CRISPR / dCas9 vector for improving BnNAC022 gene expression as well as construction method and application of CRISPR / dCas9 vector

By constructing a CRISPR/dCas9 vector to target and activate the BnNAC022 gene, the randomness and safety issues of traditional transgenic technology in rapeseed were solved, and the aphid resistance of rapeseed was significantly enhanced.

CN122012575APending Publication Date: 2026-05-12安徽省农业科学院
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202610018850.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-08
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively utilize the BnNAC022 gene to breed aphid-resistant rapeseed. Traditional transgenic technologies are subject to randomness and biosafety controversies, and CRISPR gene activation technology has not been applied in rapeseed.

Method used

A CRISPR/dCas9 vector was constructed, and the BnNAC022 gene was activated by targeting the CRISPR-SL-U6-26-TG1-TG2 vector. The precise targeting function of dCas9 was used to enhance its expression and improve the aphid resistance of rapeseed.

Benefits of technology

Transgenic homozygous lines JH21 and JH40, with significantly increased expression of the BnNAC022 gene, were obtained. They showed a significant reduction in aphid numbers and enhanced aphid resistance, while agronomic traits remained largely unchanged.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012575A_ABST
    Figure CN122012575A_ABST
Patent Text Reader

Abstract

The invention relates to a CRISPR / dCas9 (clustered regularly interspaced short palindromic repeats / dCas9) vector for improving BnNAC022 gene expression as well as a construction method and application of the CRISPR / dCas9 vector. The CRISPR / dCas9 vector is a CRISPR-SL-U6-26-TG1-TG2 vector, the nucleotide sequence of the CRISPR / dCas9 vector is shown as SEQ ID NO.7, and the CRISPR / dCas9 vector contains an expression cassette with two cores; the expression box 1 comprises an arabidopsis thaliana U6-26 promoter, a target spot 1, an sgRNA2.0 support sequence, an At-tRNAGly coding sequence, a target spot 2 and an sgRNA2.0 support sequence in sequence from the 5 '-3' end; and the expression box 2 sequentially comprises a constitutive promoter, a 3 * Flag tag coding sequence, a first SV40 NLS, a dCas9 coding gene, an NLS nuclear localization signal, a VP64 coding gene, a coding gene of self-splitting polypeptide T2A, an MS2 coding gene, a second SV40 NLS, a P65 coding gene, an HSF1 coding gene and an NOS transcription terminator from the 5 '-3' end. The recombinant vector CRISPR-SL-U6-26-TG1-TG2 constructed by the invention is an activation vector of a targeted BnNAC022 gene promoter, so that the expression level of the BnNAC022 gene in the brassica napus can be remarkably improved, and the aphid resistance of the brassica napus can be enhanced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of plant genetic engineering and molecular breeding technology, specifically relating to a CRISPR / dCas9 vector for enhancing the expression of the BnNAC022 gene, its construction method, and its application. Background Technology

[0002] Brassica napus is an important oilseed crop, but it is often attacked by pests such as aphids during its growth, which leads to a serious decline in yield and quality. At present, the control of aphids mainly relies on chemical pesticides, but long-term use can easily lead to environmental pollution, pesticide residues and increased pesticide resistance in pests. Therefore, cultivating new insect-resistant rapeseed varieties is the fundamental way to solve the above problems.

[0003] Plant insect resistance is a complex trait controlled by multiple genes. The NAC transcription factor family plays an important regulatory role in plant responses to biotic and abiotic stresses. Previous studies have found that the BnNAC022 gene is upregulated in rapeseed in response to aphid stress, suggesting that it may be involved in aphid resistance. However, how to use this gene to cultivate aphid-resistant rapeseed germplasm resources has not yet been reported.

[0004] Traditional transgenic technology enhances function by introducing exogenous genes, but it suffers from problems such as randomness in exogenous gene integration, unstable expression, and biosafety controversies. CRISPR gene activation technology fuses dCas9 (D10A, H840A) with transcriptional activation structural proteins for expression. Utilizing the precise targeting function of dCas9, the transcriptional activation protein is targeted to the promoter region of the target gene, thereby recruiting transcription factors and RNA polymerases to activate the expression of the target gene. It is precise, safe, and efficient, showing great potential in crop genetic improvement. Currently, there is no research on creating new rapeseed germplasm resistant to aphids using CRISPR gene activation technology. Summary of the Invention

[0005] The purpose of this invention is to provide a CRISPR / dCas9 vector for enhancing BnNAC022 gene expression, its construction method, and its application in order to solve the above-mentioned problems.

[0006] The present invention achieves the above objectives through the following technical solutions: This invention provides a CRISPR / dCas9 vector for enhancing the expression of the BnNAC022 gene. The CRISPR / dCas9 vector is a CRISPR-SL-U6-26-TG1-TG2 vector containing two core expression cassettes. Expression cassette 1 is an sgRNA expression cassette: from the 5' end to the 3' end, it contains the Arabidopsis U6-26 promoter, target 1, sgRNA2.0 scaffold sequence, Arabidopsis At-tRNAGly coding sequence, target 2, and sgRNA2.0 scaffold sequence. Expression cassette 2 is a functional protein expression cassette: from the 5' end to the 3' end, it consists of a constitutive promoter, a 3×Flag tag coding sequence, the first SV40 NLS, the dCas9 coding gene, the NLS nuclear localization signal, the VP64 coding gene, the coding gene for the self-cleaving polypeptide T2A, the MS2 coding gene, the second SV40 NLS, the P65 coding gene, the HSF1 coding gene, and the NOS transcription terminator.

[0007] As a further optimization of the above invention, the constituent promoter is a 35S promoter and / or a UBI promoter.

[0008] As a further optimization of the above invention, the nucleotide sequence of the CRISPR-SL-U6-26-TG1-TG2 vector is shown in SEQ ID NO.7, the nucleotide sequence of target 1 is shown in SEQ ID NO.4, the nucleotide sequence of target 2 is shown in SEQ ID NO.5, and the nucleotide sequence of the Arabidopsis U6-26 promoter is shown in SEQ ID NO.6.

[0009] As a further optimization of the above invention, the CDS sequence of the BnNAC022 gene is shown in SEQ ID NO.2, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO.3.

[0010] This invention also provides a method for constructing a CRISPR / dCas9 vector to enhance BnNAC022 gene expression, wherein the CRISPR / dCas9 vector is a recombinant vector CRISPR-SL-U6-26-TG1-TG2, and the construction method includes the following steps: (1) Construct the basic gene activation vector CRISPR-SL; (2) Two specific sgRNA targets were designed and synthesized targeting the upstream region of the translation initiation site of the BnNAC022 gene, and named target 1 and target 2, respectively. (3) The basic gene activation vector CRISPR-SL was digested with SamI restriction endonuclease, and the sgRNA expression unit driven by the Arabidopsis U6-26 promoter, containing the above two specific sgRNA target sequences and linked to the sgRNA2.0 scaffold, was inserted into the basic gene activation vector CRISPR-SL using T4 DNA ligase to construct the recombinant vector CRISPR-SL-U6-26-TG1-TG2. The nucleotide sequence of the recombinant vector CRISPR-SL-U6-26-TG1-TG2 is shown in SEQ ID NO.7.

[0011] As a further optimization of the above invention, in step (1), the pCAMBIA3301 vector is used as the basic backbone, and the pCAMBIA3301 vector is double-digested with NcoI and PmI restriction endonucleases to remove the original GUS fragment. Then, the CRISPR-SAM system with the core of dCas9-VP64 and MS2-P65-HSF1 fusion expression cassette is inserted through seamless cloning technology to construct the basic gene activation vector CRISPR-SL.

[0012] As a further optimization of the above invention, in step (3), the structure of the sgRNA expression unit is: Arabidopsis U6-26 promoter-target 1-sgRNA2.0 scaffold-At-tRNAGly-target 2-sgRNA2.0 scaffold.

[0013] This invention also provides an application of a CRISPR / dCas9 vector that enhances the expression of the BnNAC022 gene in targeting and activating the BnNAC022 gene and enhancing the aphid resistance of Brassica napus.

[0014] As a further optimization of the above invention, the method for obtaining rapeseed with enhanced aphid resistance specifically involves transforming the recombinant vector CRISPR-SL-U6-26-TG1-TG2 into wild-type rapeseed ZS11 via Agrobacterium-mediated transformation to obtain T0 generation transgenic plants. Positive transgenic plants are screened by molecular detection and cultivated to the T1 generation to obtain genetically stable lines. Using real-time quantitative PCR technology, transgenic homozygous lines JH21 and JH40 with significantly increased BnNAC022 gene expression levels are screened.

[0015] As a further optimization of the above invention, the expression level of the BnNAC022 gene in the transgenic homozygous lines JH21 and JH40 is 2-4 times that of wild-type Brassica napus ZS11.

[0016] The beneficial effects of this invention are as follows: This invention utilizes the CRISPR / dCas9 system to construct the recombinant vector CRISPR-SL-U6-26-TG1-TG2, which is an activation vector targeting the BnNAC022 gene promoter. This vector was transformed into wild-type Brassica napus ZS11 (Zhongshuang 11) using Agrobacterium-mediated transformation, resulting in transgenic homozygous lines JH21 and JH40 with significantly increased BnNAC022 gene expression. In aphid infestation tests, the transgenic homozygous lines JH21 and JH40 exhibited significantly reduced aphid numbers and significantly enhanced aphid resistance, without significant changes in agronomic traits. This invention provides a new method for aphid-resistant breeding of rapeseed. Attached Figure Description

[0017] Figure 1 This is a schematic diagram of the recombinant vector CRISPR-SL-U6-26-TG1-TG2.

[0018] Figure 2 The image shows the recombinant vector CRISPR-SL-GmU6-TG1-TG2.

[0019] Figure 3 The image shows the recombinant vector CRISPR-SL-U6-26-TG3-TG4.

[0020] Figure 4 The results of RNA detection of the BnNAC022 gene in the transgenic line of the recombinant vector CRISPR-SL-U6-26-TG1-TG2.

[0021] Figure 5 The results show the expression level of the BnNAC022 gene in the transgenic line of the recombinant vector CRISPR-SL-U6-26-TG1-TG2.

[0022] Figure 6 The results of RNA detection of the BnNAC022 gene in the transgenic line of the recombinant vector CRISPR-SL-GmU6-TG1-TG2.

[0023] Figure 7 The results show the expression level of the BnNAC022 gene in the transgenic line of the recombinant vector CRISPR-SL-GmU6-TG1-TG2.

[0024] Figure 8 The results of RNA detection of the BnNAC022 gene in the transgenic line of the recombinant vector CRISPR-SL-U6-26-TG3-TG4.

[0025] Figure 9The results show the expression level of the BnNAC022 gene in the transgenic line of the recombinant vector CRISPR-SL-U6-26-TG3-TG4.

[0026] Figure 10 Phenotypic comparison of transgenic lines JH21 and JH40, derived from the recombinant vector CRISPR-SL-U6-26-TG1-TG2, and the control group 30 days after aphid infection.

[0027] Figure 11 The number of aphids in the transgenic lines JH21 and JH40 of the recombinant vector CRISPR-SL-U6-26-TG1-TG2 and the control group was statistically analyzed. Detailed Implementation

[0028] The present application will now be described in further detail with reference to the accompanying drawings. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0029] I. Materials 1. Brassica napus type rapeseed: Brassica napus type rapeseed ZS11, provided by the rapeseed pest control and resource innovation team of the Crop Research Institute of Anhui Academy of Agricultural Sciences; 2. Agrobacterium strain: Agrobacterium tumefaciens strain GV3101; 3. Basic plant expression vector: pCAMBIA3301 (described in the literature "Hajdukiewicz P, Svab Z, Maliga P. The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol Biol. 1994 May;25(6):989-94."). 4. Core components of the CRISPR-SAM system: derived from Konermann et al., Nature, 2015, and synthesized by Sangon Biotech (Shanghai) Co., Ltd. 5. Main reagents: restriction endonucleases NcoI, PmI, SamI, FastPure Plant Total RNA Isolation Kit, HiScript III 1st Strand cDNA Synthesis Kit, Universal SYBR qPCR Master Mix, etc., were all purchased from Nanjing Novizan Biotechnology Co., Ltd. unless otherwise specified. Unless otherwise specified, the methods used in this embodiment are conventional methods known to those skilled in the art, and the reagents and materials used are commercially available products.

[0030] method 2.1 Construction of the CRISPRa system carrier (1) Construction of the CRISPRa system carrier CRISPR-SL-U6-26-TG1-TG2 Based on the pCAMBIA3301 vector, this study aims to construct a CRISPR / dCas9 activation system (CRISPRa) capable of targeting and activating the endogenous BnNAC022 gene in Brassica napus (the genomic sequence of the BnNAC022 gene is shown in SEQ ID NO.1, the CDS sequence is shown in SEQ ID NO.2, and the amino acid sequence encoding the protein is shown in SEQ ID NO.3). The specific steps are as follows: 1) The pCAMBIA3301 vector was double-digested with NcoI and PmI restriction endonucleases to remove the original GUS fragment. Then, using seamless cloning technology, the CRISPR-SAM system (with the core of the dCas9-VP64 and MS2-P65-HSF1 fusion expression cassette) synthesized by Sangon Biotech (Shanghai) Co., Ltd. was inserted to construct the basic gene activation vector, named CRISPR-SL. 2) Two specific sgRNAs were designed and synthesized targeting the upstream region of the translation initiation site (ATG) of the BnNAC022 gene: SEQ ID NO.4: Target 1 (located 204bp upstream of TSS): GACCAAGTCAAGAGGAAGATG; SEQ ID NO.5: Target 2 (located 143bp upstream of TSS): AGAATCTCTCTCATCACATA; 3) The CRISPR-SL vector was digested with SamI restriction endonuclease, and an sgRNA expression unit driven by the Arabidopsis U6-26 promoter (nucleotide sequence as shown in SEQ ID NO. 6), containing the above two target sequences and linked to the sgRNA2.0 scaffold, was inserted into the vector using T4 DNA ligase. The structure of the sgRNA expression unit is: Arabidopsis U6-26 promoter - target 1 - sgRNA2.0 scaffold - At-tRNAGly - target 2 - sgRNA2.0 scaffold. This constructed the final recombinant vector for genetic transformation of Brassica napus, named CRISPR-SL-U6-26-TG1-TG2, with its nucleotide sequence shown in SEQ ID NO. 7 (vector map shown in SEQ ID NO. 7). Figure 1 (As shown).

[0031] The CRISPR-SL-U6-26-TG1-TG2 vector contains two core expression cassettes: Expression cassette 1 (sgRNA expression cassette): from the 5' end to the 3' end, it contains the Arabidopsis U6-26 promoter, target 1, sgRNA2.0 scaffold sequence, Arabidopsis At-tRNAGly coding sequence, target 2, and sgRNA2.0 scaffold sequence.

[0032] Expression cassette 2 (functional protein expression cassette): From the 5' end to the 3' end, it consists of a constitutive promoter (such as 35S or UBI), a 3×Flag tag coding sequence, the first SV40 NLS, the dCas9 coding gene, the NLS nuclear localization signal, the VP64 coding gene, the coding gene for the self-cleaving polypeptide T2A, the MS2 coding gene, the second SV40 NLS, the P65 coding gene, the HSF1 coding gene, and the NOS transcription terminator.

[0033] (2) Construction of the CRISPRa system carrier CRISPR-SL-GmU6-TG1-TG2 Based on the construction method of the CRISPRa system vector CRISPR-SL-U6-26-TG1-TG2 in step (1) above, the following two specific sgRNA targets were designed and synthesized in the upstream region of the translation start site (ATG) of the BnNAC022 gene, on the basis of the basic gene activation vector CRISPR-SL: SEQ ID NO.4: Target 1 (located 204bp upstream of TSS): GACCAAGTCAAGAGGAAGATG; SEQ ID NO.5: Target 2 (located 143bp upstream of TSS): AGAATCTCTCTCATCACATA; The CRISPR-SL vector was digested with SamI restriction endonuclease, and an sgRNA expression unit driven by the soybean GmU6 promoter sequence (nucleotide sequence as shown in SEQ ID NO. 8), containing the two target sequences mentioned above and linked to the sgRNA2.0 scaffold, was inserted into the vector using T4 DNA ligase. The structure of this sgRNA expression unit is: GmU6 promoter-target 1-sgRNA2.0 scaffold-At-tRNAGly-target 2-sgRNA2.0 scaffold. This constructed the final recombinant vector for genetic transformation of Brassica napus, named CRISPR-SL-GmU6-TG1-TG2, with its nucleotide sequence shown in SEQ ID NO. 9 (vector map shown in SEQ ID NO. 8). Figure 2 (As shown).

[0034] The CRISPR-SL-GmU6-TG1-TG2 vector contains two core expression cassettes: Expression cassette 1 (sgRNA expression cassette): from the 5' end to the 3' end, the sequence consists of the soybean GmU6 promoter sequence, target 1, sgRNA2.0 scaffold sequence, Arabidopsis thaliana At-tRNAGly coding sequence, target 2, and sgRNA2.0 scaffold sequence.

[0035] Expression cassette 2 (functional protein expression cassette): From the 5' end to the 3' end, it consists of a constitutive promoter (such as 35S or UBI), a 3×Flag tag coding sequence, the first SV40 NLS, the dCas9 coding gene, the NLS nuclear localization signal, the VP64 coding gene, the coding gene for the self-cleaving polypeptide T2A, the MS2 coding gene, the second SV40 NLS, the P65 coding gene, the HSF1 coding gene, and the NOS transcription terminator.

[0036] (3) Construction of the CRISPRa system carrier CRISPR-SL-U6-26-TG3-TG4 Based on the construction method of the CRISPRa system vector CRISPR-SL-U6-26-TG1-TG2 in step (1) above, the following two specific sgRNA targets (reverse complementary sequences) were designed and synthesized targeting the upstream region of the translation start site (ATG) of the BnNAC022 gene, based on the basic gene activation vector CRISPR-SL: SEQ ID NO.10: Target 3 (located in the region from -374bp to -351bp of the translation start site): CCCTTTCTACGATAAAAGCGCGT; SEQ ID NO.11: Target 4 (located in the region from -68bp to -45bp of the translation start site): CCTTTTCACTTACAAAGCTTTTA; The CRISPR-SL vector was digested with SamI restriction endonuclease, and an sgRNA expression unit driven by the Arabidopsis U6-26 promoter sequence (nucleotide sequence as shown in SEQ ID NO. 6), containing the two target sequences mentioned above and linked to the sgRNA2.0 scaffold, was inserted into the vector using T4 DNA ligase. The structure of this sgRNA expression unit is: U6-26 promoter-target 3-sgRNA2.0 scaffold-At-tRNAGly-target 4-sgRNA2.0 scaffold. This constructed the final recombinant vector for genetic transformation of Brassica napus, named CRISPR-SL-U6-26-TG3-TG4, with its nucleotide sequence shown in SEQ ID NO. 12 (vector map shown in SEQ ID NO. 12). Figure 3 (As shown).

[0037] The CRISPR-SL-U6-26-TG3-TG4 vector contains two core expression cassettes: Expression cassette 1 (sgRNA expression cassette): from the 5' end to the 3' end, it contains the Arabidopsis U6-26 promoter sequence, target 3, sgRNA2.0 scaffold sequence, Arabidopsis At-tRNAGly coding sequence, target 4, and sgRNA2.0 scaffold sequence.

[0038] Expression cassette 2 (functional protein expression cassette): From the 5' end to the 3' end, it consists of a constitutive promoter (such as 35S or UBI), a 3×Flag tag coding sequence, the first SV40 NLS, the dCas9 coding gene, the NLS nuclear localization signal, the VP64 coding gene, the coding gene for the self-cleaving polypeptide T2A, the MS2 coding gene, the second SV40 NLS, the P65 coding gene, the HSF1 coding gene, and the NOS transcription terminator.

[0039] 2.2 Rapeseed genetic transformation 1) Seed cleaning and germination: Disinfect with 75% ethanol for 30-60 seconds, rinse with sterile water once, 1 min each time; disinfect with 0.15% mercuric chloride for 10 min, rinse with sterile water twice, 1 min each time; rinse with sterile water for 30 min, inoculate onto sterile filter paper and air dry. Inoculate the seeds of Brassica napus ZS11 into germination culture bottles and incubate in the dark at 23℃ for 5-6 days. 2) Pre-culture: Cut the hypocotyls of the rapeseed seedlings that germinated in step 1) into segments of 0.4-0.6 cm, inoculate them into pre-culture medium, and culture at 23℃ under light for 2-3 days to obtain explants; 3) Agrobacterium infection and co-culture: Agrobacterium was picked into the infection solution and an Agrobacterium resuspension with OD600=0.2 was prepared. The explants were inoculated into the Agrobacterium suspension for 10 min. The infected explants were inoculated onto sterile filter paper and dried. They were then inoculated onto the co-culture medium and incubated in the dark at 23℃ for 48-72 h. 4) Destermination (delayed screening): The co-cultured explants were inoculated onto a destermination medium and cultured at 23°C under light for 6 days; 5) Screening / differentiation: The sterilized explants were inoculated onto the screening / differentiation medium, with 30 explants per plate, and cultured at 23°C under light. The plates were changed every 15 days. 6) Rooting culture: Inoculate the buds differentiated in step 5) into the rooting medium and culture at 23°C under light until roots are formed.

[0040] 7) Detection: Genomic DNA was extracted from rapeseed using the CTAB method and subjected to PCR detection. Transgenic positive plants were identified through detection. The detection primers are as follows: SEQ ID NO.13: cas9F:GAGTTCTACAAGTTCATCAAGCC; SEQ ID NO. 14: cas9R: TGAAGTAGTCCTCTTTCAGC.

[0041] 2.3 Screening to obtain transgenic lines with significantly increased BnNAC022 gene expression levels RT-PCR and RT-qPCR detection: Total RNA was extracted from the leaves of the above-mentioned transgenic positive plants, reverse transcribed into cDNA, and then subjected to PCR and qPCR using specific primers. The nucleotide sequences of the specific primers for PCR and qPCR are as follows: Internal reference BnACTIN7 gene: SEQ ID NO.15: BnACTIN7-F:TGGGTTTGCTGGGTGACGAT; SEQ ID NO.16: BnACTIN7-R: TGCCTAGGACGACCAACAATACT; BnNAC022 gene: SEQ ID NO. 17: BnNAC022-F: CCGCTTCCTTCAACATCATT; SEQ ID NO. 18: BnNAC022-R: GTCGCAGCTTTCTCGAGTCT.

[0042] The PCR reaction system is shown in Table 1: Table 1 PCR reaction system ; The reaction conditions for PCR are shown in Table 2: Table 2 PCR reaction conditions ; The reaction system for qPCR is shown in Table 3: Table 3 qPCR reaction system ; The qPCR reaction conditions are shown in Table 4: Table 4 qPCR reaction conditions Experimental conclusion: After antibiotic selection, PCR identification, and RT-PCR (such as...) Figure 4 , 6 Detection (as shown in Figure 8) and RT-qPCR (as shown in Figure 8) Figure 5 , 7 As shown in Figure 9, two independent transgenic events were obtained, namely the transgenic homozygous lines JH21-1 / 2 / 3 / 4 / 5 and JH40-1 / 2 / 3 / 4 / 5. Among them, the expression level of the BnNAC022 gene in the transgenic homozygous lines JH21 and JH40 of the recombinant vector CRISPR-SL-U6-26-TG1-TG2 was significantly higher than that in wild-type Brassica napus ZS11. In addition, the expression level of the BnNAC022 gene in the transgenic homozygous lines of the recombinant vectors CRISPR-SL-GmU6-TG1-TG2 and CRISPR-SL-U6-26-TG3-TG4 was significantly lower than that in wild-type Brassica napus ZS11, indicating that these two recombinant vectors do not have the function of targeting and activating the BnNAC022 gene.

[0043] 2.4 Identification of aphid-resistant phenotypes The JH21 and JH40 transgenic homozygous lines obtained in step 2.3 above were cultured in a greenhouse until flowering and then self-pollinated to obtain the T1 generation. Using wild-type Brassica napus ZS11 as the control group, an indoor aphid-specific inoculation test was conducted to identify the aphid-resistant phenotype. The specific steps are as follows: When the seedlings of the JH21 and JH40 transgenic homozygous lines and wild type reached the five-leaf stage, an indoor aphid infestation experiment was conducted. Three aphids were infested per plant. The JH21 and JH40 transgenic homozygous lines and wild type were placed in insect rearing cages, and the total number of aphids per plant was recorded every 10 days. All seedlings were cultured under long-day (LD) conditions, with 16 hours of light, 8 hours of darkness, a temperature of 22°C, and a white LED light intensity of 5500 lux.

[0044] like Figure 10-11 As shown, the results indicate that 10–30 days after inoculation, the number of aphids on the transgenic homozygous lines JH21 and JH40 was significantly lower than that in the control group, and the leaves were less damaged, with the overall growth status being better than that of the control group.

[0045] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. A CRISPR / dCas9 vector for enhancing BnNAC022 gene expression, characterized in that, The CRISPR / dCas9 vector is a CRISPR-SL-U6-26-TG1-TG2 vector containing two core expression cassettes; Expression cassette 1 is an sgRNA expression cassette: from the 5' end to the 3' end, it contains the Arabidopsis U6-26 promoter, target 1, sgRNA2.0 scaffold sequence, Arabidopsis At-tRNAGly coding sequence, target 2, and sgRNA2.0 scaffold sequence. Expression cassette 2 is a functional protein expression cassette: from the 5' end to the 3' end, it consists of a constitutive promoter, a 3×Flag tag coding sequence, the first SV40 NLS, the dCas9 coding gene, the NLS nuclear localization signal, the VP64 coding gene, the coding gene for the self-cleaving polypeptide T2A, the MS2 coding gene, the second SV40 NLS, the P65 coding gene, the HSF1 coding gene, and the NOS transcription terminator.

2. The CRISPR / dCas9 vector for enhancing BnNAC022 gene expression according to claim 1, characterized in that, The constituent promoter is a 35S promoter and / or a UBI promoter.

3. The CRISPR / dCas9 vector for enhancing BnNAC022 gene expression according to claim 1, characterized in that, The nucleotide sequence of the CRISPR-SL-U6-26-TG1-TG2 vector is shown in SEQ ID NO.7, the nucleotide sequence of target 1 is shown in SEQ ID NO.4, the nucleotide sequence of target 2 is shown in SEQ ID NO.5, and the nucleotide sequence of the Arabidopsis U6-26 promoter is shown in SEQ ID NO.

6.

4. The CRISPR / dCas9 vector for enhancing BnNAC022 gene expression according to claim 1, characterized in that, The CDS sequence of the BnNAC022 gene is shown in SEQ ID NO.2, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO.

3.

5. A method for constructing a CRISPR / dCas9 vector for enhancing BnNAC022 gene expression as described in any one of claims 1-4, characterized in that, The CRISPR / dCas9 vector is the recombinant vector CRISPR-SL-U6-26-TG1-TG2, and the construction method includes the following steps: (1) Construct the basic gene activation vector CRISPR-SL; (2) Two specific sgRNA targets were designed and synthesized in the upstream region of the translation initiation site of the BnNAC022 gene, and named target 1 and target 2, respectively. (3) The basic gene activation vector CRISPR-SL was digested with SamI restriction endonuclease, and the sgRNA expression unit driven by Arabidopsis U6-26 promoter, containing the above two specific sgRNA target sequences and linked to the sgRNA2.0 scaffold, was inserted into the basic gene activation vector CRISPR-SL by T4 DNA ligase, thereby constructing the recombinant vector CRISPR-SL-U6-26-TG1-TG2.

6. The method for constructing a CRISPR / dCas9 vector to enhance BnNAC022 gene expression according to claim 5, characterized in that, In step (1), the pCAMBIA3301 vector is used as the basic backbone. The pCAMBIA3301 vector is double-digested with NcoI and PmI restriction endonucleases to remove the original GUS fragment. Then, the CRISPR-SAM system with the core of the dCas9-VP64 and MS2-P65-HSF1 fusion expression cassette is inserted through seamless cloning technology to construct the basic gene activation vector CRISPR-SL.

7. The method for constructing a CRISPR / dCas9 vector to enhance BnNAC022 gene expression according to claim 5, characterized in that, In step (3), the structure of the sgRNA expression unit is: Arabidopsis U6-26 promoter-target 1-sgRNA2.0 scaffold-At-tRNAGly-target 2-sgRNA2.0 scaffold.

8. The application of a CRISPR / dCas9 vector as described in any one of claims 1-4 for enhancing the expression of the BnNAC022 gene in targeting and activating the BnNAC022 gene and enhancing the aphid resistance of Brassica napus.

9. The application according to claim 8, characterized in that, The method for obtaining rapeseed with enhanced aphid resistance is as follows: the recombinant vector CRISPR-SL-U6-26-TG1-TG2 is transformed into wild-type rapeseed ZS11 using Agrobacterium-mediated transformation to obtain T0 generation transgenic plants. Positive transgenic plants are screened by molecular detection and cultivated to T1 generation to obtain genetically stable lines. Using real-time quantitative PCR technology, transgenic homozygous lines JH21 and JH40 with significantly increased BnNAC022 gene expression levels are screened.

10. The application according to claim 9, characterized in that, The expression level of the BnNAC022 gene in the transgenic homozygous lines JH21 and JH40 was 2-4 times that of wild-type Brassica napus ZS11.