Application of CDKN1A interaction zinc finger protein 1 in neuronal axon regulation and control

By inhibiting the expression of CDKN1A-interacting zinc finger protein 1 and using inhibitors such as siRNA, the growth and regeneration of neuronal axons were promoted, solving the problem of weak regenerative capacity of axons after injury in the central nervous system of adult mammals and providing a treatment option for neurodegenerative and neurological injury diseases.

CN121971618APending Publication Date: 2026-05-05NANTONG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610182174.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-09
Publication Date
2026-05-05

AI Technical Summary

Technical Problem

The regenerative capacity of axons in the central nervous system of adult mammals is extremely weak after injury, and current technologies are insufficient to effectively promote the growth and regeneration of neuronal axons.

Method used

By inhibiting the expression of CDKN1A-interacting zinc finger protein 1 (CIZ1), CDKN1A-interacting zinc finger protein 1 expression inhibitors such as siRNA, shRNA, sgRNA, and miRNA, especially adeno-associated virus vectors, can be used to reduce CIZ1 expression and promote neuronal axon growth and regeneration.

Benefits of technology

It significantly promotes the growth and regeneration of neuronal axons, providing a new therapeutic direction for the treatment of neurodegenerative diseases and nerve injury diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121971618A_ABST
    Figure CN121971618A_ABST
Patent Text Reader

Abstract

The invention discloses an application of a CDKN1A interaction zinc finger protein 1 in neuronal axon regulation and control. The invention proposes and verifies that the CDKN1A interaction zinc finger protein 1 can effectively regulate and control the growth behavior of neuron axons for the first time, the growth of the neuron axons and the regeneration of damaged axons can be promoted by inhibiting the expression of the CDKN1A interaction zinc finger protein 1, and a new direction is provided for research and development of drugs for treating diseases caused by neurodegenerative diseases and nerve injuries.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to gene therapy, and more particularly to the application of a CDKN1A-interacting zinc finger protein 1 in the regulation of neuronal axons. Background Technology

[0002] Neuronal axons are the slender processes by which neurons transmit signals, and their growth and regeneration are central to the development, damage repair, and functional remodeling of the nervous system. During development, the cytoskeleton at the axon tip guides its precise extension via a growth cone. However, the regenerative capacity of axons in the central nervous system of adult mammals is extremely weak after injury. Therefore, exploring how to reactivate the intrinsic growth potential of neurons and improve the external environment is key to promoting neural repair after diseases such as spinal cord injury.

[0003] Dorsal root ganglion neurons are a classic model for studying axonal regeneration mechanisms. As pseudounipolar neurons, their unique anatomy provides a natural control for studying differences in regenerative capacity: their peripheral processes regenerate strongly after injury, while their central processes projecting into the spinal cord regenerate almost nothing after injury. Furthermore, the regenerative capacity of DRG neurons declines with age, but studies have found that even in aged animals, administration of specific growth factors can effectively stimulate their axonal regeneration potential, offering hope for treatment.

[0004] CDKN1A-interacting zinc finger protein 1 (CIZ1) is a protein that primarily functions in the cell nucleus, playing a crucial role in DNA replication and the regulation of the G1 / S phase checkpoint in the cell cycle. Studies have shown that CIZ1 is essential for maintaining genome stability, and its functional defects can lead to DNA damage accumulation, cell cycle abnormalities, and apoptosis. Current research mainly focuses on CIZ1's DNA-related functions in the cell nucleus; whether it may affect the growth and regeneration of neuronal axons remains unclear. Summary of the Invention

[0005] Purpose of the invention: The purpose of this invention is to provide an application of CDKN1A-interacting zinc finger protein 1 in the regulation of neuronal axons, particularly the inhibition of CDKN1A-interacting zinc finger protein 1 to promote neuronal axon growth or damage repair.

[0006] Technical solution: The application of CDKN1A-interacting zinc finger protein 1 in neuronal axon regulation as described in this invention.

[0007] Preferably, the application is to inhibit the expression of CDKN1A-interacting zinc finger protein 1 to promote neuronal axon growth.

[0008] Preferably, the application is to inhibit the expression of CDKN1A-interacting zinc finger protein 1 to promote the regeneration of damaged neuronal axons.

[0009] Preferably, the application is the use of CDKN1A-interacting zinc finger protein 1 expression inhibitors in the preparation of drugs for the treatment of neurodegenerative diseases; more preferably, the neurodegenerative diseases include Alzheimer's disease, Parkinson's disease, and amyotrophic lateral sclerosis (ALS).

[0010] Preferably, the application is the use of CDKN1A-interacting zinc finger protein 1 expression inhibitor in the preparation of a therapeutic drug for diseases caused by nerve injury; more preferably, the diseases caused by nerve injury include diseases caused by physical and / or physiological damage to the nerves.

[0011] Preferably, the CDKN1A-interacting zinc finger protein 1 expression inhibitor is any one of the following: a) Any one of siRNA, shRNA, sgRNA, and miRNA; b) Viral or non-viral vectors containing a) or expressing a) in vivo; c) CDKN1A interacting zinc finger protein 1 aptamers or protein inhibitors.

[0012] Preferably, the CDKN1A-interacting zinc finger protein 1 expression inhibitor is a viral vector expressing shRNA; more preferably, the viral vector is an adeno-associated virus vector or a lentiviral vector.

[0013] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: The present invention proposes and verifies for the first time that CDKN1A-interacting zinc finger protein 1 can effectively regulate neuronal axons, and inhibiting its expression can promote neuronal axon growth and regeneration of damaged axons, providing a new direction for the development of therapeutic drugs for neurodegenerative diseases and diseases caused by nerve injury. Attached Figure Description

[0014] Figure 1 After injury to the sciatic nerve (A) or dorsal root (B) in rats Ciz1 A diagram illustrating the expression of the situation; Figure 2 Different adeno-associated viruses infect rat DRG neurons Ciz1 A diagram illustrating the expression of the situation; Figure 3 Diagrams showing neuronal dysplasia growth in rat DRG neurons after infection with different adeno-associated viruses; Figure 4 Figures showing the regeneration of neuronal axons after transection following infection of rat DRG neurons with different adeno-associated viruses. Figure 5 Immunofluorescence staining results of Ciz1 protein after intrathecal injection of different adeno-associated viruses in rats; Figure 6Immunofluorescence staining results of SCG10 protein after intrathecal injection of different adeno-associated viruses in rats. Detailed Implementation

[0015] The technical solution of the present invention will be further described below.

[0016] Example 1: Analysis of CDKN1A interaction zinc finger protein 1 expression after dorsal root ganglion injury and sciatic nerve injury 1. Dorsal root nerve injury Eight-week-old adult SD rats (purchased from the Experimental Animal Center of Nantong University) were anesthetized and their skin prepared. Using surgical scissors, the skin corresponding to the L3-L5 dorsal root ganglia (DRG) was incised along the midline of the back. The lamina of the L4 DRG segment was removed using bone forceps to expose the L3-L4 DRG. The dorsal root of the L4-L5 DRG was transversely severed at the anterior end of the L4 DRG, near the L3 DRG. In the sham surgery group, only the L3-L4 DRG segment was exposed. The injured areas were then sutured and disinfected. Tissue samples were harvested 3 days post-surgery.

[0017] 2. Sciatic nerve injury Eight-week-old adult SD rats (purchased from the Experimental Animal Center of Nantong University) were anesthetized and their skin was prepared. The rat skin was cut open with sterile surgical scissors, and the sciatic nerve was exposed by separating it with ophthalmic scissors. The sciatic nerve was transected using microscissors. In the sham surgery group, only the sciatic nerve was exposed. The injured area was then sutured and disinfected.

[0018] Three days after dorsal root ganglion and sciatic nerve injury, rat L4-L5 DRGs were collected. Axons were cleaved, and total RNA was extracted. cDNA was obtained by reverse transcription using Oligo dT primer and then analyzed by RT-PCR using the SYBR Green Premix Ex Taq system to assess the expression of CDKN1A-interacting zinc finger protein 1 (Ciz1) and its target genes. Ciz1 and internal reference genes Gapdh The primer sequences are shown in Table 1 below, and the reaction conditions are shown in Table 2 below: Table 1 Target Genes Ciz1 and internal reference genes Gapdh Primer sequence

[0019] Table 2 RT-PCR reaction conditions

[0020] Fluorescence values ​​were collected during the extension phase of each cycle, using... GapdhAs an internal parameter, it is calculated using the ΔΔCt method. Ciz1 The relative expression level.

[0021] The results are as follows Figure 1 As shown, after peripheral sciatic nerve (SN-Cut) injury of DRG neurons, the gene expression of Ciz1 in DRG is significantly reduced, while after central sciatic nerve (DR-Cut) injury of DRG neurons, the gene expression of Ciz1 in DRG is significantly increased.

[0022] Example 2: Validation of the effect of Ciz1 expression regulation on primary rat DRG neurons Based on the publicly available Ciz1 nucleotide sequence (GenBank: BC166776.1), and using ACTTTGAGAACCTGCAGAAAT (SEQ ID NO: 1) or AGCAGCAACAGCAGATAC (SEQ ID NO: 2) as gene repression target sequences, Shanghai Heyuan Biotechnology Co., Ltd. was commissioned to prepare expression-enhancing drugs based on AAV2 / 9 serotype adeno-associated virus. Ciz1 Recombinant viruses of shRNA (Ciz1-1-shRNA / AAV, Ciz1-2-shRNA / AAV) and control virus (Con-shRNA / AAV).

[0023] DRG tissue from adult SD rats was collected, segmented, and digested with 3 mg / mL type I collagenase at 37°C for 90 min, followed by digestion with 0.025% trypsin at 37°C for 5 min. Then, 15% BSA solution was added to obtain a cell suspension. After centrifugation at 900 rpm for 5 min, a precipitate containing DRG neurons was obtained. The precipitate was seeded in poly-L-lysine-coated culture dishes and cultured in Neurobasal A medium containing B27 and L-glutamine to obtain primary rat DRG neurons.

[0024] Primary rat DRG neurons in logarithmic growth phase were subjected to 5 × 10 4 Cells were seeded at a density of 1 cell / well into 24-well cell culture plates. After adhesion, 3.5 μL of Ciz1-1-shRNA / AAV (3.3 × 10⁻⁶ cells / well) was added to each well. 12 (vg / mL), or add 2.44 μL of Ciz1-2-shRNA / AAV (6.1 × 10⁻⁶). 12 (vg / mL), or 1.52 μL of Con-shRNA / AAV (1.77 × 10⁻⁶ vg / mL). 13 Infection was carried out using vg / mL.

[0025] 1. Assessment of Ciz1 expression Cells were collected 84 h after infection and RT-PCR was performed according to the method described in Example 1.

[0026] The results are as follows Figure 2 As shown, the expression Ciz1 Following infection with adeno-associated virus (AAV) containing shRNA, primary rat DRG neurons... Ciz1 Significantly reduced expression indicates that Ciz1 shRNA can inhibit intraneuronal expression. Ciz1 The expression is Ciz1 Effective inhibitors.

[0027] 2. Inhibition of Ciz1 promotes axonal growth in primary rat DRG neurons DRG neurons infected with Ciz1-1-shRNA / AAV, Ciz1-2-shRNA / AAV, or Con-shRNA / AAV for 98 h were seeded in poly-L-lysine-coated culture dishes and cultured in Neurobasal A medium containing B27 and L-glutamine. After cell crawling, cells were fixed with 4% paraformaldehyde for 1 min and incubated overnight at 4°C with a 1:1000 dilution of Tuj1 primary antibody (purchased from Abcam, catalog number ab18207). After incubation, cells were washed with PBS buffer and then incubated with a 1:1000 dilution of Alexa Fluor. TM The 488 fluorescent secondary antibody (purchased from Invitrogen, catalog number A-21206) was incubated at room temperature in the dark. After incubation, the slides were rinsed, mounted, and observed and images were acquired using a fluorescence microscope.

[0028] The results are as follows Figure 3 As shown, the expression Ciz1 Following adeno-associated virus (AAV) infection with shRNA, the axonal length of DRG neurons was significantly longer, indicating that... Ciz1 Inhibitors promote the growth of neuronal axons.

[0029] 3. Inhibition of Ciz1 promotes axonal regeneration of primary rat DRG neurons Take a sterile microfluidic chamber (purchased from Xona Microfluidics, catalog number SND150) and place it in a culture dish coated with poly-L-lysine. Add 5 μL of DRG neuronal cell suspension transfected with Ciz1-1-shRNA / AAV, Ciz1-2-shRNA / AAV, or Con-shRNA / AAV 168 h prior to the well on the left side of the microfluidic chamber, allowing it to flow into the axonal chamber in the middle of the microfluidic chamber. Culture in Neurobasal A medium containing B27 and L-glutamine.

[0030] After the axon has grown to the right side of the microfluidic chamber, the axon side is aspirated five times with a negative pressure of 0.025 MPa for 30 seconds each time, until the axon is completely severed.

[0031] After 24 h of culture, the cells were fixed with 4% paraformaldehyde and stained with Tuj1 as described above. The cells were then observed and images were acquired using a fluorescence microscope.

[0032] The results are as follows Figure 4 As shown, the expression Ciz1 Following adeno-associated virus (AAV) infection with shRNA, the regeneration length of axons after damage in DRG neurons significantly increased, indicating... Ciz1 Inhibitors also promote the regeneration of neuronal axons.

[0033] Example 3: Validation of the therapeutic effect of Ciz1 expression regulation on sciatic nerve injury in rats. Eight-week-old adult SD rats (purchased from the Experimental Animal Center of Nantong University) were anesthetized and their skin prepared. Surgical scissors were used to cut the skin along the midline of the back from L4 to L6, and the skin was stretched open. Ophthalmic scissors were used to cut the muscles of the spinous processes of the lumbar vertebrae at L4-L6. Excess muscle and spinous processes were removed with bone forceps to expose the intervertebral space. A glass electrode needle connected to a Micro4 micro-injection system was inserted obliquely posteriorly into the intervertebral foramen, and 10 μL of a 6×10⁻⁶ concentration was injected intrathecally. 12 After injecting vg / mL of Ciz1-1-shRNA / AAV, Ciz1-2-shRNA / AAV, or Con-shRNA / AAV, let the wound stand for one minute and then suture it.

[0034] Fourteen days after viral injection, the rats were obliquely cut at the buttocks to expose the nerves, and hemostatic forceps were used to clamp the sciatic nerve 1 cm above the bifurcation of the tibial and common peroneal nerves for 30 seconds.

[0035] 1. Ciz1 tissue immunostaining Fourteen days after viral injection, L4-L5 DRG tissue was collected, frozen, sectioned, and blocked for 30 min. It was then incubated overnight at 4°C with a 1:500 dilution of mouse Tuj1 primary antibody and a 1:500 dilution of rabbit Ciz1 primary antibody (purchased from abcam, catalog number ab102013). After incubation, the tissue was washed with PBS buffer and then incubated with a 1:400 dilution of mouse Alexa Fluor. TM 488 (purchased from Invitrogen, catalog number A-21206) and rabbit-derived Cy3-conjugated fluorescent secondary antibody (purchased from Proteintech, catalog number SA00009-2) were incubated at room temperature in the dark. After incubation, the slides were rinsed and stained with DAPI. After rinsing again, the slides were mounted and observed and images were acquired using a fluorescence microscope.

[0036] The results are as follows Figure 5 As shown, intrathecal injection expression Ciz1 Following adeno-associated virus (AAV) administration of shRNA, rat DRG levels Ciz1 Significantly reduced expression indicates Ciz1 Inhibitors are also effective in the body.

[0037] 2.1 Immunostaining of SCG10 tissues from rats in the sciatic nerve pinching group Three days after sciatic nerve injury, rat sciatic nerve tissue was collected, frozen, sectioned, and blocked for 30 min. It was then incubated overnight at 4°C with SCG10 primary antibody diluted 1:500 (purchased from Novus, catalog number NBP1-49461). After incubation, the tissue was washed with PBS buffer and then incubated at room temperature in the dark with secondary antibody diluted 1:400 (purchased from Invitrogen, catalog number A-21245). After incubation, the tissue was washed, mounted, and observed and images were acquired using a fluorescence microscope.

[0038] The results are as follows Figure 6 As shown, intrathecal injection expression Ciz1 Following adeno-associated virus (AAV) administration of shRNA, the length of nerve regeneration after sciatic nerve injury in rats was significantly increased, indicating that... Ciz1 Inhibitors also have the effect of promoting neuronal axon regeneration in vivo.

Claims

1. Application of CDKN1A-interacting zinc finger protein 1 in neuronal axon regulation.

2. The application according to claim 1, characterized in that, The application is to inhibit the expression of CDKN1A-interacting zinc finger protein 1 to promote neuronal axon growth.

3. The application according to claim 1, characterized in that, The application is to inhibit the expression of CDKN1A-interacting zinc finger protein 1 to promote the regeneration of damaged neuronal axons.

4. The application according to claim 1, characterized in that, The application is the use of CDKN1A-interacting zinc finger protein 1 expression inhibitors in the preparation of drugs for the treatment of neurodegenerative diseases.

5. The application according to claim 4, characterized in that, The neurodegenerative diseases mentioned include Alzheimer's disease, Parkinson's disease, and amyotrophic lateral sclerosis (ALS).

6. The application according to claim 1, characterized in that, The application is the use of CDKN1A-interacting zinc finger protein 1 expression inhibitors in the preparation of drugs for the treatment of diseases caused by nerve damage.

7. The application according to claim 4, characterized in that, The diseases caused by nerve damage include those caused by physical and / or physiological damage to the nerves.

8. The application according to any one of claims 4 to 7, characterized in that, The CDKN1A-interacting zinc finger protein 1 expression inhibitor is any one of the following: a) Any one of siRNA, shRNA, sgRNA, and miRNA; b) Viral or non-viral vectors containing a) or expressing a) in vivo; c) CDKN1A interacting zinc finger protein 1 aptamers or protein inhibitors.

9. The application according to claim 8, characterized in that, The CDKN1A-interacting zinc finger protein 1 expression inhibitor is a viral vector expressing shRNA.

10. The application according to claim 9, characterized in that, The viral vector is an adeno-associated virus vector or a lentivirus vector.