Fusion protein of targeted specific antigen GPC3 and application of fusion protein

Abstract

The invention discloses a fusion protein of a targeted specific antigen GPC3 and application thereof, and relates to the technical field of biological medicine, the fusion protein comprises an IPA structural region and a Cltx structural region; the IPA is a GPC3 C terminal targeting peptide, and the Cltx is chlorotoxin. A prokaryotic expression vector pET-32a-TrxA-IPA-Cltx is designed, soluble expression is achieved in escherichia coli, and the recombinant protein with electrophoresis-grade purity is obtained through purification. In-vitro experiments prove that the fusion protein has no significant inhibition effect on the cell viability of HL-7702, but can significantly inhibit the cell viability of liver cancer cells HepG2, Hep3B and MHCC97H and induce cell apoptosis. The IPA targeting domain is combined with the antitumor function of Cltx for the first time, a new strategy is provided for targeted therapy of GPC3 high-expression hepatoma carcinoma cells, and clinical application potential is achieved.

Description

A fusion protein targeting the specific antigen GPC3 and its applications Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the design method, preparation process, and application of a fusion protein IPA-Cltx targeting the hepatocellular carcinoma-specific antigen GPC3 in anti-tumor activity. Background Technology

[0002] Glypican-3 (GPC3), a member of the heparan sulfate (HS) proteoglycan family, is located on the X chromosome (Xq26), has a molecular weight of 70 kDa, and consists of 580 amino acids. Anchored to the cell membrane by phosphatidylinositol, it is a multifunctional co-receptor on the cell surface, playing a crucial role in mediating signal transduction. It can influence signal transduction by binding to the extracellular matrix, growth factors, and proteases, thereby regulating tumor cell proliferation, differentiation, adhesion, and metastasis. In HCC patients, GPC3 is overexpressed at both the gene and protein levels, but its expression is extremely limited or absent in normal adult tissues, indicating its potential value as a biomarker in liver cancer, making it a potential biomarker for liver cancer diagnosis and treatment. The high-affinity humanized antibody GC33, which identifies the C-terminus of GPC3, is currently being evaluated in preclinical or clinical development for liver cancer treatment. Researchers have proposed a novel GPC3 C-terminal targeting peptide, DYEMHLWWGTEL, named IPA (Zhang Q, Han Z, Tao J, Zhao M, Zhang W, Li P, Tang L, Gu Y. An innovative peptide with high affinity to GPC3 for hepatocellular carcinoma diagnosis. Biomater Sci. 2018 Dec 18;7(1):159-167. doi: 10.1039 / c8bm01016a.PMID: 30417190.), by analyzing the heavy chain variable region (VH) domain of GC33. The peptide IPA exhibits good GPC3 targeting, high affinity, specific binding, and in vivo recognition ability.

[0003] Chlorotoxin (Cltx) is a small, disulfide-rich, toxic peptide composed of 36 amino acids, isolated from the venom of the Israeli golden scorpion (Leiurus quinquestriatus). It can diffuse or cross cell membranes and penetrate deep into internal tissues or hardened tumors. Cltx binds to specific receptors on the surface of tumor cells, causing internalization and downregulation of matrix metalloproteinase 2 (MMP-2) and chloride channel protein 3 (CIC-3) in malignant cells, thereby inhibiting tumor cell migration and invasion. However, it has not yet been used in targeted therapy for hepatocellular carcinoma, and its targeting association with GPC3 has not been explored.

[0004] Liver cancer ranks sixth in incidence and third in mortality worldwide, making it one of the most common causes of cancer death globally, characterized by high recurrence rates and drug resistance. Primary and secondary liver cancers are the two main identified types. Hepatocellular carcinoma (HCC) is the most common subtype of liver cancer, accounting for 80% of all cases. Treatment strategies for liver cancer vary depending on factors such as disease stage, liver function status, tumor size, and location, and mainly include surgical resection, liver transplantation, local ablation therapy, transcatheter arterial chemoembolization (TACE), systemic therapy (targeted therapy, immunotherapy), and palliative care. For patients with early-stage HCC, surgical resection remains the preferred treatment. However, postoperative recurrence of HCC remains a major problem after resection, with a recurrence rate exceeding 70% within 5 years. For patients with unresectable intermediate-stage HCC, interventional therapy is the preferred treatment. For patients with advanced-stage HCC, current clinical treatment strategies include: (a) transarterial chemoembolization (TACE), clinical data shows that compared to conservative treatment alone, patients with advanced HCC who receive this therapy have a 23% higher two-year survival rate; (b) oral sorafenib targeted therapy, as the first approved multi-target kinase inhibitor, it remains a first-line treatment option for patients with advanced liver cancer. However, less than one-third of patients benefit from this treatment, and significant drug resistance develops within six months of starting the therapy. Long-term use of chemotherapy drugs such as sorafenib can also lead to toxic reactions or drug failure. It is noteworthy that neither existing local ablation therapies nor systemic chemotherapy regimens have significantly improved the overall treatment outcomes of this malignant disease. Emerging treatment directions include immunotherapy and targeted therapy. Traditional systemic chemotherapy has low efficacy, significant side effects, and is prone to drug resistance, offering almost no survival benefit. Compared to traditional chemotherapy, targeted therapy has the advantages of more clearly defined targets, precise treatment of liver cancer, and fewer side effects.

[0005] Currently, there are no reports on the design of fusion proteins that target GPC3 using chlortoxin, nor are there any mature methods for efficiently expressing such fusion proteins in prokaryotic systems. Therefore, there is an urgent need to develop novel drugs that combine precise targeting with production feasibility. Summary of the Invention

[0006] The primary objective of this invention is to provide a fusion protein IPA-Cltx that targets the specific antigen GPC3. The invention also includes providing a nucleic acid molecule encoding the fusion protein, an expression vector containing the nucleic acid molecule, and a host cell containing the expression vector; furthermore, it provides a method for preparing the fusion protein, a pharmaceutical composition containing the fusion protein, and the pharmaceutical use of the fusion protein or the pharmaceutical composition in the preparation of medicines for treating tumor-related diseases.

[0007] To achieve the above objectives, the present invention provides the following technical solution: A first aspect of the present invention provides a fusion protein targeting the specific antigen GPC3, comprising a first structural region and a second structural region, or the fusion protein further comprising a third structural region; the first structural region is IPA, the second structural region is Cltx, and the third structural region is a linker (GGGS)n, where G represents glycine, S represents serine, and n is a positive integer selected from 1 to 6; the IPA or Cltx comprises its functional fragment or variant; the IPA structural region is capable of specifically binding to GPC3.

[0008] A second aspect of the invention provides a polynucleotide encoding a fusion protein of the target-specific antigen GPC3.

[0009] A third aspect of the invention provides an expression vector comprising the aforementioned polynucleotide.

[0010] A fourth aspect of the invention provides a host cell comprising the expression vector or genome in which the exogenous polynucleotide is integrated.

[0011] A fifth aspect of the present invention provides a method for preparing the fusion protein, comprising the steps of: synthesizing the fusion protein, and / or culturing the host cells under suitable expression conditions, and recovering and purifying the fusion protein from the culture.

[0012] A sixth aspect of the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of the fusion protein and a pharmaceutically acceptable excipient or carrier.

[0013] A seventh aspect of the invention provides the use of the fusion protein or the pharmaceutical composition described herein in the preparation of an antitumor drug. The tumor is selected from carcinomas, lymphomas, blastomas (including medulloblastoma and retinoblastoma), sarcomas (including liposarcoma and synovial cell sarcoma), neuroendocrine tumors (including carcinoid tumors, gastrinomas, and islet cell carcinomas), liver cancer, mesotheliomas, schwannomas (including acoustic neuromas), meningiomas, adenocarcinomas, and melanomas.

[0014] An eighth aspect of the invention provides a method of using the fusion protein or the pharmaceutical composition described herein in the prevention and / or treatment of tumors, comprising administering a pharmaceutically effective amount of the fusion protein or the pharmaceutical composition to a subject.

[0015] The beneficial effects of this invention are as follows: 1. This invention provides a novel targeted therapy strategy, innovatively fusing IPA with chloramphenicol (Cltx) to successfully prepare and construct the fusion protein IPA-Cltx. This fusion protein can specifically bind to the GPC3 target, inducing cancer cell death by activating the apoptosis pathway, achieving precise killing of cancer cells. Its mechanism of action is clear and its targeting is prominent, providing a novel technical path and application direction for targeted therapy of malignant tumors.

[0016] 2. This invention screened and determined the optimal isolation and purification conditions for the TrxA-IPA-Cltx fusion protein through multiple parallel experiments, successfully obtaining a high-purity fusion protein. Further experiments, including in vitro binding assays and cell activity detection, verified the fusion protein's specific targeting ability to GPC3 and its potent anti-tumor activity, as well as its ability to efficiently activate the apoptosis pathway in cancer cells. Compared to single-function proteins, the fusion protein IPA-Cltx exhibits superior anti-cancer biological effects and has broader application prospects in the field of tumor treatment. Its specific advantages are twofold: firstly, it significantly enhances its GPC3 targeting ability, resulting in more precise targeting; secondly, it can exert highly efficient anti-tumor activity at relatively low doses (100 μmol / L). Developing this fusion protein into a clinical anti-tumor drug could achieve breakthroughs in key indicators such as therapeutic efficacy, drug safety, formulation stability, and in vivo duration of action, and is expected to become a highly valuable candidate drug for targeted tumor therapy.

[0017] 3. The technical solution of the present invention is particularly applicable to the targeted therapy of hepatocellular carcinoma with high GPC3 expression. By leveraging the specific binding ability and cytotoxic effect of the fusion protein to the target, the proliferation and metastasis of tumor cells can be effectively blocked, providing a practical new solution for the precision treatment of hepatocellular carcinoma. Attached Figure Description

[0018] Figure 1 shows the spectrum of pET-32a-IPA-Cltx in this invention.

[0019] Figure 2 shows the experimental results of cloning the pET-32a-IPA-Cltx recombinant plasmid in this invention; where A. agarose gel electrophoresis of pET-28a-IPA-Cltx PCR product; M: DL 2000 DNA Marker; 1: pET-28a-IPA-Cltx PCR product; B. agarose gel electrophoresis of pET-28a-IPA-Cltx PCR product after double enzyme digestion; M: DL 2000 DNA Marker; 1: pET-28a-IPA-Cltx PCR product after double enzyme digestion with EcoRI and NcoI; C. agarose gel electrophoresis of pET-32a plasmid after double enzyme digestion; M: DL 1000 DNA Marker. Marker; 1: pET-32a plasmid digested with EcoRI and NcoI; D. Agarose gel electrophoresis results of the plasmid extracted after transformation of the enzyme ligation product pET-32a-TrxA-IPA-Cltx; M: DL 1000 DNA Marker; 1: Enzyme ligation product pET-32a-TrxA-IPA-Cltx.

[0020] Figure 3 shows the SDS-PAGE electrophoresis analysis of pET-32a-TrxA-IPA-Cltx-BL21 induced at 37℃ in this invention; M: Marker 26610; 1: pET-32a-BL21 uninduced whole bacteria; 2: pET-32a-BL21 induced whole bacteria; 3: pET-32a-BL21 induced supernatant; 4: pET-32a-BL21 induced precipitation; 5: pET-32a-TrxA-IPA-Cltx-BL21 uninduced whole bacteria; 6: pET-32a-TrxA-IPA-Cltx-BL21 induced whole bacteria; 7: pET-32a-TrxA-IPA-Cltx-BL21 induced supernatant; 8: pET-32a-TrxA-IPA-Cltx-BL21 induced precipitation.

[0021] Figure 4 shows the SDS-PAGE gel electrophoresis results of TrxA-IPA-Cltx protein metal chelate affinity chromatography in this invention; where M: Marker 26610; Lane 1: TrxA-IPA-Cltx induced histone supernatant; Lane 2: TrxA-IPA-Cltx induced histone permeate; Lane 3: TrxA-IPA-Cltx protein permeate equilibration buffer; Lane 4: 4% Triton X-100 permeate; Lane 5: 30% ethanol permeate; Lane 6: Elution buffer A elution phase; Lane 7: Elution buffer C elution phase; Lane 8: Elution buffer E elution phase.

[0022] Figure 5 shows the SDS-PAGE gel electrophoresis results of TrxA-IPA-Cltx after ultrafiltration concentration in this invention; M: Marker 26610; 1: TrxA-IPA-Cltx ultrafiltration concentrated protein solution; 2: TrxA-IPA-Cltx ultrafiltration filtrate.

[0023] Figure 6 shows the results of Tricine-SDS-PAGE electrophoresis of TrxA-IPA-Cltx protein digested with thrombin at 4℃ in this invention; M: ultra-low molecular weight protein marker; 1: TrxA-IPA-Cltx protein ultrafiltrate; 2: TrxA-IPA-Cltx protein ultrafiltrate digestion for 1 h; 3: TrxA-IPA-Cltx protein ultrafiltrate digestion for 2 h; 4: TrxA-IPA-Cltx protein ultrafiltrate digestion for 3 h; 5: TrxA-IPA-Cltx protein ultrafiltrate digestion for 6 h; 6: TrxA-IPA-Cltx protein ultrafiltrate digestion for 9 h; 7: TrxA-IPA-Cltx protein ultrafiltrate digestion for 12 h; 8: TrxA-IPA-Cltx protein ultrafiltrate digestion for 24 h.

[0024] Figure 7 shows the results of Tricine-SDS-PAGE electrophoresis of TrxA-IPA-Cltx protein after thrombin digestion in this invention; M: ultra-low molecular weight protein marker; 1: TrxA-IPA-Cltx after thrombin digestion; 2: elution phase of elution buffer C after digestion; 3: permeate of TrxA-IPA-Cltx protein after digestion.

[0025] Figure 8 shows the BCA standard curve in this invention.

[0026] Figure 9 shows the SDS-PAGE gel electrophoresis results of the purification of TrxA-IPA-Cltx polyclonal antibody in this invention; M: Marker 26610; 1: TrxA-IPA-Cltx polyclonal antigen sample; 2: TrxA-IPA-Cltx polyclonal antibody permeation solution; 3: TrxA-IPA-Cltx purified polyclonal antibody.

[0027] Figure 10 shows the recognition ability of rabbit-derived anti-TrxA-IPA-Cltx polyclonal antibody detected by Western blotting in this invention; M: Marker 26616; 1: Purified TrxA-IPA-Cltx.

[0028] Figure 11 shows the effects of TrxA, TrxA-IPA-Cltx, and IPA-Cltx on the viability of HepG2 liver cancer cells in this invention; A. Cell survival rate (%) of HepG2 liver cancer cells after treatment with different concentrations of TrxA for 48 h; B. Cell survival rate (%) of HepG2 liver cancer cells after treatment with different concentrations of TrxA-IPA-Cltx for 48 h; C. Cell survival rate (%) of HepG2 liver cancer cells after treatment with different concentrations of IPA-Cltx for 48 h; (Data: mean±SEM; n=3; *P<0.05vsControl; **P<0.01vsControl; ***P<0.001vsControl).

[0029] Figure 12 shows the effects of TrxA, TrxA-IPA-Cltx, and IPA-Cltx on the viability of Hep3B liver cancer cells in this invention; A. Cell survival rate (%) of Hep3B liver cancer cells after treatment with different concentrations of TrxA for 48 h; B. Cell survival rate (%) of Hep3B liver cancer cells after treatment with different concentrations of TrxA-IPA-Cltx for 48 h; C. Cell survival rate (%) of Hep3B liver cancer cells after treatment with different concentrations of IPA-Cltx for 48 h; (Data: mean±SEM; n=3; *P<0.05vsControl; **P<0.01vsControl; ***P<0.001vsControl).

[0030] Figure 13 shows the effects of TrxA, TrxA-IPA-Cltx, and IPA-Cltx on the viability of MHCC97H liver cancer cells in this invention; A. Cell survival rate (%) of MHCC97H liver cancer cells after treatment with different concentrations of TrxA for 48 h; B. Cell survival rate (%) of MHCC97H liver cancer cells after treatment with different concentrations of TrxA-IPA-Cltx for 48 h; C. Cell survival rate (%) of MHCC97H liver cancer cells after treatment with different concentrations of IPA-Cltx for 48 h; (Data: mean±SEM; n=3; **P<0.01vsControl; ***P<0.001vsControl).

[0031] Figure 14 shows the effects of TrxA, TrxA-IPA-Cltx, and IPA-Cltx on the viability of human hepatocytes HL-7702 in this invention; A. Cell survival rate (%) of human hepatocytes HL-7702 after treatment with different concentrations of TrxA for 48 h; B. Cell survival rate (%) of human hepatocytes HL-7702 after treatment with different concentrations of TrxA-IPA-Cltx for 48 h; C. Cell survival rate (%) of human hepatocytes HL-7702 after treatment with different concentrations of IPA-Cltx for 48 h; (Data: mean±SEM; n=3).

[0032] Figure 15 shows the effect of TrxA on apoptosis of HepG2 liver cancer cells in this invention; A. Flow cytometry analysis of HepG2 liver cancer cells treated with different concentrations of TrxA; B. Bar graph of apoptosis rate of HepG2 liver cancer cells treated with different concentrations of TrxA; (Data: mean±SEM; n=3).

[0033] Figure 16 shows the effect of TrxA-IPA-Cltx on apoptosis of HepG2 liver cancer cells in this invention; A. Flow cytometry analysis of HepG2 liver cancer cells treated with different concentrations of TrxA-IPA-Cltx; B. Bar graph of apoptosis rate of HepG2 liver cancer cells treated with different concentrations of TrxA-IPA-Cltx; (Data: mean±SEM; n=3; *P<0.05vsControl; **P<0.01vsControl).

[0034] Figure 17 shows the expression of Caspase-8 and Caspase-3 in HepG2 liver cancer cells after treatment with different concentrations of TrxA and TrxA-IPA-Cltx by Western Blot in this invention; A. Caspase-3 and Caspase-8 protein expression; B. Gray-scale statistical diagram of Caspase-3 and Caspase-8 protein expression; (Data: mean±SEM; n=3; *P<0.05vsControl; **P<0.01vsControl; ***P<0.001vsControl).

[0035] Figure 18 shows the immunocytochemical results of TrxA and TrxA-IPA-Cltx with HepG2 liver cancer cells in this invention; A, B, C, and D are the fluorescence merge, DAPI staining, FITC staining, and PE staining images of the control group, respectively; E, F, G, and H are the fluorescence merge, DAPI staining, FITC staining, and PE staining images of the TrxA group, respectively; I, J, K, and L are the fluorescence merge, DAPI staining, FITC staining, and PE staining images of the TrxA-IPA-Cltx group, respectively; (n=3; scale bar: 50 μm).

[0036] Figure 19 shows the immunocytochemical results of TrxA and TrxA-IPA-Cltx with HL-7702 hepatocytes in this invention; A, B, C, and D are the fluorescence merge, DAPI staining, FITC staining, and PE staining images of the control group, respectively; E, F, G, and H are the fluorescence merge, DAPI staining, FITC staining, and PE staining images of the TrxA group, respectively; I, J, K, and L are the fluorescence merge, DAPI staining, FITC staining, and PE staining images of the TrxA-IPA-Cltx group, respectively; (n=3; scale bar: 50 μm).

[0037] Figure 20 shows the immunocytochemical results of TrxA and TrxA-IPA-Cltx mixed with HepG2 liver cancer cells HL-7702 in this invention; A, B, C, and D are the fluorescence merge, DAPI staining, FITC staining, and PE staining images of the control group, respectively; E, F, G, and H are the fluorescence merge, DAPI staining, FITC staining, and PE staining images of the TrxA group, respectively; I, J, K, and L are the fluorescence merge, DAPI staining, FITC staining, and PE staining images of the TrxA-IPA-Cltx group, respectively; (n=3; scale bar: 50 μm). Detailed Implementation

[0038] The embodiments described below are only some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.

[0039] Liver cancer, a highly malignant digestive system tumor, generally has a poor clinical prognosis, and existing treatments have limited effectiveness, necessitating the development of new targeted therapies. GPC3 exhibits higher sensitivity and specificity in the early diagnosis of liver cancer and is highly expressed in hepatocellular carcinoma, closely associated with poor patient prognosis. In the following examples, this invention utilizes the high-affinity targeting properties of the GPC3 ligand (IPA) to fuse it with the antitumor functional domain of chloramphenicol (Cltx), constructing the fusion protein IPA-Cltx. Soluble expression was achieved in *E. coli* using the designed prokaryotic expression vector pET-32a-TrxA-IPA-Cltx (containing a 6×His tag), and the TrxA-IPA-Cltx fusion protein was purified to electrophoretic purity. In vitro experiments confirmed that this fusion protein significantly inhibited the viability of HepG2, Hep3B, and MHCC97H liver cancer cells and induced apoptosis. Its mechanism of action is related to targeting GPC3 on the surface of hepatocellular carcinoma cells and regulating downstream signaling pathways. This invention is the first to combine the IPA targeting domain with the anti-tumor function of Cltx, providing a new strategy for targeted therapy of GPC3-overexpressing liver cancer, and has potential for clinical application.

[0040] The present invention aims to provide a fusion protein IPA-Cltx that targets the specific antigen GPC3. The present invention also aims to provide a nucleic acid molecule of the fusion protein, an expression vector containing the nucleic acid molecule, and a host cell containing the expression vector; the present invention also provides a method for preparing the fusion protein, a pharmaceutical composition containing the fusion protein, and the pharmaceutical use of the fusion protein or the pharmaceutical composition in the preparation of medicines for the prevention and / or treatment of cancer-related diseases.

[0041] A fusion protein IPA-Cltx targeting the specific antigen GPC3, comprising a first structural region and a second structural region, or the fusion protein further comprising a third structural region; the first structural region is IPA, the second structural region is Cltx, and the third structural region is a linker; the IPA or Cltx comprises a functional fragment (i.e., a partial amino acid sequence retaining the biological function of the IPA or Cltx) or a variant thereof; the IPA structural region is capable of specifically binding to GPC3. The fusion protein has at least 95%, 96%, 97%, 98%, or 99% sequence homology with the amino acid sequence shown in SEQ ID NO. 1. The variant has at least 80%-99% sequence identity with SEQ ID NO. 3 (standard IPA sequence) or SEQ ID NO. 5 (standard Cltx sequence), and retains the amino acid sequence for binding to GPC3 and antitumor activity.

[0042] In an optional embodiment, the first and second structural regions are connected by a linker, and the linker for the third structural region is (GGGS)n, where n is a positive integer from 1 to 6, G represents glycine, and S represents serine. When n=2, the amino acid sequence of this linker is GGGSGGGS, and the specific amino acid and nucleic acid sequences are shown in SEQ ID NO. 7 and SEQ ID NO. 8.

[0043] A polynucleotide encoding the fusion protein IPA-Cltx described in this invention.

[0044] In an optional embodiment, the polynucleotide comprises a nucleic acid sequence selected from SEQ ID NO. 2, SEQ ID NO. 4 and SEQ ID NO. 6.

[0045] SEQ ID NO. 1: Amino acid sequence of fusion protein IPA-Cltx; SEQ ID NO. 2: Nucleic acid sequence of fusion protein IPA-Cltx; SEQ ID NO. 3: Amino acid sequence of IPA in the first structural region; SEQ ID NO. 4: Nucleic acid sequence of IPA in the first structural region; SEQ ID NO. 5: Amino acid sequence of Cltx in the second structural region; SEQ ID NO. 6: Nucleic acid sequence of Cltx in the second structural region; SEQ ID NO. 7: Amino acid sequence of Linker; SEQ ID NO. 8: Nucleic acid sequence of Linker.

[0046] An expression vector comprising the polynucleotides described above.

[0047] A host cell comprising the expression vector or genome in which the exogenous polynucleotide is integrated.

[0048] A method for preparing the fusion protein includes the following steps: synthesizing the fusion protein, and / or culturing the host cells under suitable expression conditions, and recovering and purifying the fusion protein from the culture.

[0049] A pharmaceutical composition comprising a therapeutically effective amount of the fusion protein and pharmaceutically acceptable excipients and a carrier.

[0050] The fusion protein or the pharmaceutical composition described herein is used to prepare a drug for the prevention and / or treatment of tumors.

[0051] In optional embodiments, the tumor includes carcinoma, lymphoma, blastoma (including medulloblastoma and retinoblastoma), sarcoma (including liposarcoma and synovial cell sarcoma), neuroendocrine tumor (including carcinoid tumor, gastrinoma and islet cell carcinoma), liver cancer, mesothelioma, schwannoma (including acoustic neuroma), meningioma, adenocarcinoma and melanoma.

[0052] A method of using the fusion protein or the pharmaceutical composition described herein in the prevention and / or treatment of tumors, comprising administering a pharmaceutically effective amount of the fusion protein or the pharmaceutical composition to a subject.

[0053] In an optional implementation, the treatment of the tumor includes all cancer types that contain high / overexpression of GPC3. Tumors include carcinomas, lymphomas, blastomas (including medulloblastoma and retinoblastoma), sarcomas (including liposarcoma and synovial cell sarcoma), neuroendocrine tumors (including carcinoid tumors, gastrinomas, and islet cell carcinomas), liver cancer, mesotheliomas, schwannomas (including acoustic neuromas), meningiomas, adenocarcinomas, and melanomas.

[0054] In an optional embodiment, the method further includes administering a second active molecule. The second active molecule includes a cancer treatment drug.

[0055] In an optional implementation, the above-mentioned tumor treatment is related to the apoptosis pathway.

[0056] The amino acid sequences in this invention are arranged sequentially from the N-terminus to the C-terminus.

[0057] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here.

[0058] Unless otherwise defined, all technical and scientific terms used in this invention shall have the meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0059] IPA: The term "IPA" refers to a novel GPC3 C-terminal targeting peptide proposed by researchers through analysis of the variable heavy chain (VH) domain of the high-affinity humanized antibody GC33 at the C-terminus of GPC3. The peptide IPA exhibits good GPC3 targeting, high affinity, specific binding, and in vivo recognition capabilities.

[0060] Cltx: The term "Cltx" refers to a tiny, toxic peptide composed of 36 amino acids and rich in disulfide bonds, isolated from the venom of the Israeli golden scorpion (Leiurus quinquestriatus). It is a chloride channel blocker and has anticancer activity.

[0061] Sequence homology: Methods for determining sequence homology known to those skilled in the art include: *Computational Molecular Biology*, Lesk, AM (ed.), Oxford University Press, New York, 1988; *Biocomputing: Informatics and Genome Projects*, Smith, DW (ed.), Academic Press, New York, 1993; *Computer Analysis of Sequence Data*, Part I, Griffin, AM & Griffin, H. G (eds.), Humana Press, New Jersey, 1994; *Sequence Analysis in Molecular Biology*, von Heinje, G., Academic Press, 1987; *Sequence Analysis Primer*, Gribskov, M. & Devereux, J. (eds.), Stockton Press, New York, 1991; and Carillo, H. & Lipman, D., SIAM J.Appl. Math., 48:1073 (1988). Preferred methods for determining homology aim to achieve the largest possible match between the tested sequences. Methods for determining homology are compiled into publicly available computer programs. Preferred computer program methods for determining homology between two sequences include, but are not limited to: the GCG package (Devereux, J. et al., 1984), BLASTP, BLASTN, and FASTA (Altschul, SF et al., 1990). The BLASTX program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al., NCBI, NLM, NIH, Bethesda, Md. 20894; Altschul, S. et al., 1990). The well-known Smith-Waterman algorithm can also be used to determine homology.

[0062] Fusion protein: The term "fusion protein" refers to a new polypeptide sequence obtained by fusing multiple identical or different polypeptide sequences. The term "fusion" refers to the connection by direct peptide bonds or by means of one or more linkers (peptide adapters). The term "linker (peptide adapter)" refers to a short peptide that can connect two polypeptide sequences, typically 1-30 amino acids in length. Preferably, the peptide adapter is a flexible peptide adapter. Suitable examples of adapters include monoglycine (Gly) or serine (Ser) residues, and the identification and sequence of amino acid residues in the adapter can vary depending on the type of secondary structural element that needs to be achieved in the adapter.

[0063] Multiple: The term "multiple" refers to at least two.

[0064] Nucleic Acid Encoding and Expression Vector: This invention also provides a nucleic acid molecule encoding the above-described fusion protein. The nucleic acid of this invention can be in DNA or RNA form. The DNA form includes cDNA, genomic DNA, and artificially synthesized DNA. The DNA can be single-stranded or double-stranded. The DNA can be a coding strand or a non-coding strand. The sequence of the DNA molecule of the fusion protein of this invention can be obtained using conventional techniques, such as PCR amplification. Alternatively, the relevant sequence can be synthesized artificially.

[0065] This invention also relates to vectors comprising the aforementioned suitable DNA sequences and suitable promoters or control sequences. These vectors can be used to transform suitable host cells to enable them to express proteins. The vectors described herein are conventional expression vectors in the art, referring to expression vectors containing suitable regulatory sequences, such as promoter sequences, terminator sequences, polyadenylation sequences, enhancer sequences, marker genes and / or sequences, and other suitable sequences. The expression vectors can be viruses or plasmids, such as suitable bacteriophages or phage particles; for more technical details, please refer to, for example, Sambrook et al., *Molecular Cloning: A Laboratory Manual*, 2nd edition, Cold Spring Harbor Laboratory Press, 1989. Many known techniques and methods for nucleic acid manipulation can be found in *Current Protocols in Molecular Biology*, 2nd edition, edited by Ausubel et al. The expression vectors described in this invention are preferably pSYPU-1b and pET32a.

[0066] In this invention, the term "host cell" refers to any type of host cell conventional in the art, as long as it enables the vector to replicate stably and the carried polynucleotide molecules to be effectively expressed. The host cell includes prokaryotic expression cells and eukaryotic expression cells, and the preferred host cells are: COS, CHO, NSO, sf9, sf21, DH5α, BL21(DE3), TG1, BL21(DE3), 293F, or 293E cells.

[0067] Pharmaceutical composition: The term "pharmaceutical composition" refers to a single or compound pharmaceutical preparation consisting of the polypeptide or variant thereof, fusion protein of the present invention, together with pharmaceutically acceptable excipients and carriers. The excipients and carriers include those well known to those skilled in the art, and suitable carriers and excipients include human serum albumin, saline, buffer solution, glucose, water, glycerol, ethanol, glycine, sorbic acid, potassium sorbate, and combinations thereof.

[0068] The pharmaceutical compositions of the present invention can be in a variety of dosage forms, including liquid solutions or suspensions, injections, liposomes, etc. Preferred dosage forms depend on the administration method and the intended use. The pharmaceutical compositions of the present invention can be administered to subjects using conventional administration methods, including intravenous, peritoneal, intramuscular, and subcutaneous administration.

[0069] This invention, through multiple rounds of protein engineering and screening, has obtained a specific fusion protein IPA-Cltx that can target GPC3, exhibiting anticancer activity that surpasses the use of Cltx alone or other fusion proteins, and will play a more effective and broader therapeutic role in related cancer treatments.

[0070] The present invention will be further described below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify detailed conditions are generally performed under conventional conditions as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer.

[0071] Example 1 Molecular design of the IPA-Cltx gene: Based on the reported amino acid sequence of scorpion venom chlortoxin Chlorotoxin (protein registry number: P45639), the nucleotide sequence encoding the protein was deduced using conventional methods, while taking into account the codon bias of E. coli.

[0072] Initially, the IPA-Cltx sequence was designed and ligated into a vector to achieve the expression of the target protein. However, the target protein was not expressed after ligation into the pET-28a vector. The vector was then changed to pSYPU-1b, but the target protein was still not expressed after verification. Therefore, the vector was changed to the fusion expression vector pET-32a.

[0073] Therefore, primers were designed first to perform PCR amplification to obtain the target gene W1.

[0074] The upstream primer was P1: 5'CATGCCATGGCTGACTACGAAATGCACCTA3', and the downstream primer was P2: 5'CGGAATTCTTAGCGACACAAACATTGAGG3'.

[0075] PCR amplification was performed using pET-28a-IPA-Cltx as a template: 0.6 μL template, 0.4 μL upstream primer, 0.4 μL downstream primer, 0.4 μL dNTP (2.5 mM), 2.0 μL 10×Ex Taq Buffer, 0.2 μL Ex Taq DNA ligase, and 16.0 μL deionized water were added to the EP tube. Then, PCR amplification was performed using a PCR instrument to obtain the target gene (Figure 2A).

[0076] Example 2 Construction of the recombinant expression vector for IPA-Cltx protein: A: Double digestion and ligation of IPA-Cltx and pET-32a; The recovered PCR product and expression vector pET-32a plasmid were digested with restriction endonucleases NcoI and EcoRI (Takara products).

[0077] (1) Target fragment IPA-Cltx: Add 8 μL each of deionized water and PCR amplification product IPA-Cltx, 2 μL of 10×Quick Cut Buffer, and 1.0 μL each of NcoI and EcoRI restriction enzymes to the EP tube. Incubate at 37℃ for 2 h (Figure 2B).

[0078] (2) Cut out the area to be replaced in pET-32a: Add deionized water, 8 μL of pET-32a, 2 μL of 10×Quick Cut Buffer, and 1.0 μL each of NcoI and EcoRI restriction enzymes to the EP tube. Incubate at 37℃ for 2 h (Figure 2C).

[0079] The amplification product and the double digestion product of pET-32a were subjected to agarose gel electrophoresis to verify the size of the target fragment IPA-Cltx and the region to be replaced in pET-32a. Then, the agarose gel was processed according to Thermo Scientific...TM The GeneJET gel extraction kit was followed to extract the target fragment IPA-Cltx and the linearized new vector pET-32a. T4 DNA ligase: 1.0 μL, 10×T4 DNA Ligase Buffer: 2.0 μL, pET-32a digestion vector: 3.0 μL, and target fragment digestion product: 14.0 μL were added to an EP tube. The tube was incubated at 16°C for 16 h (Figure 2D).

[0080] B: Preparation of competent Escherichia coli DH5a and BL21 cells; Preparation of competent DH5α cells (purchased from China Center for Type Culture Collection, this strain DH5α is a common strain): Single colonies were picked from solid culture plates and inoculated into 3 mL of liquid culture medium. The culture was incubated at 37℃ and 220 rpm for 12-14 h. 500 μL of bacterial culture was inoculated into 50 mL of liquid culture medium and incubated at 37℃ and 220 rpm for 3-4 h. 0.1 mol / L CaCl2 and glycerol were added to the culture medium that had reached the logarithmic growth phase. The medium was incubated on ice for 30 min. At the same time, 50 mL of sterilized and dried centrifuge tubes were pre-cooled in a refrigerator. In a clean bench, the liquid culture medium was dispensed into 50 mL centrifuge tubes and the tube openings were sealed with sealing film. The sealed centrifuge tubes were placed in a pre-cooled 4℃ centrifuge and centrifuged at 3500 rpm for 10 min. The supernatant was discarded in a clean bench, 5 mL of pre-cooled CaCl2 was added, and the mixture was blown well and incubated on ice for 20 min. Centrifuge at 4°C for 3500 rpm for 10 min. Discard the supernatant in a clean bench and add CaCl2 and glycerol. Aliquot 100 μL into 1.5 mL EP tubes and store at -80°C. The preparation of BL21 competent cells is the same as that of DH5α competent cells.

[0081] C: Transform E. coli DH5α (BL21) competent cells with recombinant plasmid pET-32a-TrxA--IPA-Cltx; remove competent cells from -80℃ freezer and thaw in an ice box for 3 min. Add 1 μL-2 μL of positive recombinant plasmid to a clean bench and incubate on ice for 30 min. Heat shock at 42℃ for 90 s, then incubate on ice for 1-2 min. Add 1 mL of liquid culture medium to a clean bench and incubate at 37℃ and 220 rpm for 45 min. Centrifuge at 3500 rpm for 5 min, discard the supernatant in a clean bench, and rehydrate the remaining 50 μL-100 μL of the bacterial culture. Place the bacterial culture on an agar plate containing the corresponding antibiotic, spread evenly using a triangular spreader, and incubate upright in a 37℃ oven for 10 min, then invert overnight for 12-14 h. Remove the plate culture medium that has been incubated overnight for 12-14 hours, pick a single colony and inoculate it into a 5 mL test tube containing the corresponding antibiotic resistance medium. Incubate at 220 rpm and 37°C for 12-14 hours.

[0082] According to Thermo Scientific TM Extract plasmid DNA using the GeneJET plasmid miniprep kit instructions and store the extracted plasmid DNA at -20°C. Transform E. coli BL21 competent cells following the same procedure.

[0083] Example 3: Expression of recombinant pET-32a-BL21 and pET-32a-TrxA-IPA-Cltx-BL21 proteins: Single colonies of pET-32a-BL21 and pET-32a-TrxA-IPA-Cltx-BL21 cultured overnight (12-14 h) were picked and inoculated into 5 mL of liquid medium containing the corresponding antibiotic at a bacterial culture:medium ratio of 1:100. The cultures were incubated at 37°C and 220 rpm for 12-14 h. 30 μL of bacterial culture was then transferred from each test tube to 3 mL of liquid medium containing the corresponding antibiotic, labeled as the induction group and the non-induction group, respectively. The cultures were incubated at 37°C and 220 rpm. After 4 h of incubation, IPTG was added to the induction group at a ratio of IPTG:medium medium of 1:4000, and incubation continued. After 4 h of incubation, the cultures were centrifuged at 3500 rpm for 20 min, and the supernatant was discarded. Add 1 mL of pure water to each bacterial precipitate and mix well. Take 25 μL of the bacterial solution and add 25 μL of 2× Loading Buffer, mix well and set aside. Take 900 μL of the induced group bacterial solution and sonicate for 5 min. Centrifuge the lysed solution at 12000 rpm for 20 min, take 25 μL of the supernatant and add 25 μL of Loading Buffer, mix well and set aside. Add 900 μL of pure water to dissolve the precipitate, take 25 μL of the supernatant and add 25 μL of Loading Buffer, mix well and set aside. Then perform SDS-PAGE gel electrophoresis to verify that recombinant pET-32a-BL21 and pET-32a-TrxA-IPA-Cltx-BL21 can express TrxA and TrxA-IPA-Cltx (Figure 3).

[0084] Example 4: Isolation and purification of recombinant pET-32a-BL21 and pET-32a-TrxA-IPA-Cltx-BL21 proteins: In a clean bench, 50 mL of LB liquid medium was prepared, and glycerol bacteria and 100 mg / mL ampicillin (Amp) were added at 1:100 and 1:1000 respectively. The cultures were incubated at 37°C and 220 rpm with shaking for 12 h. 4 L of LB liquid medium was prepared, and bacterial culture and 60 mg / mL Amp were added at 1:100 and 1:1000 respectively. The cultures were incubated at 37°C and 220 rpm with shaking for 4 h. 200 mg / mL IPTG was added at 1:4000, and the cultures were incubated at 37°C and 220 rpm with shaking for 4 h. After centrifugation at 3500 rpm for 20 min, the supernatant was discarded, and the cells were washed twice with 0.9% NaCl solution. The bacterial cells were collected and stored at -20°C for later use. Before use, the bacterial cells were resuspended in 45 mL of equilibration buffer and sonicated at 70% amplitude for 8 min, with 4 s intervals and 16 s intervals between sonication. The lysed solution was centrifuged at 12000 rpm for 20 min, and the supernatant was collected and stored at 4°C. The protein sample was pumped into a Chelating Sepharose FastFlow column at low speed, followed by gradient elution with imidazole buffers of varying concentrations to obtain TrxA and TrxA-IPA-Cltx. The collected target protein TrxA-IPA-Cltx was digested with thrombin provided by Solarbio, yielding IPA-Cltx protein. The eluted TrxA, TrxA-IPA-Cltx, and thrombin-digested TrxA-IPA-Cltx protein were concentrated and desalted by centrifugation in 50 mL 10 kDa ultrafiltration tubes (Millipore, Centricon, USA) at 5500 rpm / min and 4°C.

[0085] Protein samples after ultrafiltration concentration were detected by 12.5% ​​SDS-PAGE electrophoresis, and protein concentration was determined by BCA method according to the instructions of TaKaRa BCA Protein Assay Kit (Figures 4-8).

[0086] The concentration of the target protein was calculated using the standard curve formula. Using the absorbance data of TrxA-IPA-Cltx and IPA-Cltx proteins after ultrafiltration at 562 nm, the concentrations were calculated to be 2.0 mg / mL and 1.2 mg / mL, respectively. The total volumes of protein liquid collected after ultrafiltration were 40 mL and 25 mL, respectively, yielding approximately 80 mg of TrxA-IPA-Cltx protein and 30 mg of IPA-Cltx protein.

[0087] Example 5: Determination and Purification of TrxA-IPA-Cltx Polyclonal Antibody Titer: After determining the TrxA-IPA-Cltx protein concentration using the BCA method, the protein was diluted to 100 μg / mL with buffer. 1.5 mL of protein was mixed thoroughly with an equal volume of Freund's adjuvant using a vortex mixer. When the sample was dropped onto water and gently shaken without diffusion, emulsification was complete. Before immunization, 200 μL of blood was collected from the marginal ear vein, incubated at 37°C for 1 h, and then allowed to stand overnight at 4°C. The next day, the blood was centrifuged at 3500 rpm for 5 min at 4°C, and the supernatant was collected and aliquoted as blank negative serum. The serum was stored at -80°C. 2 mL of protein antigen emulsified with Freund's complete adjuvant was administered subcutaneously to rabbits in four doses. 1.5 mL of 100 μg / mL protein was emulsified with an equal volume of Freund's incomplete adjuvant, and immunization was performed every 7 days for a total of 4 doses. Two to three days after the last immunization, antiserum was obtained according to the negative serum preparation procedure. Using the negative serum as a control, the antibody titer and the ability to recognize recombinant proteins were detected by Western blotting and indirect ELISA.

[0088] Indirect ELISA determination of rabbit-derived anti-TrxA-IPA-Cltx polyclonal antibody titer: The target protein concentration was diluted to 10 μg / mL with coating buffer. 100 μL of protein sample was added to each well of an ELISA plate, for a total of eight groups, with three replicates per group. The plates were incubated overnight at 4°C. The next day, the solution in the wells was discarded. 200 μL of wash buffer (PBST) was added to each well, and the plate was shaken for 3 min each time. The plate was then blotted dry on filter paper to remove unbound material, and washed three times. The washing process was performed as quickly as possible to prevent the solution from adhering to the plate walls. 200 μL of 1% BSA was added to each well of the PBS solution, and the plate was incubated at 37°C for 1 h, followed by three washes. The primary antibody was serially diluted with PBS. One group of plates contained negative serum diluted 1:8000 as a blank control, and 100 μL of the serially diluted primary antibody was added to each well. The plate was incubated at 37°C for 1 h, followed by three washes. Secondary antibody was diluted 1:8000 with PBS, with 100 μL added to each well. Incubate at 37°C for 1 h, washing 4 times. Prepare fresh substrate (1 mL TMB, 20 mL substrate buffer (Na₂HPO₄ and citric acid solution), 64 μL 0.75% H₂O), 100 μL per well, incubate at 37°C for 15 min. Add 50 μL stop solution (concentrated sulfuric acid) per well, shake for 30 s, and incubate for 7 min. Measure absorbance at 450 nm using a microplate reader and calculate the positive / negative ratio (P / N) between the test antibody and the blank control.

[0089] Column pretreatment: Pack HiTrap protein A packing material into the column and rinse with purified water using a constant flow pump to remove residual ethanol and air bubbles. Mix 1 mL of the obtained anti-TrxA-IPA-Cltx serum with 4 mL of loading buffer, filter through a 0.22 μm filter membrane, and load the sample. Rinse with loading buffer until the baseline is stable to remove unbound contaminating proteins. Collect the antibody fraction using elution buffer, and then equilibrate the column with loading buffer. Rinse sequentially with 0.1 M NaOH, equilibration buffer, and distilled water, and store the column with 20% ethanol. Adjust the pH of the purified antibody to 7.0 with neutral buffer and store at -20°C.

[0090] Samples were collected at each step and subjected to 12.5% ​​SDS-PAGE gel electrophoresis, according to Thermo Scientific. TM PageRuler TM The target protein location was determined using the pre-stained protein molecular weight standard Marker 26616. The gel was excised and transferred onto a PVDF membrane. The membrane was kept moist by soaking in methanol for 1 min, and then immersed in transfer buffer. The sandwich structure was assembled in the following order: cathode, sponge, four layers of filter paper, gel, PVDF membrane, four layers of filter paper, sponge, anode. Air bubbles were gently removed from the apparatus with a roller after each layer was added. An ice box was placed in the transfer tank, and transfer buffer was poured in. The power was connected, and transfer was performed under a constant current of 200 mA. The transfer time was adjusted according to the protein molecular weight. After transfer, the PVDF membrane was washed three times in a petri dish containing TBST for 5 min each time. The PVDF membrane was blocked with TBST containing 5% skim milk at 28°C for 1 h, followed by three washes with TBST for 5 min each time. The purified polyclonal antibody was used as the primary antibody, diluted 1:16000 with blocking buffer, incubated overnight at 4°C, and then washed three times with TBST for 5 min each time. Commercially available goat anti-rabbit antibody was used as the secondary antibody, diluted 1:10000 with blocking buffer, and incubated for 1 h. The membrane was then washed three times with TBST for 10 min each time. After washing, the membrane was transferred to a darkroom. Following the instructions of the "ECL Chemiluminescence Detection Kit," ECL luminescent solution was prepared at a ratio of A:B = 1:1 and evenly spread onto the PVDF membrane. The membrane was placed in a darkroom, and the exposure time was adjusted according to the fluorescence intensity. The development results were recorded using an imaging system.

[0091] Rabbit-derived anti-TrxA-IPA-Cltx polyclonal antibodies that specifically recognize TrxA-IPA-Cltx protein were prepared and purified by immunizing rabbits (common grade male Japanese white rabbits, 8 weeks old, 1.5kg-1.6kg) (Table 1 and Figures 9-10).

[0092] Table 1. Results of TrxA-IPA-Cltx polyclonal antibody titer assay

[0093] Example 6: TrxA, TrxA-IPA-Cltx, and IPA-Cltx Inhibit Hepatocellular Carcinoma Cell Proliferation. HepG2, Hep3B, and MHCC97H hepatocellular carcinoma cells, and normal hepatocytes HL-7702, were seeded in 96-well plates at 200 μL per well, with five replicates for each concentration group. Drugs were added when cell confluence reached approximately 40%. Different concentrations of TrxA, TrxA-IPA-Cltx, and IPA-Cltx proteins (3 μmol / L, 10 μmol / L, 30 μmol / L, and 100 μmol / L) were added to the corresponding wells. After culturing for 48 h, 100 μL of 0.5 mg / mL MTT solution was added to each well. After incubation for 4 h, the supernatant was removed, and 150 μL of DMSO was added to each well. The plates were then incubated at 37°C for 30 min to ensure complete dissolution of the crystals. The absorbance (OD value) of each well was measured at a wavelength of 490 nm using a microplate reader. Cell viability was calculated using the formula (OD of experimental group - OD of blank group) / (OD of control group - OD of blank group) × 100%. Statistical analysis of the results was performed using GraphPad Prism9 software.

[0094] In this study, TrxA, TrxA-IPA-Cltx, and IPA-Cltx at concentrations of 3 μmol / L, 10 μmol / L, 30 μmol / L, and 100 μmol / L were used to treat HepG2, Hep3B, and MHCC97H liver cancer cells and normal hepatocytes HL-7702 for 48 h. The absorbance values ​​were measured at 490 nm using an ELISA reader. The results showed that (1) TrxA, TrxA-IPA-Cltx, and IPA-Cltx at concentrations of 100 μmol / L had no significant inhibitory effect on the cell viability of normal hepatocytes HL-7702; and (2) TrxA-IPA-Cltx and IPA-Cltx at concentrations of 100 μmol / L had a significant inhibitory effect on the cell viability of HepG2, Hep3B, and MHCC97H liver cancer cells (Figures 11-14).

[0095] Example 7: Induction of apoptosis in liver cancer cells by TrxA, TrxA-IPA-Cltx, and IPA-Cltx: HepG2 cells were seeded in 60 mm diameter culture dishes and cultured at 37°C in a 5% CO2 incubator. When cell confluence reached approximately 50%-60%, the drugs were added, and the cells were divided into a blank control group (unstained group), a single-stained group (FITC or PI), and a double-stained group (FITC and PI) according to experimental requirements. After 48 h of culture, the culture dishes were removed, and the cell supernatant was pipetted into EP tubes. The cells were washed with PBS solution and then digested. The collected supernatant and digested cells were centrifuged at 1000 rpm for 5 min, and washed 2-3 times with PBS solution. 195 µL of binding buffer (10× Binding Buffer diluted to 1× with deionized water) and 5 µL of Annexin V-FITC were added, and the cells were incubated in the dark for 15 min. After the process, wash the cells 1-2 times with binding buffer, then add 190 µL of binding buffer and 10 µL of PI, stain in the dark for 15 min, and use flow cytometry to detect apoptosis in the cell samples.

[0096] Compared with the control group, TrxA at concentrations of 3 µmol / L, 10 µmol / L, 30 µmol / L, and 100 µmol / L did not increase the proportion of cells undergoing early or late apoptosis; however, TrxA-IPA-Cltx at concentrations of 30 µmol / L and 100 µmol / L significantly increased the proportion of cells undergoing early and late apoptosis. These results indicate that TrxA-IPA-Cltx can induce apoptosis in HepG2 liver cancer cells (Figures 15-16).

[0097] Example 8: Mechanism of Cltx and IPA-Cltx protein-induced apoptosis in hepatocellular carcinoma cells: HepG2 cells were treated with different concentrations of TrxA and TrxA-IPA-Cltx protein (3 μmol / L, 10 μmol / L, 30 μmol / L, and 100 μmol / L) to adherent HepG2 hepatocellular carcinoma cells. After 48 h of culture, the culture medium was collected and washed twice with 1.0 mL of pre-chilled PBS. Cells were scraped and transferred to pre-chilled EP tubes, centrifuged at 1000 rpm for 3 min, and the supernatant was discarded. Cells were resuspended in 1 mL of pre-chilled PBS and centrifuged again. 10 μL of phosphatase inhibitor, 5 μL of benzyl sulfonyl fluoride (PMSF), and 1 μL of protease inhibitor (KGI Biotech Total Protein Extraction Kit, KGB5303-50) were added to each 1 mL of pre-chilled lysis buffer. After mixing, the cell pellet was added, vortexed for 30 s, and incubated on ice for 4.5 min. This process was repeated 6 times (totaling 30 min). Finally, centrifuge at 12,000 rpm for 10 min at 4℃, and collect the supernatant as the whole protein extract for subsequent quantitative analysis. Protein concentration was then determined using the BCA method. Take 20 μg-40 μg of protein sample, mix with 5× loading buffer at a 4:1 ratio, and denature at 100℃ for 5 min. Perform SDS-PAGE (5% stacking gel, 8%-12% separating gel): stacking gel 80 V for 30 min, separating gel 120 V to the bottom of the bromophenol-landar gel. Cut the gel according to the target protein molecular weight, and activate the PVDF membrane (0.45 μm) with methanol for 5 min. The transfer sequence is: sponge → filter paper → gel → PVDF membrane → filter paper → sponge, removing air bubbles. Transfer at a constant current of 200 mA (time adjusted according to molecular weight), with the transfer bath on ice. After transfer, block with 5% skim milk powder or 5% goat serum for 2 hours (28℃). Primary antibody (diluted with blocking buffer) was incubated overnight at 4°C, followed by washing the membrane three times with TBST for 5 minutes each time. Secondary antibody (diluted as above) was incubated at 37°C for 2 hours, followed by washing three times with TBST for 5 minutes each time. The membrane was covered with ECL chemiluminescence buffer (A:B=1:1) and exposed in a darkroom. The film was developed for 3 minutes, washed with water, and fixed for 3 minutes. ImageJ software was used to analyze the target band and β-actin grayscale values ​​to calculate the relative expression level.

[0098] As shown in Figure 17, compared with the control group, 100 µmol / L TrxA had no effect on the protein expression levels of Caspase-8 and Caspase-3, while 100 µmol / L TrxA-IPA-Cltx significantly reduced the protein expression levels of Caspase-8 and Caspase-3. This suggests that TrxA-IPA-Cltx protein may induce apoptosis by increasing the cleavage of Caspase-8 and Caspase-3 proteins and reducing their expression levels.

[0099] Example 9: Co-localization of TrxA and TrxA-IPA-Cltx on HepG2 liver cancer cells and HL-7702 normal hepatocytes: Cell slides were placed in 24-well plates, with 200 μL of poly-L-lysine added to each well. The plates were incubated at 37°C for 30 min. Before use, 10× poly-L-lysine was diluted to 1× with sterile PBS. The slides were washed three times with 400 μL PBS, and the liquid was aspirated. The plates were then sterilized under UV light for 1 h until dry. Cells were digested, and 1 mL of a cell suspension with 20%-30% confluence was added to each well. The plates were incubated at 37°C with 5% CO2 for 24 h. 1.0 mL of the target protein (10 μmol / L) was added to each well, and the plates were incubated for another 48 h. After 48 h, the culture medium was discarded, and the slides were washed three times with 400 μL PBS for 5 min each time. HepG2 hepatocellular carcinoma cells and HL-7702 hepatocytes were fixed in each well with 400 μL of 4% paraformaldehyde at 28°C for 30 min. The 4% paraformaldehyde was discarded, and the cells were washed three times with 400 μL PBS for 5 min each time. Each well was then blocked with 400 μL of 10% goat serum and incubated at 28°C for 30 min. The goat serum was discarded, and the cells were washed three times with 400 μL PBS for 5 min each time. 200 μL of primary antibody was added to each well of a 24-well plate and incubated overnight at 4°C. The primary antibody was discarded, and the cells were washed three times with 400 μL PBS for 5 min each time. A fluorescently conjugated secondary antibody was added to each well and incubated at 37°C in the dark for 1 h. The cells were then washed three times with 400 μL PBS in the dark for 5 min each time. The plates were then stained and mounted with anti-fluorescence quenching mounting medium. Observations were made using a laser confocal microscope: DAPI-stained cell nuclei were observed under 405 nm excitation light, TrxA-IPA-Cltx protein stained under PE light was observed at 561 nm, and membrane protein GPC3 stained under FITC light was observed at 488 nm.

[0100] Immunocytochemical experiments were conducted to analyze the co-localization of TrxA and TrxA-IPA-Cltx in HepG2 liver cancer cells: TrxA-IPA-Cltx protein co-localized with GPC3 protein expressed on the surface of HepG2 liver cancer cells, indicating that TrxA-IPA-Cltx protein may target and bind to GPC3 expressed on the surface of HepG2 liver cancer cells (Figures 18-20).

Claims

1. A fusion protein targeting the specific antigen GPC3, characterized in that, It comprises an IPA structural region and a Cltx structural region; the IPA is a GPC3 C-terminal targeting peptide with the amino acid sequence DYEMHLWWGTEL; the Cltx is a chlorine toxin; the fusion protein has at least 95%, 96%, 97%, 98% or 99% sequence homology with the amino acid sequence shown in SEQ ID NO.

1.

2. The fusion protein targeting the specific antigen GPC3 according to claim 1, characterized in that, The IPA and Cltx structural regions are connected by a linker having an amino acid sequence of (GGGS)n, where G is glycine, S is serine, and n is a positive integer from 1 to 6.

3. The fusion protein targeting the specific antigen GPC3 according to claim 1, characterized in that, The IPA or Cltx structural region contains functional fragments or variants that maintain their targeting of GPC3 or anti-tumor function.

4. The fusion protein targeting the specific antigen GPC3 according to claim 3, characterized in that, The variant is one that has at least 80%-99% sequence identity with SEQ ID NO.3 or SEQ ID NO.5 and retains the amino acid sequence that binds GPC3 and has antitumor activity.

5. A polynucleotide, characterized in that, The fusion protein encoding the target-specific antigen GPC3 as described in any one of claims 1-4.

6. An expression carrier, characterized in that, It comprises the polynucleotide of claim 5.

7. A host cell, characterized in that, The expression vector or genome of claim 6 contains the exogenous polynucleotide.

8. A method for preparing the fusion protein targeting the specific antigen GPC3 as described in claim 1, characterized in that, Includes the following steps: Synthesize the fusion protein of the target-specific antigen GPC3 as described in any one of claims 1-4, and / or culture the host cells as described in claim 7 under suitable expression conditions, and recover and purify the fusion protein of the target-specific antigen GPC3 as described in any one of claims 1-4 from the culture.

9. A pharmaceutical composition, characterized in that, The fusion protein comprising a therapeutically effective amount of the target-specific antigen GPC3 as described in any one of claims 1-4, and pharmaceutically acceptable excipients and carriers.

10. The use of the fusion protein of the target-specific antigen GPC3 according to any one of claims 1-4 or the pharmaceutical composition according to claim 9 in the preparation of a drug for the prevention and / or treatment of tumors, characterized in that, The tumors include carcinomas, lymphomas, medulloblastomas, retinoblastomas, liposarcomas, synovial cell sarcomas, carcinoid tumors, gastrinomas, islet cell carcinomas, liver cancers, mesotheliomas, schwannomas, meningiomas, adenocarcinomas, and melanomas.

Images