DNA tetrahedron drug complex for treating retinal ischemia-reperfusion injury

Abstract

The application provides a DNA tetrahedral drug complex for treating retinal ischemia-reperfusion injury, belonging to the field of eye disease treatment and molecular biology, wherein YAP saRNA is connected to the tetrahedral drug complex. The tetrahedral drug complex of the application can efficiently and safely deliver YAP saRNA, increase the expression level of intracellular YAP, inhibit retinal cell oxidative stress and ferroptosis, thereby effectively treating RI / RI, and providing a new choice for the treatment of tetrahedral drug complexes.

Description

Technical Field

[0001] This application belongs to the fields of ocular disease treatment and molecular biology. Specifically, this application provides a DNA tetrahedral drug complex for treating retinal ischemia-reperfusion injury. Background Technology

[0002] Retinal ischemia / reperfusion injury (RI / RI) is a major pathological mechanism leading to visual impairment. Currently, clinical treatments for RI / RI are very limited, mainly including: antioxidant therapy (such as the use of antioxidants like vitamin C and vitamin E), but these drugs have limited effectiveness and lack targeted therapy; anti-inflammatory therapy (such as the use of corticosteroids), but long-term use can cause serious side effects; and neuroprotective therapy (such as the use of neurotrophic factors), but their delivery efficiency is low, making it difficult to achieve effective therapeutic concentrations.

[0003] Oxidative stress and ferroptosis play crucial roles in irritable retinopathy (RI) and retinal retinal injury (RI), but current technologies cannot effectively regulate these pathological processes. Yes-associated protein (YAP) is a core effector of the Hippo signaling pathway, participating in cell survival, proliferation, migration, and tissue repair by regulating gene transcription. Studies have shown that YAP, as a negative regulator of ferroptosis, can alleviate ferroptosis in myocardial ischemia / reperfusion injury by upregulating NEDD4L and promoting the ubiquitination and degradation of ACSL4 through transcriptional upregulation of NEDD4L. Furthermore, YAP induces the expression of SLC7A11 and GPX4 through the TEAD binding motif on its gene promoter, enhancing the cell's antioxidant defense capacity and thus inhibiting ferroptosis. Therefore, upregulating YAP expression is considered a potential strategy for treating RI / RI. However, despite YAP's potential as a negative regulator of ferroptosis, its expression level in RI / RI is insufficient, and existing delivery systems such as viral vectors and liposomes have limitations in stability, delivery efficiency, targeting, and toxicity. A highly efficient delivery system for targeted delivery of YAP saRNA to retinal cells is lacking.

[0004] Existing treatments cannot effectively address the oxidative stress and cell death issues in retinal ischemia / reperfusion injury (RI), necessitating the development of new treatment strategies. Developing an efficient, safe, and targeted delivery system is key to realizing YAP gene therapy for retinal ischemia / reperfusion injury. Summary of the Invention

[0005] This patent aims to provide a novel nanocomposite (tFNAs-YAP saRNA) that, through efficient delivery of YAP saRNA, enhances intracellular YAP expression levels, inhibits oxidative stress and ferroptosis in retinal cells, thereby effectively treating RI / RI.

[0006] On the one hand, this application provides a DNA tetrahedral drug complex for treating retinal ischemia-reperfusion injury, wherein the tetrahedral drug complex is attached with YAP saRNA.

[0007] Furthermore, the nucleotide sequence of the YAP saRNA is GUUAGAUACUCUGAGUCAACU and UUGACUCAGAGUAUCUAACAA.

[0008] Furthermore, the preparation method of the drug complex includes: adding equal concentrations of S1-saRNA sense strand, saRNA antisense strand, S2 strand, S3 strand and S4 strand to a buffer solution, mixing evenly, heating and cooling.

[0009] Further, the nucleotide sequence of the S1-saRNA sense chain is ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAATTTTTGUUAGAUACUCUGAGUCAACUTT.

[0010] Further, the S2 chain nucleotide sequence is ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG; the S3 chain nucleotide sequence is ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC; the S4 chain nucleotide sequence is ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG; and the saRNA antisense chain nucleotide sequence is UUGACUCAGAGUAUCUAACAA.

[0011] Furthermore, the buffer solution is a 10mM Tris-HCl buffer solution containing 50mM MgCl2, with a pH of 8.0.

[0012] Further, heat to 95°C for 10 minutes and cool to 4°C for 20 minutes.

[0013] On the other hand, this application provides the use of the above-mentioned DNA tetrahedral drug complex in the preparation of a drug for treating retinal ischemia-reperfusion injury.

[0014] Furthermore, the retinal ischemia-reperfusion injury refers to retinal ischemia-reperfusion injury caused by trauma, surgery, ocular vascular occlusion, or glaucoma.

[0015] Furthermore, the drug is in the form of an injection, eye drops, or ointment.

[0016] Furthermore, the drug also includes anti-inflammatory drugs and / or neurotrophic factors.

[0017] The beneficial effects of this application include at least the following: (1) Efficient delivery: tFNAs, as vectors, can efficiently deliver YAP saRNA to retinal cells, significantly improving the expression level of YAP.

[0018] (2) Multiple protective mechanisms: comprehensively protect retinal cells by inhibiting oxidative stress and ferroptosis.

[0019] (3) Safety and targeting: tFNAs have good biocompatibility and low toxicity, enabling precise delivery.

[0020] (4) Significant therapeutic effect: In the RI / RI model, tFNAs-YAP saRNA significantly improved retinal atrophy and functional impairment. Attached Figure Description

[0021] Figure 1 The results of tFNAs-YAP saRNA synthesis were verified by polyacrylamide gel electrophoresis (lane 1: S1, lane 2: S1-saRNA positive strand; lane 3: S2; lane 4: S3; lane 5: S4; lane 6: tFNAs; lane 7: tFNAs-YAP saRNA).

[0022] Figure 2 To verify the tFNAs-YAP saRNA synthesis results using high-efficiency capillary electrophoresis.

[0023] Figure 3 Transmission electron microscopy image of tFNAs-YAP saRNA.

[0024] Figure 4 Results of dynamic light scattering measurements of tFNAs-YAP saRNA particle size.

[0025] Figure 5 Results of dynamic light scattering measurements of tFNAs-YAP saRNA zeta potential.

[0026] Figure 6 The results of immunofluorescence staining to detect the uptake of Cy5-tFNAs-saRNA by R28 cells (Cy5-tFNAs-saRNA: red; cell nucleus: blue, scale bar: 20 μm).

[0027] Figure 7The results of flow cytometry were used to quantitatively detect and analyze the uptake rate of Cy5-tFNAs-saRNA in R28 cells.

[0028] Figure 8 To statistically analyze the uptake rate of Cy5-tFNAs-saRNA in R28 cells by flow cytometry.

[0029] Figure 9 The results show the YAP mRNA expression levels after treating R28 cells with the same concentrations of saRNA, tFNAs, and tFNAs-saRNA for 24 hours.

[0030] Figure 10 The electrophoresis results of YAP protein expression levels after treating R28 cells with the same concentrations of saRNA, tFNAs, and tFNAs-saRNA for 24 hours are shown.

[0031] Figure 11 The statistical results of YAP protein expression levels were obtained after treating R28 cells with the same concentrations of saRNA, tFNAs, and tFNAs-saRNA for 24 hours.

[0032] Figure 12 Cell viability of R28 cells cultured under different oxygen-glucose deprivation / reperfusion (OGD / R) conditions was measured for CCK-8.

[0033] Figure 13 Results of screening for the optimal therapeutic concentration of tFNAs-saRNA in R28 cells under OGD / R conditions for CCK-8.

[0034] Figure 14 The results of immunoblotting were used to detect the protein expression of YAP in R28 cells under OGD / R conditions.

[0035] Figure 15 The mitochondrial permeability transition pore (MPTP) opening status of R28 cells under different treatment conditions was detected using a mitochondrial permeability transition pore (MPTP) kit after exposure to OGD / R, OGD / R+saRNA, OGD / R+tFNAs, OGD / R+tFNAs-saRNA, and OGD / R+Fer-1 (MPTP: green; nucleus: blue).

[0036] Figure 16 To use flow cytometry to quantitatively detect and analyze ROS levels in R28 cells under different treatment conditions.

[0037] Figure 17 To statistically analyze and quantitatively detect ROS levels in R28 cells under different treatment conditions using flow cytometry.

[0038] Figure 18 Transmission electron microscopy images of the overall and mitochondrial structures of R28 cells after exposure to OGD / R, OGD / R+saRNA, OGD / R+tFNAs, OGD / R+tFNAs-saRNA and OGD / R+Fer-1; scale bar = 500 nm.

[0039] Figure 19 To detect Fe in R28 cells under different treatment conditions using immunofluorescence 2+ Horizontal result; scale bar = 20 μm.

[0040] Figure 20 To detect lipid ROS in R28 cells under different treatment conditions using BODIPY™ 581 / 591 C11 dye; each group of cells was stained with BODIPY™ 581 / 591 C11 reagent and analyzed by immunofluorescence; scale bar = 20 μm.

[0041] Figure 21 HE staining images at 1, 3 and 7 days after retinal ischemia-reperfusion injury; scale bar = 40 μm.

[0042] Figure 22 The results of RGC count analysis were obtained by HE staining.

[0043] Figure 23 The results of the internal plexiform layer (IPL) thickness analysis were obtained by HE staining.

[0044] Figure 24 To analyze the results of whole retinal thickness using HE staining.

[0045] Figure 25 To detect the expression of YAP protein in each group by immunoblotting.

[0046] Figure 26 To detect the expression of the ferroptosis-related protein SLC7A11 in each group by immunoblotting.

[0047] Figure 27 The expression results of the ferroptosis-related protein GPX4 in each group were detected by immunoblotting.

[0048] Figure 28 To detect the expression of the ferroptosis-related protein FTH1 in each group by immunoblotting.

[0049] Figure 29 HE staining images of retinal ischemia-reperfusion injury 7 days after intravitreal injection of saRNA, tFNAs, and tFNAs-saRNA; scale bar = 40 μm.

[0050] Figure 30The results of RGC count analysis were obtained by HE staining.

[0051] Figure 31 The results of the internal plexiform layer (IPL) thickness analysis were obtained by HE staining.

[0052] Figure 32 To analyze the results of whole retinal thickness using HE staining.

[0053] Figure 33 Immunofluorescence staining results of RBPMS (retinal ganglion cell active protein, red fluorescence) in retinal ischemia-reperfusion injury 7 days after different drug treatments.

[0054] Figure 34 Electrophoresis results were obtained to detect the expression of YAP protein, RBPMS protein, and ferroptosis-related proteins (SLC7A11, GPX4, and FTH1) in each group by immunoblotting.

[0055] Figure 35 To detect the expression of YAP protein in each group by immunoblotting.

[0056] Figure 36 To detect the RBPMS protein expression results in each group by immunoblotting.

[0057] Figure 37 To detect the expression of the ferroptosis-related protein SLC7A11 in each group by immunoblotting.

[0058] Figure 38 To detect the expression of GPX4 protein, a ferroptosis-related protein, in each group using immunoblotting.

[0059] Figure 39 To detect the expression of ferroptosis-related protein FTH1 in each group by immunoblotting.

[0060] Figure 40 To detect the expression of YAP in R28 cells by real-time quantitative PCR (RT-qPCR), the expression of YAP mRNA in R28 cells 24 hours after transfection with five different saRNAs was measured using RT-qPCR; β-actin was used as an internal control.

[0061] Figure 41 The cell viability of R28 cells co-cultured with different concentrations of tFNAs-saRNA was measured by CCK-8 assay after R28 cells were co-cultured with different concentrations of tFNAs-saRNA (62.5 / 125 / 250 / 500 nM) for 24 hours.

[0062] Data in the figure are expressed as mean ± standard deviation (SD) (n≥3). ANOVA was used; ns, p≥0.05; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001. Detailed Implementation

[0063] Example 1: Preparation and Characterization of tFNAs-YAP saRNA Five different saRNAs targeting YAP were designed (Table 1), and their role in promoting YAP expression in R28 cells was verified by RT-qPCR. After transfection with the five different saRNAs for 24 h, saRNA-2 was selected by RT-qPCR to synthesize tFNAs-YAP saRNA (e.g., saRNA-2). Figure 40 tFNAs can readily self-assemble from four specially designed single-stranded DNAs (S1, S2, S3, and S4, Table 2) via a simple annealing process. In this application, the applicant modified the 3' end of S1 with a YAPsaRNA sense strand to form a new S1 strand (S1-saRNA sense, Table 2), and then synthesized tFNAs-YAP saRNA, abbreviated as tFNAs-saRNA, following the same steps as tFNAs.

[0064] Table 1. Base sequence of each saRNA

[0065] Specifically, tFNAs-YAP saRNA was synthesized from three single-stranded DNA strands (S2, S3, and S4, GenScript, Nanjing, China, Table 2), one single-stranded DNA strand modified with the YAP saRNA cissional strand (S1-saRNA sense, Table 2), and one saRNA antisense strand (Table 2). The synthesis method was similar to that of tFNAs. S1-saRNA sense, saRNA antisense strand, S2, S3, and S4 were added to TM buffer (50 mM MgCl2, 10 mM Tris-HCl, pH=8.0) to obtain 1 μM of S1-saRNA sense, saRNA antisense strand, S2, S3, and S4. After thorough mixing, the mixture was heated to 95℃ for 10 min and cooled to 4℃ for 20 min. A final concentration of 1 μM tFNAs-YAP saRNA was successfully synthesized. Rigorous characterization experiments then verified the successful synthesis of tFNAs and tFNAs-YAP saRNA. The techniques include analyzing molecular weight differences using polyacrylamide gel electrophoresis (PAGE) and high-performance capillary electrophoresis (HPCE), determining particle size and charge zeta potential using dynamic light scattering particle size analyzer (DLS), and detecting morphology using transmission electron microscopy (TEM).

[0066] Table 2. Base sequence of each single-stranded DNA and saRNA. S1 ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA (SEQ ID NO.11) S1‐saRNA sense ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAATTTTTGUUAGAUACUCUGAGUCAACUTT (SEQ ID NO.12) S2 ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG (SEQ ID NO.13) S3 ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC (SEQ ID NO.14) S4 ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG (SEQ ID NO.15) saRNA antisense UUGACUCAGAGUAUCUAACAA (SEQ ID NO.4) Successful synthesis of tFNAs-saRNA was verified using 10% polyacrylamide gel electrophoresis (PAGE). Compared to S1 (lane 1), S1-saRNA sense (lane 2), S2-S4 (lanes 3-5), and tFNAs (lane 6), tFNAs-saRNA (lane 7) exhibited the slowest migration speed. Figure 1 ). By high-performance capillary electrophoresis (HPCE) ( Figure 2 Similar results were obtained, indicating that tFNAs-saRNA was successfully synthesized. Transmission electron microscopy (TEM) images showed that tFNAs-saRNA was triangular in shape in a two-dimensional plane. Figure 3 Furthermore, dynamic light scattering (DLS) analysis revealed that the particle size of tFNAs-saRNA was approximately 17.54 nm, and the zeta potential of tFNAs-saRNA was approximately -5.27 mV. Figure 4 , Figure 5 These results indicate that YAP saRNA was successfully loaded onto tFNAs.

[0067] Example 2 Cell Experiment To investigate the potential protective effect of tFNAs-saRNA against retinal ischemia-reperfusion injury, this application uses R28 cells for in vitro cell experiments.

[0068] Cell culture and processing: R28 cells are a retinal progenitor cell line with biological characteristics similar to retinal ganglion cells (RGCs). They are commonly used to establish an oxygen-glucose deprivation / reoxygenation (OGD / R) model to simulate ischemia-reperfusion injury in RGCs in vitro. Cells were cultured in DMEM medium with 10% fetal bovine serum (FBS) and 1% streptomycin-penicillin (P / S) at 37°C, 95% air, and 5% carbon dioxide (CO2) for 24 hours before being placed in OGD / R conditions. The OGD / R conditions consisted of culturing cells in glucose-free DMEM medium in a hypoxic incubator (94% nitrogen + 1% oxygen + 5% carbon dioxide) for 12 hours, followed by replacement with complete DMEM medium containing 10% FBS and 1% P / S, and reoxygenation at 37°C, 5% CO2, and 95% air for 12 hours. To screen the optimal concentration of tFNAs-YAP saRNA, cells were co-cultured with tFNAs-YAP saRNA at concentrations of 125, 250, and 375 nM, and with tFNAs and saRNA at a concentration of 250 nM each, under OGD 12 h and reoxygenation 12 h conditions. After determining the optimal concentration of tFNAs-YAP saRNA (250 nM), R28 cells were co-cultured with the same concentrations of tFNAs-YAP saRNA, tFNAs, and saRNA under OGD / R conditions.

[0069] Cellular uptake: To assess the uptake of tFNAs-YAP saRNA by R28 cells, the applicant labeled single-stranded DNA with Cy5 fluorescent labeling. R28 cells were cultured at 2 × 10⁶ cells per well. 5 Cells were seeded at a density of [value missing] mL in 6-well plates, and Cy5-tFNAs-YAP saRNA was added. Cells were incubated for 4 h, 12 h, and 24 h, respectively. Intracellular fluorescence intensity was assessed in two ways: firstly, cell nuclei were stained with Hoechst 33342 (APExBIO, USA), and fluorescence imaging was performed using a confocal microscope (Zeiss, Germany); secondly, cell samples were collected, and fluorescence intensity was quantitatively detected using flow cytometry (Thermo Fisher Scientific, USA). This comprehensive assessment evaluated the cellular uptake efficiency of tFNAs-saRNA.

[0070] Intracellular uptake of tFNAs-saRNA was assessed using immunofluorescence and flow cytometry. Confocal laser scanning microscopy revealed that red fluorescence in R28 cells gradually increased with prolonged Cy5-tFNAs-saRNA incubation time. Figure 6 Flow cytometry results showed that after 4 h, 12 h, and 24 h of incubation, 27.740%, 73.002%, and 89.741% of the cells were able to take up Cy5-tFNAs-saRNA, respectively. These results indicate that R28 cells can effectively take up tFNAs-saRNA. Figures 7-8 ).

[0071] Cell viability assay: Cell viability was assessed using the CCK-8 assay kit. This method was used to determine the optimal modeling conditions and the optimal concentration of tFNAs-YAPsaRNA. R28 cells were cultured at 5 × 10⁻⁶ cells / year. 4 Cells were seeded at a density of 1 / ml in 96-well plates, with 100 μL of cell suspension in each well. Three replicates were performed for each condition. Cells were cultured and processed according to standard procedures. Following the instructions of Cell Counting Kit-8 (CCK-8, MedCheExpress, China), 10 μL of CCK-8 reagent was added to each well and incubated for 1–4 h. The absorbance at 450 nm was measured using a spectrophotometer, and the relative cell viability for each group was calculated.

[0072] Expression level detection: Western blotting: The retina was separated from the eyeball under a stereomicroscope. The completely separated retinal tissue was added to a 1.5 ml centrifuge tube, along with 200 μL of protein extraction buffer (RIPA protein lysis buffer + PMSF protease inhibitor, 1:100). The retinal tissue was then sonicated until no tissue fragments were visible in the tube. The centrifuge tube containing the completely lysed retinal tissue protein was placed in a high-speed benchtop refrigerated centrifuge and centrifuged at 12,000 rpm for 15 minutes at 4°C. The supernatant was then transferred to a new tube for protein quantification. The extracted protein was quantified and its concentration equilibrated using a BCA protein quantification kit (KeyGEN, Nanjing, China). The supernatant containing 20 μg of protein was heated to 100°C and maintained for 10 min. Electrophoresis was performed using a 4%–20% pre-prepared gel, and the separated protein was transferred to a PVDF membrane (Millipore, Merck, Germany). The PVDF membrane was then blocked with 5% bovine serum albumin (BSA) solution at room temperature for 2 hours. The diluted primary antibodies were incubated overnight at 4°C. YAP (1:5000, 13584-1-AP, Proteintech), RBPMS (1:1000, abs152188, absin), SLC7A11 (1:1000, HA721868, huabio), GPX4 (1:5000, ET1706‐45, huabio), and FTH1 (1:1000, 4393S, Cell Signaling Technology) were used as internal controls. β-actin (1:1000; 4970S, CST) was incubated with anti-rabbit IgG horseradish peroxidase antibody (1:5000, ab6721, Abcam) at room temperature for 60 min and visualized using an enhanced chemiluminescence system (ProteinSimple, USA).

[0073] Real-time quantitative PCR: Gene expression levels were detected using Real-Time Fluorescence Quantitative PCR (RT-qPCR). Total RNA was extracted using the FastPure Cell / Tissue Total RNA Isolation Kit V2 (Vazyme, Nanjing, China), followed by genome clearance and reverse transcription using the HiScript IV All-in-One Ultra RTSuperMix for qPCR Reverse Transcription Kit (Vazyme, Nanjing, China) to obtain cDNA. Target genes were detected using qPCR with ChamQ SYBR Color qPCR Master Mix (High ROX Premixed) (Vazyme, Nanjing, China). β-actin was used as an internal control, and 2... -ΔΔCT The results were analyzed using a relative quantification method. Table 3 lists the corresponding primer sequences used in this study.

[0074] Table 3 PCR primer sequences YAP Forward: TTGCCATGAACCAGAGGATCAC (SEQ ID NO.16); Reverse: ATATTCCGTATTGCCTGCCG (SEQ ID NO.17) β-actin Forward: TCTGTGTGGATTGGTGGCT (SEQ ID NO.18); Reverse: TCATCGTACTCCTGCTTGCT (SEQ ID NO.19) The expression of YAP after tFNAs-saRNA incubation was detected by RT-PCR and Western blotting. Figures 9-11 The results showed that 250 nM tFNAs-saRNA significantly increased the levels of YAP mRNA and protein in R28 cells. Meanwhile, YAPsaRNA treatment alone had no significant effect on YAP expression in R28 cells. Therefore, tFNAs can serve as an effective delivery system for YAP saRNA, promoting the upregulation of target gene expression and thus enhancing related biological effects.

[0075] Inhibiting oxidative damage and ferroptosis: Ferraphobia Detection: Lipid ROS: Lipid ROS is the gold standard for detecting cellular ferroptosis. The level of intracellular lipid ROS was detected using the BODIPY™ 581 / 591 C11 fluorescent probe (Thermo Fisher Scientific, USA). Simply put, cells were incubated with BODIPY™ 581 / 591 C11 (10 μM) at 37°C for 30 min, washed three times with PBS, and the intensity of red and green fluorescence was observed using a fluorescence microscope to determine the level of lipid ROS. Red fluorescence represents unoxidized cells, and green fluorescence represents oxidized cells.

[0076] Fe 2+ Detection: Intracellular Fe was detected using the FerroOrange fluorescent probe (GLPBIO, USA). 2+Cells were incubated with FerroOrange working solution (1 μM) at 37°C for 30 min. No washing was required; the intensity of red fluorescence was directly observed using a fluorescence microscope to determine intracellular Fe. 2+ level.

[0077] Electron microscopy: The ultrastructure of R28 cells in each experimental group was observed using transmission electron microscopy (TEM). Cell samples from different treatment groups were collected according to standard procedures, pre-fixed with 2.5% glutaraldehyde, and then post-fixed with 1% osmium tetroxide. Following graded dehydration and infiltration with acetone, the samples were embedded in Epon-812 resin. Ultrathin sections with a thickness of 60-90 nm were prepared, collected on copper grids, and double-stained with uranyl acetate and lead citrate before TEM imaging.

[0078] Mitochondrial permeability transition pore (MPTP) detection method: The degree of mitochondrial permeability transition pore (MPTP) opening in cells of different treatment groups was determined by detecting calcein-AM fluorescence in the presence of CoCl2 using an MPTP detection kit (Beyotime Biotechnology Co., Ltd., China). Calcein-AM staining solution containing CoCl2 was added to each well and incubated at 37°C in the dark for 40 minutes. Subsequently, the medium was replaced with fresh, preheated medium at 37°C, and incubation continued for another 30 minutes in the dark. Nuclear staining was then performed using Hoechst 33342 (APExBIO, USA), and fluorescence images were acquired using a confocal microscope (Carl Zeiss, Germany).

[0079] Reactive oxygen species (ROS) level detection: ROS in OGD / R-damaged R28 cells were detected by flow cytometry. Intracellular ROS were detected using a DCFH-DA assay kit (Beyotime Biotechnology Co., Ltd., China). Cells were incubated in DMEM with 10 mM DCFH-DA at 37°C for 30 min before measurement. Cells were collected, washed three times with PBS, resuspended in PBS, and analyzed by flow cytometry. The excitation wavelength was 488 nm. The measured intensity was directly proportional to the intracellular ROS concentration.

[0080] Antioxidant activity of tFNAs-saRNA: R28 cells were stimulated with different oxygen-glucose deprivation / reoxygenation (OGD / R) conditions (OGD 4, 8, 12, 16 h, R 12 h). CCK-8 assay showed that cell viability gradually decreased with prolonged oxygen-glucose deprivation. Under the OGD 12 h / R 12 h condition, cell viability decreased to approximately 50% (e.g., Figure 12Effects of different concentrations of tFNAs-saRNA on R28 cells under normal culture conditions: Data showed that 0–500 nM of tFNAs-saRNA (0, 62.5, 125, 250, 500 nM) had no significant effect on cell viability (e.g., ...). Figure 41 In subsequent experiments, the applicant cultured R28 cells under OGD12h / R12h conditions, simultaneously adding tFNAs-YAP saRNA to assess its ability to enhance cell viability. The results showed that 250 nM tFNAs, 125 nM, 250 nM, and 375 nM tFNAs-saRNA all significantly improved R28 cell viability, with 250 nM tFNAs-YAP saRNA showing the most significant effect. In contrast, YAP-saRNA alone did not affect R28 cell viability (e.g., Figure 13 Then, the applicant used Western blotting to detect the protein expression of YAP in R28 cells after intervention with 250 nM tFNAs-saRNA under OGD / R conditions. The results showed that OGD / R damage significantly inhibited YAP protein levels; tFNAs-saRNA could effectively reverse this inhibition, while YAP saRNA alone had no effect. Figure 14 Therefore, tFNAs can serve as an efficient delivery system for YAP saRNA, promoting the upregulation of target gene expression and thus enhancing related biological effects.

[0081] The applicant treated R28 cells under OGD / R conditions with different drugs (saRNA, tFNAs, and tFNAs-saRNA) at a concentration of 250 nM to assess changes in mitochondrial function in R28 cells under OGD / R conditions. Mitochondria are important organelles responsible for ATP production, redox signaling, and cell death. The degree of MPTP opening in R28 cells under OGD / R conditions was quantitatively assessed by measuring the fluorescence intensity of retained calcein within mitochondria; this fluorescence intensity was negatively correlated with the degree of MPTP opening. The applicant found that the fluorescence intensity in the OGR / R model group was significantly reduced compared to the control group; however, after treatment with tFNAs, tFNAs-saRNA, or the ferroptosis inhibitor Fer-1, the fluorescence intensity significantly increased and was higher than that of the group treated with YAP saRNA alone. Figure 15 Furthermore, the applicant used flow cytometry to detect ROS levels and found that tFNAs, tFNAs-saRNA, and Fer-1 could all significantly inhibit the OGD / R-induced increase in ROS levels, with significantly better effects than using YAP saRNA alone. Figure 16 and Figure 17 tFNAs and tFNAs-saRNA have a significant inhibitory effect on OGD / R-induced oxidative stress damage in cells.

[0082] Ferroprelation, a common form of oxidative damage, was investigated in R28 cells under OGD / R conditions. The applicant treated R28 cells with different drugs (saRNA, tFNAs, and tFNAs-saRNA) at 250 nM concentrations and then examined the ferroptosis status. Transmission electron microscopy (TEM) allowed for detailed identification of ultrastructural changes in cells. The applicant observed that after OGD / R treatment, the cytoplasm and organelles of R28 cells swelled, and mitochondria atrophied. The changes in mitochondria were particularly pronounced in the OGD / R group, with smaller, more deeply stained mitochondria, damaged cristae, and ruptured outer mitochondrial membranes—all morphological markers of ferroptosis. tFNAs-saRNA treatment significantly alleviated the pathological changes in R28 cells, and its improvement on mitochondria was comparable to that of the ferroptosis inhibitor (Fer-1). Figure 18 Intracellular Fe 2+ It is one of the typical markers of ferroptosis in cells; therefore, the applicant further examined intracellular Fe. 2+ The applicant observed Fe levels in the OGD / R group and the saRNA group after OGD / R injury. 2+ The level (red fluorescence) was significantly increased after treatment with tFNAs, tFNAs-saRNA, and the ferroptosis inhibitor (Fer-1) Fe 2+ The level (red fluorescence) was significantly reduced ( Figure 19 Lipid peroxidation is the gold standard for detecting ferroptosis. The extent of lipid peroxidation can be observed through the intensity of red and green fluorescence under a fluorescence microscope, where red fluorescence represents unoxidized cells and green fluorescence represents oxidized cells. Compared to the control group, the applicant observed a significant increase in oxidized cells (green fluorescence) containing lipid peroxides and a significant decrease in unoxidized cells (red fluorescence) in both the OGD / R and saRNA groups after OGD / R injury. Conversely, treatment with tFNAs, tFNAs-saRNA, and the ferroptosis inhibitor (Fer-1) resulted in an increase in unoxidized cells (red fluorescence) and a decrease in oxidized cells containing lipid peroxides (green fluorescence). Figure 20 tFNAs and tFNAs-saRNA significantly inhibited OGD / R-induced ferroptosis in cells.

[0083] Example 3: Animal Model and Treatment Adult Sprague-Dawley (SD) rats (male, weighing 200±20 g) were obtained from the Animal Experiment Center of the Central Theater Command General Hospital. They were housed in a controlled environment with ample food and water, at a temperature of 22±1℃ and humidity of 55±5%, and subjected to a 12-hour light / dark cycle. All experimental procedures in this application were approved by the Medical Laboratory Animal Welfare and Ethics Committee of the Central Theater Command General Hospital.

[0084] Animals were randomly assigned to HE staining, immunofluorescence, and immunoblotting analysis. In the HE staining experiment, they were divided into a control group, an I / R 1-day group, an I / R 3-day group, and an I / R 7-day group. Three rats were observed in each group (n=3 rats / 6 eyes) to observe retinal damage at different time points after RI / RI.

[0085] Subsequent experiments divided rats into a control group, an I / R group, an I / R+tFNAs group, an I / R+tFNAs-saRNA group, and an I / R+saRNA group. Observations were conducted 7 days after RI / RI injury, with 3 animals (n=3 rats / 6 eyes) used at each observation time. The therapeutic concentrations of tFNAs, tFNAs-saRNA, and saRNA were all 1 μM, administered via intravitreal injection the day before RI / RI. RI / RI was performed using the anterior chamber inflation method. The main procedures were as follows: after deep anesthesia of rats using 2% sodium pentobarbital solution (60 mg / Kg), a 30G needle was inserted into the anterior chamber, and the intraocular pressure (IOP) was gradually increased from 60 mmHg to 110 mmHg using an anterior chamber inflation device, maintained for 60 min, and then slowly decreased back to 60 mmHg.

[0086] HE staining and RGC counting: All eyeballs were removed, and the optic nerve was severed 1 mm posterior to the eyeball wall. The eye cups were routinely fixed, dehydrated, and embedded. The eye cup specimens were prepared into 3–4 consecutive 4 μm frozen sections via the optic disc. Some sections were baked and stained with hematoxylin and eosin for observation of retinal histology under a light microscope. RGC counting was performed as follows: for each section, five non-repeating fields of view were randomly selected under high magnification (10×40), and the average number of RGCs in each field was calculated.

[0087] Immunofluorescence staining: After incubating the sections overnight at 4°C with diluted primary antibody, they were treated with histochemical staining, RBPMS (1:200, ab152188, Absin), and DAPI (1:100, ab104139, Abcam).

[0088] Statistical analysis: All data were analyzed using GraphPad Prism (version 8.0.1) software and are expressed as mean ± standard deviation (SD). One-way ANOVA was used for comparisons among multiple groups. A p-value < 0.05 was considered statistically significant.

[0089] The protective effect of tFNAs-saRNA on R28 cells damaged by OGD / R was verified in vitro. To further investigate the changes in the retina after RI / RI and the therapeutic effect of tFNAs-saRNA in vivo, a rat model of retinal ischemia-reperfusion injury (RI / RI) was established by induced intraocular pressure through anterior chamber paracentesis. HE staining was used to observe changes in retinal thickness at 1, 3, and 7 days after RI / RI injury. HE staining showed that in the control group, the retinal cell structure of each layer was compact and clear, and RGCs were arranged in an orderly manner; 1 day after I / R, retinal edema and thickening increased, GCL cells were disordered, cells were loose and swollen, and IPL showed significant edema and thickening; 3 days after I / R, retinal edema decreased, thickness recovered, RGC cell count decreased, survival rate reached 84%, IPL edema decreased, and thickness thinned; 7 days after I / R, retinal atrophy and thinning occurred, RGC cell count further decreased, survival rate reached 51%, and IPL thickness further thinned. Figures 21-24 ).

[0090] The applicant observed dynamic changes in YAP protein expression at 1, 3, and 7 days after RI / RI injury. Western blot analysis showed that YAP protein expression decreased in a time-dependent manner. Figure 25 This suggests that decreased YAP expression may be associated with I / R retinal damage. To further investigate whether ferroptosis is involved in I / R-induced retinal damage and its timing, the applicant subsequently used Western blotting to detect the dynamic changes in the expression of ferroptosis marker proteins (SLC7A11, GPX4, and FTH1), finding that the expression of SLC7A11, GPX4, and FTH1 proteins decreased in a time-dependent manner. Figures 26-28 ).

[0091] Considering the dilution effect of the vitreous cavity and the presence of various metabolic enzymes and clearance mechanisms in the tissue, higher concentrations of intravitreal drugs are needed to improve drug stability and efficacy in vivo. Based on previous studies, the drug concentration was determined to be 1 µM. Before modeling, intravitreal administration of saRNA, tFNAs, and tFNAs-saRNA was performed, and the drug's effect was evaluated 7 days after modeling. HE staining results showed that 7 days after modeling, the number of RGCs, the thickness of the IPL layer, and the inner retinal layer were significantly reduced. Treatment with tFNAs and tFNAs-saRNA improved the reduction of RGCs and slowed down IPL and retinal atrophy. Figures 29-32 ).

[0092] RBPMS are proteins involved in neuronal survival, synapse formation, and repair, and are active proteins of RGCs. Observing RBPMS helps to understand the activity of RGCs. Immunofluorescence staining by the applicant revealed that after RI / RI injury, the expression of RBPMS protein (red fluorescence) in the ganglion cell layer was significantly reduced compared with the normal group. The expression of RBPMS protein in the simple saRNA treatment group was comparable to that in the RI / RI injury group. RBPMS protein expression increased after tFNAs and tFNAs-saRNA treatment, indicating that the drug treatment enhanced the biological activity of RGCs and promoted the functional recovery of RGCs. Figure 33 ).

[0093] To further investigate the effect of tFNAs-saRNA on promoting YAP protein expression in retinal ischemia-reperfusion injury and to explore its potential therapeutic mechanism, the applicant conducted immunoblotting experiments. Results showed that YAP protein expression was significantly reduced after RI / RI injury, and there was no significant increase in YAP protein expression after saRNA treatment. YAP protein expression increased after tFNAs and tFNAs-saRNA treatment, with higher YAP protein expression in the tFNAs-saRNA group than in the tFNAs group. On the other hand, the applicant found that RBPMS expression was significantly reduced after RI / RI, and increased after tFNAs and tFNAs-saRNA treatment, consistent with the immunofluorescence results. This indicates that tFNAs-saRNA can promote the functional recovery of RGCs. However, its mechanism of action requires further investigation. In preliminary cell experiments, the applicant found that tFNAs-saRNA significantly inhibited ferroptosis, thus protecting R28 cells. Further validation was achieved through Western blotting experiments on retinal tissue. The results showed that tFNAs-saRNA increased the expression of ferroptosis-protective proteins SLC7A11, GPX4, and FTH1 in retinal tissue, alleviating ferroptosis-induced damage. These results indicate that tFNAs-saRNA treatment significantly upregulated YAP expression and increased the expression of RBMPS, SLC7A11, GPX4, and FTH1, significantly outperforming the tFNAs and YAP saRNA treatment groups. It can protect retinal tissue by inhibiting ferroptosis and reducing ganglion cell damage in retinal ischemia-reperfusion injury. Figures 34-39 ).

[0094] In summary, retinal ischemia-reperfusion injury is common in various fundus diseases, including retinal vascular occlusion and glaucoma, and is an important pathophysiological process in a series of retinal ischemic diseases, with oxidative stress playing a crucial role. Currently, clinical treatments for retinal ischemic diseases mainly involve intravitreal injection of anti-VEGF drugs and corticosteroids, but their efficacy is limited. Therefore, the exploration of new drugs for treating retinal ischemia-reperfusion injury is crucial. This application observes that the tFNAs-saRNAs complex can improve RI / RI by inhibiting ferroptosis, further providing a theoretical basis for the future clinical application of tFNAs-saRNAs. In the future, tFNAs-saRNAs are expected to become an effective treatment for retinal ischemic diseases.

Claims

1. A DNA tetrahedral drug complex for treating retinal ischemia-reperfusion injury, characterized in that, The tetrahedral drug complex is attached with YAP saRNA; The nucleotide sequences of the YAP saRNA are GUUAGAUACUCUGAGUCAACU and UUGACUCAGAGUAUCUAACAA. The preparation method of the DNA tetrahedral drug complex includes: adding the S1-saRNA sense strand, saRNA antisense strand, S2 strand, S3 strand, and S4 strand to buffer solutions to prepare solutions of equal concentration; mixing the five solutions thoroughly; heating; and cooling; the S1-saRNA... The nucleotide sequence of the sense strand is ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAATTTTTGUUAGAUACUCUGAGUCAACUTT; the nucleotide sequence of the S2 strand is ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG; the nucleotide sequence of the S3 strand is ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC; the nucleotide sequence of the S4 strand is ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG; and the nucleotide sequence of the saRNA antisense strand is UUGACUCAGAGUAUCUAACAA.

2. The DNA tetrahedral drug complex according to claim 1, characterized in that, The buffer solution contains 50 mM MgCl2, 10 mM Tris-HCl, and has a pH of 8.0; and / or the preparation method involves heating to 95°C for 10 min and cooling to 4°C for 20 min.

3. The use of the DNA tetrahedral drug complex according to claim 1 or 2 in the preparation of a drug for treating retinal ischemia-reperfusion injury.

4. The application according to claim 3, characterized in that, The retinal ischemia-reperfusion injury refers to retinal ischemia-reperfusion injury caused by trauma, surgery, ocular vascular occlusion, or glaucoma.

5. The application according to claim 3, characterized in that, The drug is in the form of an injection, eye drops, or ointment.

6. The application according to claim 3, characterized in that, The drug also includes anti-inflammatory drugs and / or neurotrophic factors.

Images