LAMP primer, CRISPR RNA, detection kit and detection method for detecting bursaphelenchus xylophilus

By designing LAMP primers and CRISPR RNA targeting the BXEcKs1 gene of pine wood nematode and combining them with the LAMP-CRISPR/Cas12a system, the problems of high cost, long time consumption and low sensitivity in pine wood nematode detection have been solved, achieving rapid detection with high efficiency and specificity.

CN121915162APending Publication Date: 2026-04-24INST OF FOREST ECOLOGY ENVIRONMENT & PROTECTION CHINESE ACAD OF FORESTRY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202512057906.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2024-12-31
Filing Date
2025-12-31
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

Existing methods for detecting pine wilt disease suffer from high costs, complex operations, long processing times, or low sensitivity. In particular, LAMP amplification technology has deficiencies in specificity and sensitivity, making it difficult to meet the rapid detection needs of grassroots institutions.

Method used

LAMP primers targeting the BXEcKs1 gene of pine wood nematode were designed and combined with the CRISPR/Cas12a system to establish a LAMP-CRISPR/Cas12a detection system. The detection method was optimized through specificity and sensitivity tests, and CRISPR RNA-1 with high specificity and sensitivity was used to achieve rapid and intuitive detection.

Benefits of technology

It achieves specific differentiation between pine wood nematode and pine wood nematode, with a detection sensitivity of 10 fg/µL, providing a stable, practical, and rapid detection method suitable for on-site screening in grassroots institutions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121915162A_ABST
    Figure CN121915162A_ABST
Patent Text Reader

Abstract

The invention discloses LAMP primers for detecting pine wood nematodes, CRISPR RNA, a detection kit and a detection method. The invention relates to a BXEcKs1 gene of bursaphelenchus xylophilus as a target gene, an LAMP primer is designed, corresponding CRISPR RNA is designed, and a detection kit and a detection method for detecting bursaphelenchus xylophilus based on an LAMP-CRISPR / Cas12a system are established. Specificity and sensitivity tests show that the CRISPR RNA as shown in SEQ ID No.8 has the best detection effect, pine wood nematode and bursaphelenchus mucronatus can be specifically distinguished, and the sensitivity reaches 10 fg / L. The detection method for detecting the pine wood nematodes based on the LAMP-CRISPR / Cas12a system has the advantages of being good in stability, high in practicability, high in amplification efficiency and the like, and a sensitive, specific, rapid and visual detection means is provided for rapidly screening the pine wood nematodes on site.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to primers and kits for detecting pine wood nematodes, and particularly to primers for detecting pine wood nematodes. BXEcKs1 LAMP primers and CRISPR RNA designed with genes as target genes for the detection of pine wood nematode, as well as kits and detection methods for the detection of pine wood nematode based on the LAMP-CRISPR / Cas12a system, belong to the field of molecular detection of pine wood nematode. Background Technology

[0002] Pine wilt disease, also known as pine wilt or pine blight, is caused by the pine wood nematode [Bursaphelenchus xylophilus (Steiner & Buhrer) Nickle]. It is primarily spread naturally through the feeding and oviposition of longhorn beetles (Monochamus) on pine trees, as well as through long-distance transmission via the transport of diseased wood and processed timber. Within forest areas, the pine wood nematode is mainly spread by the pine longhorn beetle, and can damage 36 species of Pinus (Pinus spp.), Larix (Larix spp.), Picea (Picea spp.), Pseudotsuga (Pseudotsuga spp.), Abies (Abies spp.), and Cedrus (Cedrus spp.), and 8 non-Pinus species, with Pinus species being the most prevalent host. Due to its extremely serious harm and the current lack of effective prevention and control methods, it has been listed as the number one quarantine target by many countries.

[0003] Currently, the detection and identification of pine wood nematode mainly relies on molecular biology methods. Among these, DNA probe technology can effectively identify pine wood nematode, but it is expensive and radioactive; RAPD technology analyzes the relationship between pine wood nematode and similar species, but the results have poor reproducibility; RFLP technology distinguishes between pine wood nematode and *Pseudomonas aeruginosa*, but the restriction enzymes are expensive and time-consuming; fluorescent PCR is sensitive and rapid, but relatively expensive; PCR technology is simple to operate and less expensive, but it also takes a long time.

[0004] Loop-mediated isothermal amplification (LAMP) is a novel nucleic acid amplification method developed in 2000 by Notomi T et al. of Eiken Chemical Co., Ltd. in Japan. This method uses two pairs of specific primers designed for six regions of the target gene. The primers are incubated at an isothermal temperature (around 65°C) for several tens of minutes under the action of strand displacement DNA polymerase (Bst DNA polymerase). Due to its unique inversion design, it undergoes strand displacement and infinite amplification. The entire reaction can be completed within one hour, without the need for template denaturation, annealing, or temperature cycling. The amplification is characterized by high specificity and rapid isothermal action. Therefore, compared to the molecular detection techniques mentioned above, LAMP amplification does not require expensive instruments and reagents, making it more suitable for application in some grassroots institutions. The key to successfully detecting pine wood nematode using LAMP technology is to design a highly specific and sensitive LAMP primer set targeting the pine wood nematode's target gene. Furthermore, LAMP technology for detecting pine wood nematode suffers from varying degrees of poor specificity and low sensitivity, which require further improvement. Summary of the Invention

[0005] One of the objectives of this invention is to provide a treatment for pine wood nematode. BXEcKs1 LAMP primers designed with the target gene as the target gene for the detection of pine wood nematode; The second objective of this invention is to provide CRISPR RNA for detecting pine wood nematode; The third objective of this invention is to provide a kit for detecting pine wood nematode based on the LAMP-CRISPR / Cas12a system; The fourth objective of this invention is to provide a method for detecting pine wood nematodes based on the LAMP-CRISPR / Cas12a system.

[0006] To achieve the above objectives, the main technical solutions adopted by the present invention include: One aspect of the present invention is to provide a method for treating pine wood nematode. BXEcKs1 LAMP primers for detecting pine wood nematode, designed with the target gene as the target gene, are described. The LAMP primers consist of a positive inner primer, a reverse inner primer, a positive outer primer, a reverse outer primer, and a loop primer. The nucleotide sequence of the positive inner primer is shown in SEQ ID No. 4, the nucleotide sequence of the reverse inner primer is shown in SEQ ID No. 5, the nucleotide sequence of the positive outer primer is shown in SEQ ID No. 2, the nucleotide sequence of the reverse outer primer is shown in SEQ ID No. 3, and the nucleotide sequence of the loop primer is shown in SEQ ID No. 6 or SEQ ID No. 7.

[0007] Another aspect of the present invention provides a CRISPR RNA for detecting pine wood nematode, wherein the nucleotide sequence of the CRISPR RNA is selected from any of the nucleotide sequences shown in SEQ ID No. 8-20.

[0008] Another aspect of the present invention provides a kit for detecting pine wood nematode based on the LAMP-CRISPR / Cas12a system, the kit comprising a LAMP amplification system and a CRISPR / Cas12a reaction system; wherein the LAMP amplification system comprises LAMP primers; the LAMP primers are composed of a positive inner primer, a reverse inner primer, a positive outer primer, a reverse outer primer, and a loop primer; The nucleotide sequence of the positive inner primer is shown in SEQ ID No. 4, the nucleotide sequence of the reverse inner primer is shown in SEQ ID No. 5, the nucleotide sequence of the positive outer primer is shown in SEQ ID No. 2, the nucleotide sequence of the reverse outer primer is shown in SEQ ID No. 3, and the nucleotide sequence of the loop primer is shown in SEQ ID No. 6 or SEQ ID No. 7. The CRISPR-Cas12a reaction system includes CRISPR RNA, and the nucleotide sequence of the CRISPR RNA is selected from any of the nucleotide sequences shown in SEQ ID No. 8-20; preferably, the nucleotide sequence of the CRISPR RNA is shown in SEQ ID No. 8.

[0009] This invention targets pine wood nematode. BXEcKs1 LAMP primers were designed for the target gene, and corresponding CRISPR RNAs were designed. A detection kit and method for detecting pine wood nematodes based on the LAMP-CRISPR / Cas12a system were established. Specificity and sensitivity tests showed that the CRISPR / RNA shown in SEQ ID No. 8 had the best detection effect. The detection specificity of the CRISPR RNA shown in SEQ ID No. 8 was also tested. The specificity test results showed that the CRISPR RNA shown in SEQ ID No. 8 could specifically distinguish between pine wood nematodes from different locations and *Pseudomonas aeruginosa* from different locations. The sensitivity test results showed that the detection method established in this invention achieved a sensitivity of 10 fg / µL.

[0010] Another aspect of the present invention provides a method for detecting pine wood nematodes based on the LAMP-CRISPR / Cas12a system, comprising: (1) Extract DNA from the sample to be tested; (2) Using the extracted sample DNA as a template and the above-mentioned LAMP primers, a LAMP amplification system was established to carry out LAMP isothermal amplification reaction to obtain the amplification product dsDNA; (3) The amplified product dsDNA is added to the CRISPR-Cas12a reaction system for reaction. CRISPR RNA and the amplified product dsDNA are specifically recognized by the Cas12a enzyme and the auxiliary cleavage function is activated to cleave ssDNA. Finally, the presence of pine wood nematode in the sample is determined based on the fluorescence display results.

[0011] In a preferred embodiment of the present invention, the LAMP amplification system in step (2) is preferably as follows: 2 μL template DNA, 8 U Bst 2.0 WarmStart DNA polymerase, 1.6 μM positive inner primer, 1.6 μM reverse inner primer, 0.2 μM positive outer primer, 0.2 μM reverse outer primer, 0.8 μM loop primer, 1.4 mM dNTPs mix, 10 mM MgSO4, 2.5 µL 10x isothermal amplification buffer, and 1 µL SYBR Green; the total volume of the reaction system is 25 µL. In a preferred embodiment of the present invention, the LAMP isothermal amplification reaction in step (2) is carried out in a water bath at 65°C for 60 minutes.

[0012] In a preferred embodiment of the present invention, the CRISPR-Cas12a reaction system in step (3) consists of: Cas12a 250 nM, CRISPR RNA 500 nM, ssDNA-FQ reporter gene 400 nM, LAMP amplification product dsDNA 2 μL, NEBuffer 2.1 buffer 2.5 μL, and the total reaction volume is 25 μL.

[0013] In a preferred embodiment of the present invention, the reaction conditions of the CRISPR-Cas12a reaction system in step (3) are: reaction at a constant temperature of 37 °C for 60 minutes.

[0014] The detection method for pine wood nematode based on the LAMP-CRISPR / Cas12a system established by this invention can specifically distinguish pine wood nematode from *Pseudomonas pineatus* from different locations without cross-reaction. It has good stability, strong practicality, and high amplification efficiency. This invention provides a sensitive, specific, rapid, and intuitive detection method for rapid on-site screening of pine wood nematode. Attached Figure Description

[0015] Figure 1 Abundance of fluorescence values ​​amplified by different groups of LAMP primers.

[0016] Figure 2 Abundance of fluorescence values ​​of different CRISPR RNAs amplified after LAMP primer set 1.

[0017] Figure 3 Abundance of fluorescence values ​​of different CRISPR RNAs amplified after LAMP primer set 2.

[0018] Figure 4 Abundance of fluorescence values ​​of different CRISPR RNAs amplified after amplification with LAMP primer set 7.

[0019] Figure 5 Results of CRISPR RNA-1 detection specificity assay (P<0.05, error bar represents SD).

[0020] Figure 6 CRISPR RNA-1 detection sensitivity test results (error bars represent SD). Detailed Implementation

[0021] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, it should be understood that the embodiments described are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but such modifications or substitutions all fall within the protection scope of the present invention.

[0022] Example 1: Using pine wood nematode BXEcKs1 LAMP primers and CRISPR RNA designed with genes as targets for detection of pine wood nematode Targeting pine wood nematode BXEcKs1 LAMP primers were designed for the target genes.

[0023] Pine wood nematode BXEcKs1 The nucleotide sequence of the gene is as follows: (SEQ ID No.1).

[0024] With pine wood nematode BXEcKs1 The LAMP primer sequences designed for the target genes are shown in Table 1.

[0025] Table 1 shows the results of the study on pine wood nematode. BXEcKs1 LAMP primer sequences designed for target genes

[0026] Note: (1) The LAMP primer set consisting of primers 1F3, 1B3, 1FIP, 1BIP, 1LF and 1LB is LAMP primer set 1; LAMP primer sets 2-11 are described in the same way. (2) F3 are all positive outer primers, B3 are all negative outer primers, FIP are all positive inner primers, BIP are all negative inner primers, and LB and LF are all loop primers.

[0027] The designed CRISPR RNA sequences are as follows: CRISPR RNA-1: TTTAACTAAATCCGTTGCTAGCCGCAT (SEQ ID No.8) CRISPR RNA-2: TTTACGACATGCGGCTAGCAACGGAT (SEQ ID No.9)​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​CRISPR RNA-13: TTTGATTTTGCCAACTTCAGCTCTCAT (SEQ ID No. 20) Example 1: Establishment of a detection method for pine wood nematode based on the LAMP-CRISPR / Cas12a system, and specificity and sensitivity tests. 1. Experimental Methods 1.1 DNA Extraction DNA was extracted from pine wood nematodes from different locations and from *Pseudomonas pineensis* from different locations.

[0028] 1.2 Establishment of the LAMP-CRISPR / Cas12a detection system and sensitivity and specificity tests The LAMP amplification reaction system is as follows: The reaction components are listed in Table 1, in a 25 µL volume. The reaction was carried out in a water bath at 65 °C for 60 minutes. The CRISPR-Cas12a reaction system is as follows: The reaction components are listed in Table 2, in a 25 µL volume. The reaction was carried out in a water bath at 37 °C for 60 minutes.

[0029] Table 2 LAMP reaction system

[0030] Table 3 LAMP-Cas12a detection system Thirteen different CRISPR RNAs were tested. After the LAMP reaction, 2 µL of the LAMP amplification product was added to the CRISPR-Cas12a reaction system of different CRISPR RNAs and reacted at 37 °C for 60 minutes.

[0031] The sensitivity and specificity of the detection were evaluated. Pine wood nematode and its closely related species were selected for comparison, and they were amplified using a LAMP system. The reaction was carried out in a water bath at 65 °C for 60 minutes. After the LAMP reaction, 2 µL of the LAMP amplification product was added to the CRISPR-Cas12a reaction system and reacted at a constant temperature of 37 °C for 60 minutes.

[0032] The detection sensitivity of the LAMP-CRISPR / Cas12a system was tested. The concentration of extracted DNA was determined using a NanoDrop micro-spectrophotometer to confirm the DNA concentration. The extracted DNA was then diluted with ddH2O, and LAMP amplification was performed on DNA samples of different diluted concentrations. 2 µL of the LAMP amplification product was added to the CRISPR-Cas12a reaction system and reacted at 37 °C for 60 minutes. 2. Test Results Eleven different LAMP primer sets were tested, and the results showed that primer sets 1, 2, and 7 performed best. Figure 1 Subsequently, CRISPR RNAs were designed based on these three sets of LAMP primers, resulting in a total of 13 different CRISPR RNAs.

[0033] Thirteen different CRISPR RNAs were tested. Figure 2 This is a graph showing the abundance of fluorescence values ​​of different CRISPRRNAs amplified using LAMP primer set 1. Figure 3 This is a graph showing the abundance of fluorescence values ​​of different CRISPR RNAs amplified using LAMP primer set 2. Figure 4 The image shows the fluorescence abundance of different CRISPR RNAs amplified using LAMP primer set 7. The test results indicate that using LAMP primer set 2 first, followed by detection of CRISPR RNA-1 (SEQ ID No. 8), significantly outperformed other combinations. Figure 3 Simultaneously, the specificity of the LAMP-CRISPR / Cas12a detection method based on LAMP primer set 2 and CRISPR RNA-1 for detecting pine wood nematodes was tested. Figure 5 The specific detection results show that the LAMP-CRISPR / Cas12a detection method based on CRISPR RNA-1 established in this invention can accurately distinguish between pine wood nematodes from different locations and pseudo-pine wood nematodes from different locations. Figure 5 NJ, CQ, and QY are pine wood nematodes from different locations, BM1 and BM2 are *Pseudomonas pineensis* from different locations, and CK is a blank control. The sensitivity of the LAMP-CRISPR / Cas12a detection method based on CRISPR RNA-1 was 10 fg / µL. Figure 6 ).

Claims

1. Targeting pine wood nematode BXEcKs1 LAMP primers for detecting pine wood nematode, designed with the target gene as the target gene, wherein the LAMP primers consist of a positive inner primer, a reverse inner primer, a positive outer primer, a reverse outer primer, and a loop primer; characterized in that, The nucleotide sequence of the positive inner primer is shown in SEQ ID No. 4, the nucleotide sequence of the reverse inner primer is shown in SEQ ID No. 5, the nucleotide sequence of the positive outer primer is shown in SEQ ID No. 2, the nucleotide sequence of the reverse outer primer is shown in SEQ ID No. 3, and the nucleotide sequence of the loop primer is shown in SEQ ID No. 6 or SEQ ID No.

7.

2. A method for detecting CRISPR RNA in pine wood nematodes, characterized in that, The nucleotide sequence of the CRISPR RNA is selected from any of the nucleotide sequences shown in SEQ ID No. 8-20.

3. The CRISPR RNA according to claim 1, characterized in that, The nucleotide sequence of the CRISPR RNA is shown in SEQ ID No.

8.

4. A kit for detecting pine wood nematode based on the LAMP-CRISPR / Cas12a system, the kit comprising a LAMP amplification system and a CRISPR-Cas12a reaction system; wherein, The LAMP amplification system includes LAMP primers, and the CRISPR-Cas12a reaction system includes CRISPR RNA; characterized in that the LAMP primers are those described in claim 1, and the CRISPR RNA is that described in claim 2.

5. A method for detecting pine wood nematode based on the LAMP-CRISPR / Cas12a system, characterized in that, include: (1) Extract DNA from the sample to be tested; (2) Using the extracted sample DNA as a template and the above-mentioned LAMP primers, a LAMP amplification system was established to perform LAMP isothermal amplification reaction to obtain the amplified product dsDNA; (3) The amplified product dsDNA was added to the CRISPR-Cas12a reaction system for reaction. CRISPR RNA and the amplified product dsDNA were specifically recognized under the action of Cas12a enzyme, and the auxiliary cleavage function was activated to cut ssDNA; the presence of pine wood nematode in the sample was determined according to the fluorescence display results.

6. The method according to claim 5, characterized in that, The LAMP amplification system described in step (2) is as follows: 2 μL template DNA, 8 U Bst 2.0 WarmStart DNA polymerase, 1.6 μM positive inner primer, 1.6 μM reverse inner primer, 0.2 μM positive outer primer, 0.2 μM reverse outer primer, 0.8 μM loop primer, 1.4 mM dNTPs mix, 10 mM MgSO4, and 2.5 µL 10 x isothermal amplification buffer; the total volume of the reaction system is 25 µL. The LAMP isothermal amplification reaction described in step (2) is carried out in a water bath at 65°C for 60 minutes.

7. The method according to claim 5, characterized in that, The composition of the CRISPR-Cas12a reaction system described in step (3) is: Cas12a 250 nM, CRISPR RNA 500 nM, ssDNA-FQ reporter gene 400 nM, LAMP amplification product dsDNA 2 μL, NE Buffer 2.1 buffer 2.5 μL, and the total reaction volume is 25 μL. The reaction conditions for the CRISPR-Cas12a reaction system described in step (3) are: reaction at a constant temperature of 37 °C for 60 minutes.

8. The application of the LAMP primers according to claim 1 in the detection of pine wood nematode.

9. The application of the CRISPR RNA according to claim 2 in the detection of pine wood nematode.

10. The application of the kit according to claim 4 in the detection of pine wood nematode.