous TSCMs are induced and expanded using glycogen synthase kinase-3β inhibitors and stimulants. A large number of pMHC-specific TSCM cells are then isolated and sorted.
Obtaining sufficient pMHC-specific allogeneic TSCM cells can overcome self-tolerance, kill specific target cells without killing non-target cells, alleviate GVHD, and have long-term survival and continuous antigen-specific killing function, making them suitable for adoptive immunotherapy of tumors or viruses.
Smart Images

Figure CN121896166A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of biotechnology and immunotherapy, specifically to a method for inducing amplification of pMHC-specific homologous T cells. SCM The method. Background Technology
[0002] Immunotherapy is widely recognized as one of the most active, promising, and effective methods in the 21st-century comprehensive treatment paradigm, capable of completely eradicating tumor cells or chronically virus-infected cells. CD8+ cytotoxic T lymphocytes (CTLs) play a crucial role in various immune responses, including those related to tumors, viral infections, organ transplantation, and autoimmune diseases. In recent years, adoptive immunotherapy strategies based on in vitro genetic modification to enhance the specific anti-tumor capabilities of autologous CTLs have shown rapid development, particularly CAR-T and TCR-T therapies. However, in clinical trials and applications, only 20-30% of patients have benefited. The main reasons are as follows: 1. CAR-T therapy has developed rapidly and achieved excellent results in the treatment of various hematologic malignancies, but it still faces significant challenges in treating solid tumors. Firstly, it requires overcoming the technical difficulties of finding targets within the dense structure of solid tumors. Secondly, common adverse reactions such as cytokine release syndrome (CRS), off-target effects, neurotoxicity, allergic reactions, graft-versus-host disease (GVHD), and tumor lysis syndrome also limit its clinical efficacy. 2. TCR is a specific receptor on the surface of T cells, which functions by recognizing the target cell surface antigen peptide / MHC-I molecular complex (pMHC). Generally, tumor cells and chronically virus-infected cells can activate T cells by presenting the antigen peptide / MHC-I molecular complex on their cell surface. However, these antigen peptides are often widely present self-antigens. During T cell maturation, T cells need to undergo a negative selection event, i.e., the selection for survival or clonal elimination is based on the affinity between the TCR on the T cell surface and the self-antigen peptide / MHC-I molecular complex. During this process, high-affinity CTLs targeting these self-antigen peptides are clonally eliminated, while the remaining low-affinity CTLs often exhibit clonal incompetence, making it extremely difficult to identify specific TCRs with high affinity for the self-antigen peptide / MHC-I molecule complex. Furthermore, low TCR expression rates and susceptibility to mismatches also hinder the efficacy of TCR-T in clinical applications. 3. In vitro genetically engineered CAR-T and TCR-T cells often utilize effector T cells (T cells) expanded by cytokines. EFF ), due to T EFF These are terminally differentiated T cells with short lifespans, making it difficult for them to survive long-term in the recipient and thus unable to continuously exert their killing function to completely eliminate tumor cells in the body.
[0003] Therefore, adoptive immunotherapy urgently needs antigen-specific T cells with minimal toxicity, good clinical compatibility, and the ability to survive long-term in vivo and continuously exert responses as seed cells, possessing long lifespan and self-renewal capabilities. SCM (Tmemory stem cells) are considered ideal candidates for cancer immunotherapy.
[0004] Immune memory is crucial for clearing antigens. Upon stimulation by the same antigen, a stronger response is rapidly generated, exhibiting higher proliferative capacity and antigen clearance ability. This memory can last for decades or even a lifetime. SCM These cells are the least differentiated subset of memory T cells in the T cell hierarchy, following a gradual differentiation pathway: T N →T SCM →T CM →T EM / EFF They can differentiate into central memory T cells (T cells) both in vivo and in vitro. CM Effector memory T cells (T cells) EM ) and terminal differentiation T EFF Human Tscm cells not only express T N Cellular markers, such as CCR7 + CD45RA + CD45RO - CD62L + CD27 + CD28 + and IL-7RA + (CD127), and also expresses memory T cell (TM cell) signature markers, including CD95. + IL-2Rβ + (CD122), CXCR3 + and LFA-1 + .
[0005] In 2011, Gattinoni et al. described T memory stem cells (T1). SCM This is a rare group of memory T cells, located in CD8. + The earliest T cell subsets to differentiate into T cells. Many studies have shown that T cells... SCM It possesses characteristics of both stem cells and memory T cells. Stem cell characteristics refer to the potential for self-renewal and differentiation, while memory T cell characteristics refer to the ability of T cells to re-stimulate with the same antigen. SCMCells rapidly proliferate and differentiate into effector T cells, mediating cytokine production and cytotoxic effects. These two characteristics endow T cells with... SCM These cells can survive long-term in vivo and differentiate into effector cells that can mediate responses, exerting a sustained anti-infection effect and eliminating tumor cells. Christopher et al. directly demonstrated in vivo the efficacy of transplanted T cells. SCM Cellular ratio T CM and T EM The cells have a stronger anti-tumor effect, reflected in T cells. SCM Cells were able to suppress tumor growth more sustainably and ultimately significantly improve overall survival (OS) in mice treated with melanoma. Therefore, T SCM The cells possess strong long-term persistence, proliferative capacity, and anti-tumor activity, making them ideal candidates for cancer immunotherapy and potentially useful for adoptive immunotherapy to eliminate tumors or chronic viral infections.
[0006] But autologous T SCM Adoptive immunotherapy often results in immune tolerance and poor treatment outcomes, while allogeneic T cells... SCM Adoptive immunotherapy requires overcoming GVHD; furthermore, regardless of the strategy, obtaining sufficient T cells is crucial. SCM Cells are a prerequisite for application. However, under physiological or pathological conditions, T... SCM The low frequency of T cells in peripheral blood makes it difficult to obtain sufficient quantities directly from donor peripheral blood, and this scarcity is one of the main obstacles to its clinical application. If it were possible to study and obtain T cells that can be sufficiently expanded in vitro and possess both good adoptive immunotherapy efficacy and the ability to overcome or alleviate GVHD, it would be beneficial. SCM The method to T SCM It is of great significance for adoptive immunotherapy. Summary of the Invention
[0007] To address the problems mentioned in the background art, this invention aims to provide a novel method for in vitro expansion of T cells that exhibit both good adoptive immunotherapy efficacy and the ability to overcome or alleviate GVHD. SCM Specifically, this invention provides a strategy for inducing the amplification of pMHC-specific homologous T cells. SCM The method can perform T in vitro SCM Sufficient amplification, the amplified T SCM It has good adoptive immunotherapy effects and can overcome or alleviate GVHD.
[0008] The technical solution of the present invention to solve the above-mentioned technical problems is as follows:
[0009] Firstly, this invention provides a method for inducing pMHC-specific homologous T cells. SCM The method includes the following steps:
[0010] a) Preparation of pMHC that presents a single antigenic peptide;
[0011] b) Sort lymphocytes and monocytes from the donor and attach the pMHC obtained in step a) to the surface of the sorted monocytes as stimulating cells.
[0012] c) The lymphocytes sorted in step b) are co-cultured with stimulatory cells in a medium containing an inhibitor of glycogen synthase kinase-3β to induce the production of pMHC-specific allogeneic T cells. SCM ;
[0013] d) The pMHC-specific homologous T obtained in step c) of the separation process SCM .
[0014] Secondly, this invention further provides a method for inducing amplification of pMHC-specific homologous T cells. SCM The method includes the following steps:
[0015] a) Preparation of pMHC that presents a single antigenic peptide;
[0016] b) Sort lymphocytes and monocytes from the donor and attach the pMHC obtained in step a) to the surface of the sorted monocytes as stimulating cells.
[0017] c) The lymphocytes sorted in step b) are co-cultured with stimulatory cells in a medium containing an inhibitor of glycogen synthase kinase-3β to induce the production of pMHC-specific allogeneic T cells. SCM ;
[0018] d) The pMHC-specific homologous T obtained in step c) of the separation process SCM And it was stimulated to amplify with a stimulant to obtain a large number of pMHC-specific homologous T cells. SCM .
[0019] According to the above protocol, the lymphocytes and monocytes can be derived from peripheral blood mononuclear cells (PBMCs) of the donor.
[0020] According to the above scheme, the pMHC that presents a single antigenic peptide is formed by the HLA I / IgG Fc fusion protein formed by the fusion expression of the heavy chain extracellular domain of HLA class I molecules and the IgG1CH1 region (IgG Fc), which replaces and binds a single restriction antigenic peptide.
[0021] The Fc fragment of the HLA-I / IgG Fc fusion protein can bind to the Fc receptor (FcγRI) on the surface of monocytes, "linking" pMHC to the monocyte surface. This allows monocytes to present a single restriction antigen peptide, which then acts as a stimulus to induce lymphocytes to produce pMHC-specific allogeneic T cells. SCM .
[0022] According to the above scheme, the HLA class I molecules are selected from any of the following:
[0023] HLA-A1, HLA-A2, HLA-A203, HLA-A210, HLA-A3, HLA-A9, HLA-A10, HLA-A11, HLA-A19, HLA-A23, HLA-A24, HLA-A2403, HLA-A25, HLA-A26, HLA-A28, HLA-A29, HLA-A30, HLA-A31, HLA-A32, HLA-A33, HLA-A34, HLA-A36, HLA-A43, HLA-A66, HLA-A68, HLA-A69, HLA-A74, HLA-A80;
[0024] HLA-B5, HLA-B7, HLA-B703, HLA-B8, HLA-B12, HLA-B13, HLA-B14, HLA-B15, HLA-B16, HLA-B17, HLA-B18, HLA-B21, HLA-B22, HLA-B27, HLA-B2708, HL A-B35, HLA-B37, HLA-B38, HLA-B39, HLA-B3901, HLA-B3902, HLA-B40, HLA-B41, HLA-B42, HLA-B44, HLA-B45, HLA-B46, HLA-B47, HLA-B48, HLA-B49, HLA-B50, HLA-B51, HLA-B5102, HLA-B5103, HLA-B52, HLA-B53, HLA-B54, HLA-B55, HLA-B56, HLA-B57, HLA-B58, HLA-B59, HLA-B60, HLA-B61, HLA-B6 2. HLA-B63, HLA-B64, HLA-B65, HLA-B67, HLA-B70, HLA-B71, HLA-B72, HLA-B73, HLA-B75, HLA-B76, HLA-B77, HLA-B78, HLA-B81, HLA-BW4, HLA-BW6;
[0025] According to the above scheme, the restriction antigenic peptide is a viral antigenic peptide or a tumor antigenic peptide.
[0026] According to the above scheme, the restriction antigenic peptide is selected from, but not limited to, any of the following, and the HLA class I molecules corresponding to each antigenic peptide are shown in the table below:
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037] According to the above scheme, the selection criteria for donors in step a) are: select donors who are serotype-negative and correspond to HLA class I molecules in the HLA I / IgG Fc fusion protein that forms pMHC.
[0038] According to the above scheme, the ratio of effector cells to stimulator cells in step c) is 5 to 20:1.
[0039] According to the above scheme, the concentration of glycogen synthase kinase-3β inhibitor in step c) is 2.5 μM-7.5 μM, and the co-culture time is 7-10 days, preferably 7-8 days.
[0040] Following the above protocol, pMHC-specific homologous T cells were induced and amplified. SCM In the method, step d) is a two-step amplification method, which includes two steps:
[0041] d.1) Use flow cytometry to separate proliferating cells from the co-culture system;
[0042] d.2) Add the sorted proliferating cells to a solution containing T SCM Cultured in a culture medium containing stimulants to stimulate T SCM Amplification to generate large amounts of pMHC-specific homologous T cells SCM .
[0043] According to the above scheme, the lymphocytes sorted in step a) are first subjected to fluorescent staining before co-culturing.
[0044] According to the above scheme, the T SCM The stimulants are a combination of IL-7, IL-15 and N-acetylcysteine.
[0045] According to the above scheme, the concentrations of IL-7, IL-15 and NAC are 5ng / ml~25ng / ml, 5ng / ml~25ng / ml and 0.5mM~3mM, respectively.
[0046] The beneficial effects of this invention are:
[0047] 1) This invention can obtain sufficient amounts of pMHC-specific homologous T cells. SCM Cells can overcome their own tolerance and meet the needs of adoptive immunotherapy; this pMHC-specific allogeneic T cell... SCM It can be induced to differentiate into specific effector cells (T cells). EFF It possesses pMHC-specific cytotoxic activity, capable of killing target cells presenting this pMHC without killing cells not presenting this pMHC, thereby effectively avoiding or mitigating GVHD, and T SCM It possesses stem cell characteristics, allowing it to survive and differentiate long-term within the recipient's body, thus continuously exerting its effects.
[0048] 2) The method of the present invention is simple to operate and has high induction and amplification efficiency;
[0049] 3) This invention induces pMHC-specific homologous T cells. SCM The method is versatile and flexible, stimulating cells to connect different pMHC molecules and inducing the amplification of the same T cells. SCM The specificity of pMHC varies. For different tumors or viruses, different bridging pMHCs can be selected to control the induced amplification of pMHC-specific allogeneic T cells targeting different targets. SCM They are then used for adoptive immunotherapy of the corresponding tumors or viruses. Attached Figure Description
[0050] Figure 1 The sequencing results of the HLA-A2 / IgG1FC fusion gene in Example 1 of this invention;
[0051] Figure 2 The sandwich ELISA identification results of the fusion protein HLA-A2 / IgG1FC in Example 1 of this invention;
[0052] Figure 3 The conformational identification results of the fusion protein HLA-A2 / IgG1FC in the concentrated sample of Example 1 of this invention;
[0053] Figure 4 The results of Western blot analysis of the fusion protein HLA-A2 / IgG1FC in Example 1 of this invention;
[0054] Figure 5 This is the ELISA quantitative detection result of the fusion protein HLA-A2 / IgG1FC in Example 1 of the present invention, wherein... Figure 5 In the figure, A represents the standard curve for human IgG, and B represents the content of the fusion protein HLA-A2 / IgG1FC in the concentrated sample.
[0055] Figure 6 The HLA-A2 after loading in Embodiment 3 of the present invention - Results of HLA-A2 molecule binding rate detection on monocyte surface;
[0056] Figure 7 This is the detection of lymphocyte celltrace labeling in Example 3 of the present invention, where A is before PBMC celltrace labeling and B is after sorted lymphocyte celltrace labeling;
[0057] Figure 8 This refers to the cell sorting strategy and purity detection for proliferating cells in Example 5 of the present invention, where A represents the sorting strategy and B represents the sorting purity.
[0058] Figure 9 The proliferating cells (pMHC-specific allogeneic T cells) in Example 5 of this invention SCM Amplification and proliferation curves;
[0059] Figure 10 CD3 before and after stimulation induction in Example 5 of this invention + CD8 + Changes in cell population phenotype, where A represents the selected CD3 cells. + CD8 + Cells, CD3 in unstimulated PBMCs on day 0 + CD8 + Cell population segmentation: B represents effector / stimulatory cell co-culture on day 7 of induction, CD3 + CD8 + Cell population grouping;
[0060] Figure 11 CD3 before and after stimulation induction in Example 5 of this invention + CD8 + Cell population and T SCM Tetramer frequency of cell population, where A is the Tetramer frequency before stimulation and B is the Tetramer frequency after stimulation;
[0061] Figure 12 In Example 5 of this invention, IL-2 induces T SCM Cells to T EFF The results of differentiation capacity testing, where A represents the result without 300 IU IL-2 induction, and B represents the result of T... SCM After induction with 300 IU IL-2 for 24 hours, C becomes T. SCMAfter induction with 300 IU IL-2 for 48 hours;
[0062] Figure 13 T in Embodiment 5 of the present invention SCM Results of cell self-renewal capacity test;
[0063] Figure 14 T in Embodiment 5 of the present invention SCM Results of detection of specific cytotoxic effects after IL-2-induced differentiation of cells. Detailed Implementation
[0064] The principles and features of the present invention are described below with reference to the accompanying drawings and specific embodiments. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention.
[0065] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0066] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention.
[0067] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This application specification and embodiments are merely exemplary.
[0068] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0069] T SCM It possesses the characteristics of stem cells and memory T cells, namely, the potential for self-renewal and differentiation, and upon re-stimulation by the same antigen, T cells... SCM Cells rapidly proliferate and differentiate into effector T cells, mediating cytokine production and cytotoxic effects. These two characteristics endow T cells with... SCMThese cells can survive long-term in vivo and differentiate into effector cells that can mediate responses, exerting a sustained anti-infection and tumor cell-clearing effect. In adoptive cell immunotherapy, transplanting T cells... SCM Cellular ratio T CM and T EM The cells have a stronger anti-tumor effect.
[0070] However, it is obvious that autologous T SCM Adoptive immunotherapy often results in immune tolerance and poor treatment outcomes, while allogeneic T cells... SCM Adoptive immunotherapy inevitably carries the risk of GVHD. Furthermore, regardless of the strategy employed, obtaining a sufficient amount of T cells is challenging. SCM Cells are a prerequisite for application. However, under physiological or pathological conditions, T... SCM Cells are present in a low frequency in peripheral blood, making it difficult to obtain sufficient quantities directly from donor peripheral blood.
[0071] This invention aims to provide a new way to obtain T SCM The strategy, on the one hand, is to obtain a sufficient amount of T SCM On the other hand, the obtained T SCM It needs to overcome immune tolerance and achieve good immunotherapy results, while also... SCM For adoptive immunotherapy, the ability to overcome or alleviate GVHD is also required. Based on this, in order to obtain T cells for adoptive immunotherapy... SCM Increase T SCM The activity, and avoid the preparation of T SCM For patients who develop GVHD after treatment, the inventors, through extensive research and exploration, have developed a new method for obtaining T... SCM The strategy proposes a method to induce T cells in allogeneic lymphocytes by using pMHC, which presents a single antigenic peptide, as a stimulating signal on the surface of monocytes. N Differentiation into T cells specific to a single pMHC SCM After sorting, amplification was performed to generate a large number of pMHC-specific homologous T cells through efficient in vitro amplification. SCM The method.
[0072] This method can be used to induce the generation of pMHC-specific allogeneic T cells. SCM After sorting, the samples are further amplified using stimulants to obtain a large number of pMHC-specific homologous T cells. SCM The obtained pMHC-specific homologous T SCM It can be used for adoptive immunotherapy targeting viruses or tumors. On one hand, this pMHC-specific allogeneic T... SCM It can be induced to differentiate into specific effector cells (T cells). EFFThis substance possesses pMHC-specific cytotoxic activity, capable of killing target cells that present pMHC without killing cells that do not present pMHC, thereby effectively preventing or mitigating GVHD. On the other hand, it induces allogeneic T cells... SCM It can overcome autoimmune tolerance and meet the requirements of adoptive immunotherapy for T cells. SCM The method meets the requirements for activity and has high induction and amplification efficiency, enabling it to induce and amplify sufficient quantities of pMHC-specific allogeneic T cells for adoptive immunotherapy. SCM .
[0073] Specifically, in a first aspect, the present invention proposes a method for inducing pMHC-specific homologous T cells. SCM The method includes the following steps:
[0074] a) Preparation of pMHC that presents a single antigenic peptide;
[0075] b) Sort lymphocytes and monocytes from the donor and attach the pMHC that presents a single antigenic peptide obtained in step a) to the surface of the sorted monocytes as the stimulating cells.
[0076] c) The lymphocytes sorted in step b) are co-cultured with stimulatory cells in a medium containing an inhibitor of glycogen synthase kinase-3β to induce the production of pMHC-specific allogeneic T cells. SCM ;
[0077] d) The pMHC-specific homologous T obtained in step c) of the separation process SCM .
[0078] Secondly, based on the above scheme, the inventors further proposed an induction amplification of pMHC-specific homologous T cells. SCM The method includes the following steps:
[0079] a) Preparation of pMHC that presents a single antigenic peptide;
[0080] b) Sort lymphocytes and monocytes from the donor and attach the pMHC that presents a single antigenic peptide obtained in step a) to the surface of the sorted monocytes as the stimulating cells.
[0081] c) The lymphocytes sorted in step b) are co-cultured with stimulatory cells in a medium containing an inhibitor of glycogen synthase kinase-3β to induce the production of pMHC-specific allogeneic T cells. SCM ;
[0082] d) The pMHC-specific homologous T obtained in step c) of the separation process SCM And it is stimulated to amplify with stimulants to produce a large number of pMHC-specific homologous T cells. SCM .
[0083] The prepared pHMC-specific homologous T SCM It can be used for adoptive immune cell therapy, with recipients (the subjects of treatment) being patients with viral infectious diseases or tumors that can deliver the above-mentioned target pHMC.
[0084] This invention induces and amplifies pMHC-specific homologous T cells. SCM The method used to prepare allogeneic T SCM The donor and the recipient are not the same person.
[0085] In some specific implementations, lymphocytes and monocytes are derived from donor peripheral blood mononuclear cells (PBMCs).
[0086] In some specific embodiments, the pMHC that presents a single antigenic peptide is formed by replacing the single restriction antigenic peptide with an HLA I / IgG Fc fusion protein formed by the fusion expression of the heavy chain extracellular domain of an HLA class I molecule and IgG Fc.
[0087] The aforementioned antigenic peptides are not specifically limited and may be antigenic peptides of viral origin or antigenic peptides of tumor origin.
[0088] Viral antigenic peptides include, but are not limited to, the following:
[0089] The targets of human immunodeficiency virus-1 (HIV-1) are QVPLRPMTY, KIQNFRVY, SLYNTVATL, KLTPLCVTL, TLNAWVKVV, RLRPGGKKK, RYLRDQQLL, GPGHKARVL, GEIYKRWII, ERYLKDQQL, KRWIILGLNK, KRWIIMGLNK, NPDIVIYQY, VPLDEDFRKY, VKNWMTETL, RQANFLGKI, KAFSPEVIPMF, TSTLQEQIGW, TSNLQEQIGW, and KAFLRPEVIPMF.
[0090] The targets are EBV, including TVCGGIMFL, TLTSYWRR; LLSCLTTPV, FLGERVTLT, KLGPGEEQV, YLLEMLWRL, CLGGLLTMV, FLYALALLL, LIVDAVLQL, TYGPVFMSL, PYLFWLAAI, ILLARLFLY, FTASVSTVV, RRWRRLTVC, RRRWRRLTV, RRLTVCGGIMF, MGSLEMVPM, and LPVIVAPYL.
[0091] The targets of cytomegalovirus (CMV) are YSEHPTFTSQY, NLVPMVATV, QYDPVAALF, HERNGFTVL, NVHHYPSAAER, HERNGFTVL, TPRVTGGGAM, RPHERNGFT, HERNGFTVL, QAIRETVEL, IPSINVHHY, RPHERNGFTVL, HERNGFTVL, QMWQARLTV, and IPSINVHHY.
[0092] The targets of hepatitis D virus (HDV) are KLEDLERDL, KLEDLERDL, QLAAGGKHL, DHRRRKALENKR, FPWDILFPA, SMQGVPESPF, DENPWLGNI, RRDHRRRKAL, RRRKALENKK, RRKALENK / R, ERRDHRRRKALE, QGFPWDILF, FPWDILFPA, GQGFPWDILFPS, VDSGPRKRPL, QDHRRRKAL, RERRVAGPPV, DENPWLGNI, and RGSQGFPW;
[0093] CLVDYPYRL, FLARLIWWL, WEYVLLLFL, YYKVFLARL, GLNAVAYYR, VLYEAFDEM, KYLFNWAVK, YLVAYQATV, ALYDVVTKL, CINGVCWTV, ALYDVVSKL, LLSCLTTPV, VLQAGLIRV, GFTGDFDSV, KFPPALPIW, EVIKGGRHL, ENLPYLVAY, EVVTSTWVL, DVVCCSMSY, ARMILMTHF are targets of hepatitis C virus (HCV).
[0094] The following are targets targeting the hepatitis B virus core protein (HBV CORE): MQLFHLCLI, FLPSDFFPSV, ELMNLATWV, YLVSFGVWI, AYRPPNAPI, ILSTLPETTV, MGLKFRQL, LLWFHISC, FLPSDFFPSV, DLLDTASALY, YVNVNMGLK, STLPETAVVRR, RTQSPRRRR, TLPETTVVRR, LWFHISCLTF, EYLVSFGVW, SYVNMNMGL, HISCLTFGR, LVSFGVWIR, and LPSDFFPSV.
[0095] RLCCQLDPA, PVSGPFGPL, AVPADHGAHL, HLSLRGLPV, (K)VLHKRTLGL, TLGLAAMST, GLSAMSTTDL, AMSTTDLEA, DLEAYFKDCL, CLFKDWEEL, ELGEEIRLKV, EIRLKVFVL, VLGGCRHKL(V), ALRFTSARRM, NAHQILPKV, ALRFTSARR, STTDLEAYFK, RGRPVSGPF, AFSSAGPCALRF, LPVCAFSSA, with the target being hepatitis B virus X protein (HBX);
[0096] LLDDEAGPL, PLEEELPRL, DLNLGNLN, NLGNLNVSI, GLYSSTVPV, NLQSLTNLL, LLSSNLSWL, NLSWLSLDV, HLLVGSSGL, LLAQFTSAI, SLNFMGYVI, GLCQVFADA, NLYVSLLLL, KLHLYSHPI, HLYSHPIIL, YMDDVVLGA, FLLSLGIHL, ALMPLYACI, PLPIHTAEL, IIGTDNSVV, LLGCAANWI, WILRGTSFV, ILRGTSFVYV, RLGLSRPLL, SLYADSPSV, LYSSTVPVF, QYVGPLTVN, ASFCGSPYSW, SWPKFAVPNL, RNLYVSLLL, KYTSFPWLLG, RKYTSFPWLL, KYTSFPWLL, NVSIPWTHK, KVGNFTGLY, HTLWKAGILYK, TLWKAGILY(K), VTGGVFLVDK, PVNRPIDWK, QAFTFSPTYK, TLWKAGILY(K), YMDDVVLGAK, LVYRPTTGR, RVTGGVFLVDK, SAICSVVRR, GTDNSVVLSR, LVVDFLHQFSR, VVDFSQFSR, TPARVTGGV(F), HPAAMPHLL, FFPHCLAFSYM, DPSRGRLGL, YPALMPLYA, ILGFRKIPM, FFPHCLAFSYM, YPALMPLYA, YPALMPLSA, with the target being hepatitis B virus POL protein (HBV POL);
[0097] The following are the targets of hepatitis B surface antigen (HBS): FLLTRILTI, NLLGWSPQA, LLDPRVRGL, VLQAGFFLL, FLLTRILTI, IPQSLDSWWTSL, FLGGTPVCL, ILLLCLIFL, LLLLCLIFLL, LLCLIFLLV, VLLDYQGML, LLDYQGMLP, LLDYQGMLPV, WLSLLVPFV, GLSPTVWLS, GLSPTVWLSV, SVIWMMWYW, SIVSPFIPLL, IVSPFIPLL, MMWYWGPSLY, PLGFFPDH, TTSTGPCK, TSMFPSCCCTK, SWWTSLNFL, SWLSLLVPF, RWMCLRRFII, RFSWLSLLVPF, LCLIFLVL, VGLSPTVWL, GYRWMCLRR, CPGYRWMCL, IPIPSSWAF, (L)SVIWMMWYW, SVIWMMWYW;
[0098] FLSFASLFL, RLMRTNFLI, KLTEAITAA, QTNAMVTLR, GVRLHPLAR, VSSGRNIKR, QTNAMVTLR, EVKKCDGVK, PVYRDHSEK, and RSTKGGQQK are targets of Ebola virus (EBOV).
[0099] The targets are dengue virus (DV) KLAEAIFKL, NIQTAINQV, VTLYLGVMV, GLLFMILTV, QLWAALLSL, APTRVVAAEM, and TPRMCTREEF;
[0100] The targets are human papillomavirus (HPV) YMLDLQPET, MLDLQPETT, LLMGTLGIV, TLGIVCPI, TIHDIILECV, CDSTLRLCV, LCVQSTHVDI, VYDFAFRDL, FAFRDLCIVY, HDIILECV, LEDLLMGTL, and TIHDIILEC.
[0101] Tumor-derived antigenic peptides include, but are not limited to:
[0102] SLWRLESKG and GQQTFSVKV target the BK ion channel (gBK) in gliomas, and WPFGFILI and WYEGLDHAL target the interleukin-13 receptor α2 (IL-13Rα2).
[0103] RMSAPSTGGV targets histone 3 variant 3 (H3.3);
[0104] GLLPDVPSL targeting lysophospholipid acetyltransferase 7 (MBOA7);
[0105] The following drugs target melanoma-associated antigen gp100 (gp100): ITQVPFSV, IMQVPFSV, YLEPGPVTA, KTWGQYWQV, VLYRYGSFSV, LLDGTATLRL, ALLAVGATK, SLIYRRRLMK, and VYFFLPDHL.
[0106] YLIRRIEEL, ALADKHATL, FLSRQLESL, and TLLNETESL are targets of transfer-associated protein-1 (MAT-1).
[0107] CYAGSGCPL and ETLSNVEVF target mammoglobulin-a (mam-A);
[0108] The targets are AWPFTCLPL, KVKRKKNVL, FPEPEAAQP, and VEVLVDLFL, which are preferentially expressed melanoma antigens (PRAMEs).
[0109] GLQLGVQAV, PLTEYIQPV, and SLLSGDWVL are type II transmembrane serine proteases (Hepsin).
[0110] TLVTVSSAS and LMISRPEV target the IgG heavy chain (immunoglobulin G heavy-chain);
[0111] FLDRFLSCM, SLIAAAAFCLA, and KVLAFDLTV are targets of cyclin A1.
[0112] AGYLMELCC targets cyclin B1.
[0113] STAPPVHNV, STPPVHNV, and LLLLTVLTV are targets of epithelial mucin MUC1 (MUC1).
[0114] RMFPNAPYL, YMFPNAPYL, SLGEQQYSV, CMTWNQMNL, and CYTWNQMNL are targets of Wilms tumor protein (WT1).
[0115] The targets of the tumor suppressor protein p53 (P53) are STPPPGTRV, VVPYEPPEV, LLGRNSFEV, GLAPPQHLIRV, RMPEAAPPV, KMFCQLAKT, KLLPENNVL, TYPALNKMF, AIYKQSQHM, and EYLDDRNTF.
[0116] EADPTGHSY, KVLEYVIKV, and other drugs targeting melanoma-associated antigen-1 (MAGE-1)
[0117] SAYGEPRKL, SQYGEPRKL, NYKHCFPEI, ITKKVADLVGF;
[0118] KMVELVHFL targets melanoma-associated antigen-2 (MAGE-2);
[0119] EVDPIGHLY, KVAELVHFL, FLWGPRALV, LVFGIELMEV, IMPKAGLLI, NYKHCFPEI, and EVDPIGHLY are targets of melanoma-associated antigen A3 (MAGE-A3).
[0120] GLYDGMEHL targets melanoma-associated antigen A10 (MAGE-A10);
[0121] The target is FLWGPRALA with MAGE-n;
[0122] KASEKIFYV targets synovial sarcoma X breakpoint 2 (SSX2);
[0123] Targets for HER-2 / neu include TYLPTNASL, RWGLLLALL, VWSYGVTVW, AVVGILLVV, KIFGSLAFL, QIAKGMSYL, ILHNGAYS, and RLLQETELV.
[0124] VLHKAFVEV and VLSGVLHKA are targets of squamous cell carcinoma antigen (SCCA).
[0125] TYACFVSNL, GVLVGVALI, and YLSGANLNL are targets of carcinoembryonic antigen (CEA).
[0126] The targets of prostate-specific antigen (PSA) are KLQCVDLHV, VISNDVCAQV, VLVHPQWVL, GLLVHPQWV, VISNDVCAQV, FLTPKKLQCV, CYASGWGSI, HYRKWIKDTI, and GAAPLILSR.
[0127] KVFRGNKVK and STEWAEENSR are targets of prostate-specific membrane antigen (PSMA).
[0128] FMNKFIYEI, PLFQVPEPV, GLSPNLNRFL, GVALQTMKQ, LLNQHACAV, and KWVESIFLIF are targets of alpha-fetoprotein (AFP).
[0129] KCDICTDEY, SSDYVIPIGTY, MLLAVLYCL, YMNGTMSQV, AFLPWHRLF, and SEIWRDIDF are tyrosinase-targeting enzymes.
[0130] The target is melanoma antigen 1, which is recognized by melanoma antigen A / T cells.
[0131] AAGIGILTV, EAAGIGILTV, AEEAAGIGILTV of (Melan-A / MART-1);
[0132] MSLQRQFLR targets tyrosinase-associated protein 1 (gp75 / TRP-1);
[0133] SVYDFFVWL, LLPGGRPYR, and EVISCKLIKR are targets of tyrosinase-associated protein 2 (TRP-2).
[0134] The target is MUM-1's EEKLIVVLF;
[0135] ACDPHSGHFV targets cyclin-dependent kinase 4 (CDK4);
[0136] The target is HQKRPIPIKY, which targets the toll-like receptor adaptor gene MYD88.
[0137] In this invention, the HLA-I molecules that can be used for the construction of HLA-I / IgG Fc fusion proteins are HLA-A and HLA-B, including HLA-A1, HLA-A2, HLA-A203, HLA-A210, HLA-A3, HLA-A9, HLA-A10, HLA-A11, HLA-A19, HLA-A23, HLA-A24, HLA-A2403, HLA-A25, HLA-A26, HLA-A28, HLA-A29, HLA-A30, HLA-A31, HLA-A32, HLA-A33, HLA-A34, HLA-A36, HLA-A43, HLA-A66, HLA-A68, HLA-A69, HLA-A74, and HLA-A80;
[0138] HLA-B5, HLA-B7, HLA-B703, HLA-B8, HLA-B12, HLA-B13, HLA-B14, HLA-B15, HLA-B16, HLA-B17, HLA-B18, HLA-B21, HLA-B22, HLA-B27, HLA-B2708, HLA-B 35. HLA-B37, HLA-B38, HLA-B39, HLA-B3901, HLA-B3902, HLA-B40, HLA-B41, HLA-B42, HLA-B44, HLA-B45, HLA-B46, HLA-B47, HLA-B48, HLA-B49, HLA-B50 , HLA-B51, HLA-B5102, HLA-B5103, HLA-B52, HLA-B53, HLA-B54, HLA-B55, HLA-B56, HLA-B57, HLA-B58, HLA-B59, HLA-B60, HLA-B61, HLA-B62, HLA-B63, H LA-B64, HLA-B65, HLA-B67, HLA-B70, HLA-B71, HLA-B72, HLA-B73, HLA-B75, HLA-B76, HLA-B77, HLA-B78, HLA-B81, HLA-BW4, HLA-BW6; HLA-C is not included in this technical limitation.
[0139] Specific HLA-I molecules can selectively bind antigenic peptides for TCR recognition via desired shared motifs. The restriction antigenic peptides they can bind and present are limited in length, typically 8–10 amino acid residues, as is well known to those skilled in the art. Therefore, the antigenic peptides corresponding to the HLA class I molecules listed above are shown in the table below:
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149] In a specific embodiment of the present invention, pMHC selects the HLA-A2-restricted antigenic peptide FLPSDFFPSV (HBC) of the hepatitis B virus. 18-27 As a single restriction antigenic peptide, the corresponding HLA-I / IgG Fc fusion protein is the HLA-A2 / IgG Fc fusion protein. This fusion protein is formed by fusing the extracellular domain (α1-α3 region) of the heavy chain of HLA-A2 with IgG Fc, and then replacing and binding the hepatitis B virus antigen peptide HBC. 18-27 This forms a relatively simple pMHC (HBC) 18-27 / HLA-A2 / IgG Fc). Those skilled in the art should know that, when using the present invention to prepare pMHC-specific allotransmitters... SCM During the process, different pMHC receptors on the cells are stimulated, inducing the amplification of the same type of T cells. SCM The pMHC specificity varies, therefore, the induced amplification of pMHC specificity targeting different targets can be controlled by flexibly selecting different pMHCs. SCM This allows it to be used for adoptive immunotherapy against different tumors or viruses. The preparation process is identical except for the selection of HLA class I molecules and their restriction antigenic peptides; there are no significant technical difficulties, and the preparation methods provided in the examples are also applicable.
[0150] Step a) The selection criteria for donors are: select donors whose serotype is negative for the HLA I class molecules corresponding to the HLA I / IgG Fc fusion protein that forms pMHC.
[0151] In a specific embodiment of the present invention, pMHC selects the hepatitis B virus antigen peptide HBC. 18-27As a single restriction antigenic peptide; the HLA class I molecule is HLA-A2. The extracellular domain (α1-α3 region) of the heavy chain of HLA-A2 is fused with IgG Fc to form the HLA-A2 / IgG Fc fusion protein; the HLA-A2 / IgG Fc fusion protein binds to the hepatitis B virus antigen peptide HBC through substitution. 18-27 This forms a relatively simple pMHC (HBC) 18-27 / HLA-A2 / IgG Fc); donor selection is HLA-A2 negative individuals, pMHC(HBC) 18-27 HLA-A2 / IgG Fc binds to the surface of HLA-A2-negative mononuclear cells.
[0152] Preferably, in step c), the ratio of effector cells to stimulator cells is 5 to 20:1.
[0153] Preferably, in step c), the concentration of the glycogen synthase kinase-3β inhibitor is 2.5 μM to 7.5 μM, and the co-culture time is 7 to 10 days; more preferably, the co-culture time is 7 to 8 days.
[0154] In some specific embodiments, the glycogen synthase kinase-3β inhibitor is TWS119.
[0155] The culture medium for co-culture can be a regular culture medium containing serum or a serum-free culture medium. In a specific embodiment of the present invention, the culture medium for co-culture is X-VIVO medium containing autologous serum. Those skilled in the art can also choose other existing culture systems as needed.
[0156] In some induced amplification pMHC-specific homologous T SCM In a specific implementation, step d) includes:
[0157] d.1) Proliferating cells in the co-culture system were separated using flow cytometry. The separated proliferating cells are pMHC-specific allogeneic T cells. SCM ;
[0158] d.2) Add the sorted proliferating cells to a solution containing T SCM Cultured in a culture medium containing stimulants to stimulate T SCM Massive amplification to generate large amounts of pMHC-specific homologous T cells SCM .
[0159] Step a) Before co-culturing the sorted lymphocytes, fluorescent staining is performed so that proliferating cells can be sorted out according to the principle of fluorescence decrement after fluorescent staining.
[0160] In some specific embodiments, the T SCM The stimulants are a combination of IL-7, IL-15 and N-acetylcysteine.
[0161] In some specific embodiments, the concentrations of IL-7, IL-15, and NAC are 5 ng / ml to 25 ng / ml, 5 ng / ml to 25 ng / ml, and 0.5 mM to 3 mM, respectively.
[0162] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.
[0163] The molecular biology experiments in the following examples include plasmid construction, enzyme digestion, ligation, preparation of competent cells, transformation, and culture medium preparation. These were primarily conducted in accordance with *Molecular Cloning: A Laboratory Manual* (3rd Edition), edited by J. Sambrook et al., published by Science Press. Specific experimental conditions could be determined through simple experiments if necessary. PCR amplification experiments were performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. Adjustments could be made through simple experiments if necessary.
[0164] In the following examples, the hepatitis B virus HLA-A2 restriction antigenic peptide HBC was used. 18-27 Taking (FLPSDFFPSV) as an example, HBC targeting the HLA-A2 restricted antigenic peptide of hepatitis B virus was prepared. 18-27 Specific homologous T SCM .
[0165] I. Construction and Expression of the Fusion Protein HLA-A2 / IgG1 Fc Dimer
[0166] Using gene recombination technology, the gene encoding the extracellular α1-α3 region of HLA-A2 was fused with the gene encoding the human IgG1CH1 (IgG1 Fc) region and inserted into the eukaryotic expression vector pcDNA3.1 to construct a eukaryotic expression vector for the fusion protein HLA-A2 / IgG1 Fc.
[0167] The simplified technical process is as follows: T2 cells are used as the source of the HLA-A2 extracellular segment gene; normal human PBMCs are used as the source of the gene encoding the IgG1 heavy chain constant region. The construction of the recombinant plasmid is carried out in two steps.
[0168] First, total RNA was extracted from T2 cells and RT-PCR was performed to obtain cDNA. The α1-α3 region gene of HLA-A2 was amplified by PCR using specific primers (HLA-A2 upstream primer P1 and HLA-A2 downstream primer P2). The extracellular segment gene of HLA-A2 was inserted into the plasmid vector PcDNA3.1 by molecular biology techniques such as Hind III and EcoRI digestion, purification, and T4 ligase ligation to obtain the PcDNA3.1+[HLA-A2] plasmid.
[0169] P1: 5'-CCCG AAGCTT ATGGCCGTCATGGCGCCC-3'(SEQ ID NO:1), the underlined part is the HindIII restriction site;
[0170] P2: 5-CGTA GAATTC GGAAGACGGCTCCCATCTCAGG-3'(SEQ ID NO:2), the underlined part is the EcoRI restriction site;
[0171] Then, total RNA was extracted from peripheral blood lymphocytes (PBMCs) of healthy individuals for RT-PCR to obtain cDNA. The IgG1 CH1-Fc fragment gene was amplified by PCR using specific primers (IgG1-Fc upstream primer P3 and IgG1-FC downstream primer P4). The IgG1 CH1-Fc fragment gene was then inserted into the PcDNA3.1+[HLA-A2] plasmid to form the HLA-A2 / IgG1 eukaryotic expression vector (PcDNA3.1+[HLA-A2 / IgG1] plasmid) using molecular biology techniques such as EcoRI and XhoI digestion, purification, and T4 ligase ligation.
[0172] P3: 5'-GGTC GAATTC TCCACCAAGGGCCCATCGGTC-3'(SEQ ID NO3), the underlined part is the EcoRI restriction site;
[0173] P4: 5'-GGAG CTCGAG TCATTTACCCGGAGACAGGGAGAG-3'(SEQ ID NO:4), the underlined part is the XhoI restriction site.
[0174] The nucleotide sequence of the α1-α3 regions of HLA-A2 is shown as SEQ ID NO:5: ATGGCCGTCATGGCGCCCCGAACCCTCGTCCTGCTACTCTCGGGGGCTCTGGCCCTGACCCAGACCTGGGCGGGCTCTCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAGGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGTCCGGAGTATTGGGACGGGGAGACACGGAAAGTGAAGGCCCACTCACAGACTCACCGAGTGGACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGCCGGTTCTCACACCGTCCAGAGGATGTATGGCTGCGACGTGGGGTCGGACTGGCGCTTCCTCCGCGGGTACCACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAAAGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGACCACCAAGCACAAGTGGGAGGCGGCCCATGTGGCGGAGCAGTTGAGAGCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGGACGCCCCCAAAACGCATATGACTCACCACGCTGTCTCTGACCATGAAGCCACCCTGAGGTGCTGGGCCCTGAGCTTCTACCCTGCGGAGATCACACTGACCTGGCAGCGGGATGGGGAGGACCAGACCCAGGACACGGAGCTCGTGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAAGTGGGCGGCTGTGGTGGTGCCTTCTGGACAGGAGCAGAGATACACCTGCCATGTGCAGCATGAGGGTTTGCCCAAGCCCCTCACCCTGAGATGGGAGCCGTCTTCC
[0175] The nucleotide sequence of the human IgG1 Fc fragment gene is shown in SEQ ID.NO:6 displays: TCCACCAAGGGCCCATCGGTCTTCCCCCTGGCACCCTCCTCCAAGAGCACCTCTGGGGGCACAGCGGCCCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGTCGTGGAACTCAGGCGCCCTGACCAGCGGCGTGCACACCTTCCCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCTCAGCAGCGTGGTGACCGTGCCCTCCAGCAGCTTGGGCACCCAGACCTACATCTGCAACGTGAATCACAAGCCCAGCAACACCAAGGTGGACAAGAAAGTTGAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCAGCACCTGAACTCCTGGGGGGACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCTGAGGTCACATGCGTGGTGGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGT GGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAGCCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGATGAGCTGACCAAGAACCAGGTCAGCCT GACCTGCCTGGTCAAAGGCTTCTATCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTAAATGA
[0176] To obtain higher protein expression levels and eliminate interference from MHC molecules and IgG expressed by the cells themselves, LCL 721.221 cells were selected as the expression cells. These cells are deficient in the expression of HLA class I heavy chains and IgG1 heavy chains, but highly express the light chain β2M of HLA class I molecules. The plasmid pcDNA3.1+[HLA-A2 / IgG1Fc] was transfected into LCL 721.221 cells via electroporation, and stably transfected cells with high expression were selected using a selective medium containing G418.
[0177] Monoclonal cells with the highest expression of the fusion protein HLA-A2 / IgG1 Fc were selected by monoclonalization and ELISA identification, named dimer-721.221, amplified and cryopreserved.
[0178] The translated amino acid sequence is correct. The base composition of the HLA-A2 / IgG1 Fc fusion gene is as follows: Figure 1 As shown.
[0179] W6 / 32 can recognize the conformation formed in the α2-α3 region after the heavy and light chains of HLA class I molecules bind, and is a conformational antibody for HLA class I molecules; anti-human IgG (H+L) antibody can recognize the IgG-Fc segment in the HLA-A2 / IgG1 fusion protein. Cell culture supernatant containing the HLA-A2 / IgG1 Fc fusion protein was obtained. A sandwich ELISA was performed using the antibody against the human IgG Fc segment and W6 / 32 to detect whether transfected 721.221 cells expressed the correctly conformated HLA-A2 / IgG1 Fc fusion protein. The identification results are as follows: Figure 2 As shown, sandwich ELISA tests of 1:10 and 1:20 dilutions of dimer-721.221 culture supernatant were positive, while ELISA tests of untransfected 721.221 cell supernatant were negative. This indicates that transfected dimer-721.221 cells can highly express the fusion protein HLA-A2 / IgG1 with the correct conformation.
[0180] Dimer-721.221 was amplified in large quantities to obtain cell culture supernatant containing the fusion protein HLA-A2 / IgG1 Fc, which was then concentrated by ultrafiltration using a 30kDa Cention ultrafilter and sterilized.
[0181] The concentrate was analyzed using soluble protein flow cytometry and Western blot to detect the composition of the HLA-A2 / IgG1 Fc fusion protein, employing mAb BB7.2 (specifically recognizing HLA-A2) and anti-human IgG Fc antibody. The results are as follows: Figure 3As shown, the concentrated sample HLA-G / IgG Fc was captured by an anti-human IgG Fc capture antibody coated on microspheres. It could bind to the HLA-A2 specific antibody BB7.2 fluorescent antibody, indicating that it is an HLA-A2 / IgG1Fc fusion protein with the correct conformation.
[0182] The concentrate was reduced with β-mercaptoethanol and then subjected to SDS-denaturing polyacrylamide gel electrophoresis. Further Western blot analysis using anti-human IgG Fc antibody was performed to verify the accuracy of the HLA-A2 / / IgG1 Fc molecular weight. The results are as follows: Figure 4 As shown, a 75KD protein band can be detected, further indicating that it contains the correctly conformed HLA-A2 / IgG1 Fc fusion protein.
[0183] Quantitative detection of the fusion protein HLA-A2 / IgG1 Fc: To more accurately detect the amount of the fusion protein HLA-A2 / IgG1 Fc expressed in dimer-721.221 cells, IgG monomer was used as a standard. A sandwich ELISA was performed using anti-human IgG antibody and enzyme-labeled IgG Fc. A standard curve was plotted to detect the HLA-A2 / IgG1 Fc content in the dimer-721.221 supernatant concentrate. Since the ratio of HLA-A2 molecules to IgG1 Fc molecules in HLA-A2 / IgG1 Fc is 2:1, and ELISA only detects the content of IgG Fc, therefore... Figure 5 The concentration of Ig in HLA-A2 / IgG1 Fc calculated from the standard curve should be multiplied by 2 to obtain the concentration of HLA-A2 / IgG1 Fc. Multiple batches of test results show that after concentration, the HLA-A2 / IgG1 Fc content of 100ml dimer-721.221 supernatant is 60ug.
[0184] II. HLA-A2 / IgG1 Fc-loaded antigenic peptide (HBC) 18-27 FLPSDFFPSV) form a relatively single pMHC (HBC) 18-27 / HLA-A2 / IgG1 Fc)
[0185] Using a relatively excessive amount of artificially synthesized antigen peptide (HBC) 18-27 The FLPSDFFPSV complex completely replaces irrelevant antigenic peptides on the HLA-A2 / IgG1 Fc layer, forming a relatively simple pMHC complex (HBC). 18-27 / HLA-A2 / IgG1 Fc). The peptide dosage Mp (mg) is estimated using this formula: Mp = Md × R × Dp / Dd, where Dp = peptide molecular weight (daltons), Dd = 200,000 daltons, R = molar ratio of excess peptide to HLA-A2 / IgG1 Fc = 640, and Md = HLA-A2 / IgG1 Fc dosage. The specific steps are: ① Take 5ug of concentrated HLA-A2 / IgG1 Fc; ② Add 20ug of antigen peptide (HBC). 18-27 ③ The pMHC (HBC / HLA-A2 / IgG1 Fc) loaded with antigen peptides was stored at 4°C for later use.
[0186] 3. pMHC (HBC18-27 / HLA-A2 / IgG1 Fc) binds to the surface of monocytes in HLA-A2-negative individuals, serving as a stimulatory cell capable of presenting a single pMHC.
[0187] Peripheral blood PBMCs were routinely isolated from HLA-A2 negative individuals, and lymphocytes and monocytes were sorted by flow cytometry.
[0188] Centrifugation was used to collect and sort monocytes, and pMHC (HBC) was then transferred to monocyte-macrophage ligation pMHC technology. 18-27 The HLA-A2 / IgG1 Fc receptor binds to the surface of HLA-A2-negative monocytes. Specifically, the surface of HLA-A2-negative monocytes, already bound to IgG, is first acidified and eluted to expose the Fc receptor (FcγRI), then loaded with pMHC (1×10⁻⁶) that has replaced the antigenic peptide. 6 Each mononuclear cell was loaded with 5g HBC 18-27 The HLA-A2 / IgG1 Fc antibody was used to bind to the surface of monocytes, and after flow cytometry identification, it was identified as a stimulating cell capable of presenting single pMHC. The pMHC binding rate was detected using flow cytometry with a mAb BB7.2 fluorescent antibody that specifically recognizes HLA-A2. The specific steps were: ① Routinely isolate peripheral blood PBMCs from HLA-A2-negative individuals, wash twice, and adjust the PBMC concentration to 5 × 10⁻⁶ cells / mL. 6 / ml; ② Based on cell size and intracellular granule quantity, aseptically sort lymphocytes and monocytes / macrophages using flow cytometry in purity mode; ③ Collect all monocytes, centrifuge at 1200 rpm for 10 min, and discard the supernatant; ④ Add 3 ml of acidified 1640 solution (pH 6.0) containing 10% FBS, incubate at 37℃ and 5% CO2 for 10 min, centrifuge at 1200 rpm for 10 min, and discard the supernatant; ⑤ Add the pMHC (HBC) solution with the antigen peptide replaced as described above. 18-27Add 5g of HLA-A2 / IgG1 Fc and incubate at 37℃ in a 5% CO2 incubator for 30 minutes, shaking three times during incubation; add 5ml of PBS solution, centrifuge at 1200rpm for 10 minutes, discard the supernatant, and adjust the cell concentration to 5×10⁶ cells / mL using X-VIVO medium containing 5% autologous serum. 5 / ml~1×10 6 / ml, as a reserve of stimulated cells capable of presenting single pMHC; ⑦ Using the mAb BB7.2 fluorescent antibody that specifically recognizes HLA-A2 as the detection antibody, HLA-A2 was detected by flow cytometry. - The binding rate of HLA-A2 molecules on the surface of monocytes. Results are as follows: Figure 6 As shown, A represents the cell segmentation strategy, with P1 representing lymphocytes and P2 representing monocytes; B represents the binding of lymphocytes to pMHC; and C represents the binding of monocytes to pMHC in HLA-A2-negative individuals. The lymphocyte population shown is negative, indicating that it does not bind HBCs. 18-27 / HLA-A2 / IgG1 Fc; while the monocyte population was positive, with a positive rate as high as 94.4%, meaning that after loading HLA-A2... - The binding rate of HLA-A2 molecules on the surface of monocytes reached 90%, indicating that it can bind well to HBC18-27 / HLA-A2 / IgG1 Fc and can serve as a stimulatory cell for presenting single pMHC.
[0189] IV. Co-culturing stimulatory cells and effector cells to induce pMHC-specific allogeneic T cells SCM
[0190] HLA-A2-negative lymphocytes were collected by centrifugation and flow cytometry sorting. Lymphocytes labeled according to the CellTrace [Invitrogen LOT2549238] instruction manual were used as effector cells, and flow cytometry was used to analyze the CellTrace labeling status of the lymphocytes. The specific steps are as follows:
[0191] ① Collect all lymphocytes and centrifuge at 1200 rpm for 10 min, discarding the supernatant; ② Take another centrifuge tube containing 1 ml PBS, add 1 μL of Celltrace, mix well, add to the lymphocyte pellet, and mix again; ③ Incubate at 37°C in the dark for 20 min, shaking once during incubation; ④ Add 5 times the volume of medium containing 10% bovine serum, incubate at 37°C in the dark for 5 min to terminate the staining reaction; ⑤ Centrifuge at 1200 rpm for 10 min, discard the supernatant, resuspend in X-VIVO medium containing 5% autologous serum, and adjust the cell concentration to 1×10⁻⁶ cells / mL. 7 / ml, reserved as beneficial cells; ⑥ Take a small amount of cells for flow cytometry analysis of celltrace-labeled lymphocytes, the results are as follows Figure 7As shown, 99% of the cells were stained with celltrace and formed a narrow single peak.
[0192] Long-term mixed lymphocyte culture was performed at an effector cell / stimulator cell ratio of 10:1. 1×10 7 0.1 ml of effector cells per ml were seeded into 24-well culture plates, and then 1 × 10⁶ cells were added. 6 Stimulate cells with 0.1 ml of medium per ml, and supplement the culture system with 1 ml of medium containing 5% autologous serum. After 24 h of culture, add TWS119 to each well to a final concentration of 5 μM. After the sample is added, centrifuge at 500 rpm for 2 min, and incubate at 37 ℃ and 5% CO2 for 7 days. During this period, replace half of the medium every 3 days and supplement with the full amount of TWS119.
[0193] 5. "Two-step amplification technique" for amplifying single pMHC-specific homologous T cells SCM
[0194] In this invention, IL-7 and IL-15 are specifically used as stimulants to promote T. SCM It proliferates and maintains its stemness. Furthermore, NAC can be added, utilizing its protective effect against activation-induced apoptosis (AICD) without affecting the development of memory T cells.
[0195] Cells co-cultured to day 7 were collected, and based on the principle of decreasing fluorescence in proliferating cells, a two-step amplification technique was used to amplify single pMHC-specific homologous T cells. SCM .
[0196] The first step uses flow cytometry to sort proliferating cells. Cells co-cultured to day 7 are collected, and based on the principle of decreasing fluorescence in proliferating cells, they are sorted according to... Figure 8 The sorting strategy shown in Figure A (circling proliferating cells based on cell trace fluorescence intensity (celltrace dim+), assigning P4 gates to non-proliferating cells with strong positive cell trace fluorescence (cell trace hi+), and assigning P3 gates to proliferating cells with decreasing cell trace fluorescence intensity, and sorting according to this strategy) sorts out proliferating cells to ensure the subsequent expansion of T cells. SCM Antigen specificity of cells. The specific steps are as follows: ① Collect cultured cells, centrifuge at 1200 rpm for 10 min, discard the supernatant, wash once with PBS solution, resuspend the cell pellet in PBS solution, and adjust the cell concentration to 5 × 10⁻⁶ cells / mL. 6 / ml; ② Based on the principle of decreasing fluorescence in proliferating cells, proliferating cells and non-proliferating cells were collected separately using flow cytometry in purity sorting mode; ③ As Figure 8As shown in B, the purity of the sorted proliferating and non-proliferating cells was tested. The required sorting purity was 80-90% or higher. In this example, the results showed that the sorting purity of cells in the P3 and P4 gates could reach more than 90%.
[0197] The second step involves cell proliferation (i.e., pMHC-specific allogeneic T cells). SCM Amplification, centrifugation to collect and sort proliferating cells, resuspending in X-VIVO medium containing 5% autologous serum, and adjusting the cell concentration to 3 × 10⁻⁶ cells / year. 5 / ml-5×10 5 Cells were seeded at a concentration of 1 ml / well in 24-well cell culture plates. Each well was then supplemented with IL-7, IL-15, and 2 mM NAC to a final concentration of 25 ng / ml. The plates were incubated at 37°C with 5% CO2 for 7 to 30 days, with half the medium replaced every 3 days, and the remaining IL-7, IL-15, and NAC replenished. During expansion, a small amount of cell suspension was taken every three days, stained with trypan blue, and viable cells were counted using a cell counting chamber (instrument). Growth curves were then plotted. Results are as follows: Figure 9 As shown, HBC-P3 refers to rapidly proliferating cells sorted after stimulation with HBC18-27 / HLA-A2-loaded mononuclear cell populations, i.e., HBC18-27 / HLA-A2-specific T cells. SCM HBC-P4 cells are slow-proliferating cells sorted after stimulation with a mononuclear cell population loaded with HBC18-27 / HLA-A2. The illustration shows that both HBC-P3 and HBC-P4 cells exhibit good expansion efficiency, increasing approximately 13-fold by day 20 after sorting.
[0198] VI. The T obtained from the above amplification SCM Phenotypic identification and functional testing were performed.
[0199] 1)T SCM Cell phenotype identification and Tetramer+ cell detection.
[0200] On days 7 and 14, a small number of cells were collected and Tscm phenotypic antibodies (APC-Cy7-labeled anti-human CD3 antibody, BV510-labeled anti-human CD8 antibody, PE-Cy7-labeled anti-human CD62L antibody, Percp-Cy5.5-labeled anti-human CD45RA antibody, PE-labeled anti-human CD95 antibody) or PE-labeled Tetramer were added, respectively. An FMO control (without CD95) was also included. Cells were incubated at 4°C in the dark for 30 min for labeling. After washing with PBS, T cells were detected by flow cytometry. SCM Cell phenotype and cell proportion. Results are as follows: Figure 10 As shown in the figure, 98.6% of CD3 in unstimulated PBMCs + CD8 + CD45RA+ CD62L + Cells that do not express CD95 are mostly TN cells; after stimulation and induction, 99.9% of CD3+CD8+CD45RA+CD62L+ cells highly express CD95, which are T cells. SCM Cells, representing T cells SCM Cell induction was successful. Figure 11 The results showed that the frequency of the CD3+CD8+ Tetramer cell population was as high as 9.0% after stimulation, which was significantly higher than the frequency before stimulation (0.8%); CD3 + CD8 + CD45RA + CD62L + The frequency of Tetramer cells reached 14.7%, which was significantly higher than the pre-stimulation frequency (0.9%).
[0201] 2)T SCM After amplification, for T SCM Test its self-renewal ability
[0202] Self-renewal refers to the maintenance of a certain proportion of stem cells after their proliferation and differentiation. IL-7 and IL-15 can promote the proliferation of Tscm cells. Prepared Tscm cells were stained with CellTrace and expanded by adding IL-7 and IL-15 to a final concentration of 25 ng / ml and 2 mM NAC. The Tscm cells were then observed. SCM Changes in T cell subsets and their self-renewal capacity during cell proliferation and differentiation. The specific steps are as follows: On day 7 of expansion, the prepared T cells are collected... SCM After the cells were filled, T was added separately. SCM Antibodies for cell phenotype detection were used, and FMO tubes (without CD95) were set up as a control. Cells were incubated at 4°C in the dark for 30 minutes, washed with PBS, and then flow cytometry was used to detect T cells. SCM Cell differentiation and self-renewal capacity. Results are as follows: Figure 13 As shown, after 7 days of amplification, T SCM All seven daughter cells from the cell proliferation contained different proportions of T cells. SCM Phenotype of cells, namely T cells SCM All seven daughter cells from the cell proliferation retained stemness.
[0203] 3) Inducing T SCM Specific cytotoxicity detection after cells differentiate into effector cells.
[0204] IL-2 can promote T SCM Towards terminal effector T cells (T EFF Differentiation occurs in the direction of CD8+ effector T cells. The immune effect mediated by CD8+ effector T cells includes the production of cytokines and the killing of target cells.
[0205] Measurement of IL-2-induced T SCM Cells to T EFF Differentiation ability, T SCM (HBC 18-27 After amplification and culture of HLA-A2 for 14 days, 300 IU of IL-2 was added to induce differentiation. Flow cytometry was used to detect the T values before and after induction. SCM Differentiation status. Results are as follows: Figure 12 As shown. A is T SCM Without the addition of 300 IU IL-2 for induction, B is T. SCM After induction with 300 IU IL-2 for 24 hours, C becomes T. SCM After induction with 300 IU IL-2 for 48 hours, the results showed that IL-2 could induce T SCM To effector T cells (T EFF (CD3+CD8+CD45RA+CD62L- cells) differentiate, and with the extension of induction time, T cells... EFF The proportion is constantly increasing.
[0206] HepG2 cells are HLA-A2 + Human hepatocellular carcinoma cell line; HepG2.2.15 cells are HLA-A2 cells. + HepG2 cell line, derived from human hepatocellular carcinoma cells, is stably transfected with the HBV gene and can stably replicate the HBV genome. Therefore, its surface can present pMHC (HBC) 18-27 HLA-A2 is killed by pMHC-specific CTLs.
[0207] Propidium iodide (PI) is a nuclear staining reagent that can stain DNA. PI cannot pass through the membrane of living cells, but it can pass through damaged cell membranes to stain the nucleus. It is often used to distinguish between living and dead cells.
[0208] To observe specific cytotoxic effects, the T cells prepared by co-culturing as described above were... SCM Cells differentiate into effector T cells (T cells) under the induction of IL-2. EFF HepG2 cells (not expressing pMHC) and HepG2.15 cells (expressing pMHC) stained with CFSE were used as target cells in a 2:1.5 ratio for cytotoxicity assays. Five hours after cytotoxicity, propidium iodide (PI) dye was used to distinguish between live and dead cells, and the number of surviving target cells (CFSE-stained cells) in each group was counted using flow cytometry. +hi PI - ), to observe T SCM Effector cells of cell differentiation specifically kill target cells. The specific operational steps are as follows: ① On day 14, take 3 × 10⁻⁶ cells... 5Cells were seeded at 300 U / ml in 24-well plates, and IL-2 was added to each well. The plates were then incubated at 37°C in a 5% CO2 incubator. Cells were harvested at 24h and 48h, washed with PBS, resuspended in complete 1640 medium, and the cell concentration was adjusted to 2 × 10⁶ cells / ml. 5 / ml, reserved as effector cells; ② Digest logarithmically growing HepG2 and HepG2.2.15 cells, terminate digestion with 10% FBS 1640 medium and centrifuge at 1000 rpm for 10 min; discard the supernatant, resuspend in 0.1% BSA PBS, and wash once by centrifugation; ③ Resuspend in 0.1% BSA PBS and adjust the cell concentration to 5×10⁶ cells / ml. 6 Add CFSE dye to a working concentration of 5 μM / ml; incubate at 37°C, 5% CO2 in the dark for 10 min, then add 1 ml of fetal bovine serum to stop staining. Wash twice with 10% FBS 1640 medium; discard the supernatant, then fill with 10% FBS 1640 medium and incubate at 37°C, 5% CO2 for 15 min to remove excess unbound CFSE dye; centrifuge at 1000 rpm for 10 min, resuspend in complete 1640 medium, and adjust the cell concentration to 1.5 × 10⁶ cells / ml. 5 / ml, as target cells for later use. ④ Take 100μL of effector cells and target cells respectively and seed them into 96-well plates, double-duplicate wells, and set up a natural control of target cells. ⑤ After 5h of co-culture, digest and centrifuge to collect cells from each well, resuspend in 300μL PBS and add 10μL of propidium iodide (PI) dye for staining for 10min; ⑥ Flow cytometry is used to detect the number of surviving target cells (CFSE) in each group. +hi PI - And calculate the lethality.
[0209] Specific killing activity = (1 - number of viable target cells in the experimental group / number of viable target cells in the natural control group) × 100%
[0210] The results are as follows Figure 14 As shown, T SCM After 24 h and 48 h of IL-2 induction, at an effector-target ratio of 2:1.5, the cytotoxicity of HepG2.2.15 cells (expressing this pMHC) was 5.41% and 6.32%, respectively, while the cytotoxicity of HepG2 cells (not expressing this pMHC) was -2.34% and -3.96%, respectively. These results indicate that T... SCM After differentiation induced by IL-2, the cells exhibited significant pMHC-specific cytotoxic effects.
[0211] pHMC specific isotype T SCMIt exhibits significant pMHC-specific cytotoxic activity and can be used for adoptive immunotherapy. On one hand, adoptive infusion can induce differentiation into T cells. EFF It kills virus-infected cells and tumor cells in the recipient's body that express the corresponding target pHMC, while not killing normal cells in the body (cells that do not express the corresponding target pHMC). Furthermore, due to its stem cell characteristics, it can survive and differentiate for a long time. Its immune cell therapy targets patients with viral infectious diseases and tumors corresponding to the above-mentioned target pHMC.
[0212] In addition, pMHC-specific T cells prepared using other antigenic peptides SCM It also has a high specific killing rate on cells that express the target of the antigen peptide.
[0213] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A method for inducing pMHC-specific homologous T cells SCM The method is characterized by, Includes the following steps: a) Preparation of pMHC that presents a single antigenic peptide; b) Sort lymphocytes and monocytes from the donor and attach the pMHC obtained in step a) to the surface of the sorted monocytes as stimulating cells. c) The lymphocytes sorted in step b) are co-cultured with stimulatory cells in a medium containing an inhibitor of glycogen synthase kinase-3β to induce the production of pMHC-specific allogeneic T cells. SCM ; d) The pMHC-specific homologous T obtained in step c) of the separation process SCM .
2. A method for inducing amplification of pMHC-specific homologous T cells SCM The method is characterized by, Includes the following steps: a) Prepare pMHC that presents a single antigenic peptide, and attach the pMHC fusion protein that presents a single antigenic peptide to the surface of isolated mononuclear cells as a stimulating cell. b) Sort lymphocytes and monocytes from the donor and attach the pMHC obtained in step a) to the surface of the sorted monocytes as stimulating cells. c) The lymphocytes sorted in step b) are co-cultured with stimulatory cells in a medium containing an inhibitor of glycogen synthase kinase-3β to induce the production of pMHC-specific allogeneic T cells. SCM ; d) Separate the pMHC-specific homologous Tscm obtained in step c) and stimulate its amplification with a stimulant to generate a large number of pMHC-specific homologous Tscm. SCM .
3. The method according to claim 1 or 2, characterized in that, The lymphocytes and monocytes were derived from peripheral blood mononuclear cells from the donor.
4. The method according to claim 1 or 2, characterized in that, The pMHC that presents a single antigenic peptide is formed by replacing the single restriction antigenic peptide with an HLA I / IgG Fc fusion protein, which is formed by the fusion expression of the heavy chain extracellular domain of an HLA class I molecule with IgG Fc.
5. The method according to claim 4, characterized in that, The HLA class I molecules are selected from any of the following: HLA-A1, HLA-A2, HLA-A203, HLA-A210, HLA-A3, HLA-A9, HLA-A10, HLA-A11, HLA-A19, HLA-A23, HLA-A24, HLA-A2403, HLA-A25, HLA-A26, HLA-A28, HLA-A29, HLA-A30, HLA-A31, HLA-A32, HLA-A33, HLA-A34, HLA-A36, HLA-A43, HLA-A66, HLA-A68, HLA-A69, HLA-A74, HLA-A80; HLA-B5, HLA-B7, HLA-B703, HLA-B8, HLA-B12, HLA-B13, HLA-B14, HLA-B15, HLA-B16, HLA-B17, HLA-B18, HLA-B21, HLA-B22, HLA-B27, HLA-B2708, HL A-B35, HLA-B37, HLA-B38, HLA-B39, HLA-B3901, HLA-B3902, HLA-B40, HLA-B41, HLA-B42, HLA-B44, HLA-B45, HLA-B46, HLA-B47, HLA-B48, HLA-B49, HLA-B50, HLA-B51, HLA-B5102, HLA-B5103, HLA-B52, HLA-B53, HLA-B54, HLA-B55, HLA-B56, HLA-B57, HLA-B58, HLA-B59, HLA-B60, HLA-B61, HLA-B6 2. HLA-B63, HLA-B64, HLA-B65, HLA-B67, HLA-B70, HLA-B71, HLA-B72, HLA-B73, HLA-B75, HLA-B76, HLA-B77, HLA-B78, HLA-B81, HLA-BW4, HLA-BW6.
6. The method according to claim 1 or 2, characterized in that, The restricted antigenic peptide is a viral antigenic peptide or a tumor antigenic peptide.
7. The method according to claim 5, characterized in that, The restriction antigenic peptide is selected from any of the following, and the HLA class I molecules corresponding to each antigenic peptide are shown in the table below:
8. The method according to claim 4, characterized in that, Step a) The donor selection criteria are: select donors who are serotype-negative for the HLA class I molecules corresponding to the HLA class I molecules in the HLA I / IgG Fc fusion protein that forms pMHC.
9. The method according to claim 1 or 2, characterized in that, In step c), the ratio of effector cells to stimulator cells is 5–20:
1.
10. The method according to claim 1 or 2, characterized in that, In step c), the concentration of glycogen synthase kinase-3β inhibitor is 2.5 μM-7.5 μM, and the co-culture time is 7-10 days.
11. The method according to claim 2, characterized in that, Step d) includes: d.1) Use flow cytometry to separate proliferating cells from the co-culture system; d.2) Add the sorted proliferating cells to a solution containing T SCM Cultured in a culture medium containing stimulants to stimulate T SCM Amplification to generate large amounts of pMHC-specific homologous T cells SCM .
12. The method according to claim 11, characterized in that, Before co-culturing the sorted lymphocytes, perform fluorescent staining in step a).
13. The method according to claim 11, characterized in that, The T SCM The stimulants are a combination of IL-7, IL-15 and N-acetylcysteine.
14. The method according to claim 13, characterized in that, The concentrations of IL-7, IL-15, and N-acetylcysteine were 5 ng / ml to 25 ng / ml, 5 ng / ml to 25 ng / ml, and 0.5 mM to 3 mM, respectively.
15. The pMHC-specific homologous T cells obtained by the method described in any one of claims 1 to 14 SCM Application in the preparation of viral or tumor adoptive immunotherapy drugs.