Saline-alkaline resistant gene MdLAC12 for enhancing apple, extraction method and system

By cloning the apple salt tolerance gene MdLAC12 and using Agrobacterium-mediated genetic transformation, the problem of high cost of apple improvement in saline-alkali soil was solved, achieving efficient planting and biosafety of apples in severely saline-alkali land, and promoting technological progress in apple breeding.

CN122012576APending Publication Date: 2026-05-12NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610026703.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-09
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

In existing technologies, apples are highly adaptable to saline-alkali soils, but the improvement of severely saline-alkali land is costly, time-consuming, and ineffective. Traditional transgenic technology has low application efficiency and it is difficult to improve the salt and alkali tolerance of apples through genetic modification.

Method used

By cloning and functionally validating the apple salt tolerance gene MdLAC12, and using an Agrobacterium-mediated genetic transformation system, the gene was introduced into apples, establishing an efficient genetic improvement method to enhance the salt tolerance of apples.

Benefits of technology

It significantly improved the salt and alkali tolerance of apples, expanded their planting range, reduced breeding costs, provided biosafety and environmental adaptability, and promoted the application of modern biotechnology in agriculture.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012576A_ABST
    Figure CN122012576A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of molecular biology, and discloses a saline-alkaline resistant gene MdLAC12 for enhancing apple and application thereof, an extraction method of the saline-alkaline resistant gene MdLAC12 for enhancing apple comprises the following steps: step 1, extracting total RNA (Ribonucleic Acid) from an apple rootstock M9-T337 root system, and taking cDNA (Complementary Deoxyribonucleic Acid) obtained by reverse transcription as a cloning template; 2, designing an MdLAC12 primer according to an apple genome database GDDH13, and carrying out a conventional polymerase chain reaction (PCR); and step 3, carrying out homologous recombination on the obtained PCR product of the MdLAC12 and pMD18-T, transforming a connection product into an escherichia coli DH5 alpha competent cell, and selecting resistant bacterial plaque for sequencing analysis to obtain a CDs sequence of the MdLAC12. The method is helpful for breeding excellent saline-alkaline tolerant apple rootstocks, and can also improve utilization of saline-alkaline land in a prebiotic area. The method has the advantages of simplicity in operation, high saline-alkaline tolerance and low production cost, and can be widely applied to the saline-alkaline tolerance germplasm resource breeding process.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, and in particular relates to a gene MdLAC12 that enhances the salt and alkali tolerance of apples, its extraction method and system. Background Technology

[0002] Apples (Malus domestica Borkh.) are cultivated in temperate regions across five continents and are one of the world's most important deciduous fruit tree species. According to data from the National Bureau of Statistics, in 2020, my country's total apple cultivation area reached 2.088 million hectares, with a total output of 446,600 tons (National Bureau of Statistics of the People's Republic of China data 2021), ranking first in the world and holding an important position in my country's fruit industry development. However, my country has limited arable land, its overall quality is not high, and its reserve resources are insufficient. Therefore, it is crucial to properly balance the development of grain production with maximizing comparative benefits. Under the premise of ensuring basic self-sufficiency in grains and absolute security of staple food, better development of the apple planting industry requires the development of new apple-growing land. The Loess Plateau in Northwest China, a prime apple-growing region, is dominated by black loess soil with high salinity. Long-term unreasonable irrigation and the application of chemical fertilizers have increased soil salinity. In low-lying areas, even after water evaporation, salt remains, leading to the long-term accumulation of saline-alkali areas (Zhang Rui 2021). Currently, over 70% of the soil in the Loess Plateau region is high-pH saline-alkali soil (mainly containing NaCl and NaHCO3 salts, pH 8.0-8.5) (Xue Hao et al., 2015). Most of this land is unsuitable for grain cultivation. Apples, however, are relatively adaptable to soil conditions, and mildly saline-alkali land can be cultivated in large areas after appropriate improvement. However, improving severely saline-alkali land is costly, time-consuming, and ineffective, and is generally not applicable (Shan Shuangquan, 2017). In production, it has been found that in the symbiotic relationship between scion and rootstock, the strength of the rootstock directly affects the scion's adaptability to adverse conditions (Moore, 1984). Therefore, selecting rootstocks with strong salt and alkali resistance is the most direct and effective way to address soil salinization. Thus, screening salt- and alkali-resistant rootstock varieties is of great significance.

[0003] Based on the above analysis, the problems and shortcomings of the existing technology are as follows: More than 70% of the soil in the Loess Plateau region is high-pH saline-alkali soil (mainly containing NaCl and NaHCO3 salts, pH 8.0-8.5) (Xue Hao et al. 2015). Most of the land is unsuitable for grain production. Apples are relatively adaptable to soil conditions. Slightly saline-alkali land can be cultivated in large areas after appropriate improvement. However, the improvement of severely saline-alkali land is costly, time-consuming, and ineffective, and is generally not applicable. Summary of the Invention

[0004] To address the problems existing in the prior art, the present invention provides a salt and alkali tolerance enhancement gene MdLAC12 for apples and its application, wherein the nucleotide sequence of MdLAC12 is SEQ ID NO: 1 and the interference sequence listing of MdLAC12 is SEQ ID NO: 2.

[0005] This invention is achieved as follows: A method for extracting the MdLAC12 gene, which enhances the salt and alkali tolerance of apples, includes: Step 1: Extract total RNA from the roots of apple rootstock “M9-T337” and use the cDNA obtained by reverse transcription as a cloning template; Step 2: Based on the apple genome database GDDH13, design MdLAC12 primers and perform conventional polymerase chain reaction PCR. Step 3: The PCR product of MdLAC12 was homologously recombinated with pMD18-T, and the ligation product was transformed into E. coli DH5α competent cells. Resistant plaques were selected for sequencing analysis to obtain the CDs sequence of MdLAC12.

[0006] Furthermore, the CDs sequence of MdLAC12 obtained above was introduced into the pCambia2300 vector through homologous recombination, and the constructed vector was transformed into Agrobacterium for apple genetic transformation; a sequence segment of the cloned MdLAC12 sequence was inserted into the pK7GWIWG2D interference vector and transformed into Agrobacterium for apple genetic transformation.

[0007] Furthermore, leaves from GL-3 tissue culture seedlings 30 days after subculture were selected as transgenic materials, and transgenic apple lines were obtained using an Agrobacterium-mediated transformation system. The obtained resistant apple buds were then subjected to DNA and RNA level detection to screen out positive transgenic apple lines.

[0008] Furthermore, the three MdLAC12 overexpression lines, two MdLAC12 lines, and GL-3 were subcultured. After subculturing to a certain number, the lines that grew to 2.0 cm were selected for rooting culture. After culturing in rooting medium for 30 days, they were transferred to nutrient pots and grown in nutrient pots for 60 days. Then, they were subjected to salt and alkali treatment. After 60 days of treatment, relevant physiological indicators were recorded.

[0009] Another object of the present invention is to provide an extraction system for the MdLAC12 gene, which enhances the salt and alkali tolerance of apples, comprising: The reverse transcription module is used to extract total RNA from the roots of the apple rootstock “M9-T337” and use the cDNA obtained by reverse transcription as a cloning template. The chain reaction module is used to design MdLAC12 primers based on the apple genome database GDDH13 and perform conventional polymerase chain reaction PCR. The sequencing analysis module is used to perform homologous recombination between the obtained MdLAC12 PCR product and pMD18-T, transform the ligation product into E. coli DH5α competent cells, select resistant plaques for sequencing analysis, and obtain the CDs sequence of MdLAC12.

[0010] Based on the above technical solutions and the technical problems solved, the advantages and positive effects of the technical solution to be protected by this invention are as follows: Firstly, another objective of this invention is to provide the mechanism of salt-alkali tolerance in apple rootstocks, which is beneficial for selecting apple rootstocks with good salt-alkali tolerance and is of great significance for the breeding of salt-alkali resistant germplasm resources and the utilization of saline-alkali land in superior growing areas. This invention helps in the breeding of superior salt-alkali resistant apple rootstocks and can also improve the utilization of saline-alkali land in superior growing areas. This invention has the advantages of simple operation, strong salt-alkali tolerance, and low production cost, and can be widely used in the breeding process of salt-alkali resistant germplasm resources.

[0011] Second, the technical problem solved by this invention: 1. Poor salt and alkali tolerance: Traditional apple varieties are sensitive to saline-alkali environments, which can easily lead to stunted growth and exacerbate physiological disorders, affecting apple yield and quality. This limits the widespread planting of apples in saline-alkali soils and the improvement of economic benefits.

[0012] 2. Insufficient identification of gene function: There is insufficient understanding of the specific genes and regulatory mechanisms that affect the salt and alkali tolerance of apples, making it difficult to solve the salt and alkali tolerance problem through genetic improvement.

[0013] 3. Limitations of the application of genetically modified technology: The application efficiency of existing genetically modified technology in apples is low, and it has not been optimized for specific stress tolerance traits such as salt and alkali tolerance, resulting in slow progress in the development of genetically modified apple varieties.

[0014] Significant technological advancements achieved: 1. Improved salt and alkali tolerance in apples: A novel apple salt and alkali tolerance gene, MdLAC12, was cloned and functionally validated. Overexpression of this gene significantly enhanced the salt and alkali tolerance of apples. This allows apples to be grown in a wider range of soil conditions, increasing the geographical adaptability of cultivation and contributing to improved overall apple yield and economic value.

[0015] 2. Optimized genetic transformation system: A highly efficient method for apple genetic transformation was invented. By introducing the MdLAC12 gene into apples and using an Agrobacterium-mediated transformation system, the production efficiency and stability of transgenic apples were effectively improved. This improved transformation system not only provides a new genetic improvement pathway for apples but also offers a technological platform for genetic manipulation of other important agricultural traits.

[0016] 3. Enhanced biosafety and environmental adaptability: Through meticulous gene function verification and ecological adaptability assessment, the biosafety and environmental adaptability of the genetically modified apples are ensured. This genetic improvement strategy based on functional verification helps alleviate public concerns about genetically modified products and promotes the application of modern biotechnology in sustainable agricultural development.

[0017] These technological advancements have not only improved the stress resistance of apples and expanded their planting range, but also provided new methods and theoretical support for the genetic improvement of apples and other crops, and have important research and application value.

[0018] Third, the expected benefits and commercial value of the technical solution of this invention after transformation are as follows: Overexpression of MdLAC12 in apples can significantly enhance the salt and alkali tolerance of apples, while interference with MdLAC12 weakens the salt and alkali tolerance of apples. Although my country has abundant apple rootstock resources, salt- and alkali-tolerant apple rootstocks are relatively few, and apple breeding cycles are long and evaluation systems are incomplete. The technical solution of this invention can screen for apple rootstocks with strong salt and alkali tolerance at the molecular level, shorten the breeding cycle for screening salt- and alkali-resistant apple rootstocks, and greatly reduce breeding costs. Attached Figure Description

[0019] Figure 1 This is a flowchart of the method for extracting the MdLAC12 gene, which enhances the salt and alkali tolerance of apples, provided in an embodiment of the present invention.

[0020] Figure 2 This is a structural block diagram of the MdLAC12 extraction system for enhancing the salt and alkali tolerance of apples provided in an embodiment of the present invention.

[0021] Figure 3 This is a diagram showing the detection of DNA and RNA in MdLAC12 transgenic apple lines overexpressed and interfered with, provided in an embodiment of the present invention.

[0022] Figure 4 This is a diagram showing the detection of DNA and RNA in MdLAC12 transgenic apple lines overexpressed and interfered with, provided in an embodiment of the present invention.

[0023] Figure 5 This is an overexpression diagram under salt and alkali treatment provided in an embodiment of the present invention.

[0024] Figure 6 This is a statistical chart of phenotypic observation and physiological indicators of the MdLAC12 transgenic apple line and the wild 'GL-3' provided in the embodiments of the present invention. Detailed Implementation

[0025] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0026] Two specific application examples demonstrate the practical application of the MdLAC12 gene, which enhances the salt and alkali tolerance of apples: Example 1: Improving the salt and alkali tolerance of apple seedlings to adapt to high saline-alkali environments Objective: To improve the survival rate and growth performance of apple seedlings in saline-alkali soil.

[0027] 1. Gene Extraction and Cloning: Total RNA was extracted from the apple rootstock “M9-T337” and transcribed to obtain cDNA. MdLAC12 primers were designed based on the apple genome database, and the MdLAC12 gene was amplified by PCR.

[0028] 2. Gene construction: The PCR product was inserted into the pCambia2300 vector via homologous recombination, and the vector was transferred into apple seedlings using Agrobacterium-mediated transformation.

[0029] 3. Genetic transformation: Leaves of GL-3 tissue culture seedlings 30 days after subculture were selected for Agrobacterium-mediated genetic transformation.

[0030] 4. Cultivation and screening: Transgenic apple seedlings were cultured in rooting medium for 30 days and then transferred to nutrient pots for 60 days of growth.

[0031] 5. Salt and alkali tolerance test: Transgenic apple seedlings were treated in a high salt and alkali environment for 60 days, and physiological indicators such as survival rate, growth rate and chlorophyll content were measured.

[0032] Genetically modified apple seedlings exhibit stronger salt and alkali tolerance, higher growth rate, and better physiological condition than non-genetically modified apple seedlings.

[0033] Example 2: Study on the function of MdLAC12 gene in apple salt tolerance. Objective: To elucidate the role of MdLAC12 in apple salt tolerance by comparing the phenotypes of MdLAC12 overexpression lines and interference lines. 1. Gene extraction and construction: As in steps 1 and 2 of Example 1, the MdLAC12 gene was cloned and overexpression and interference vectors were constructed respectively. 2. Genetic transformation and culture: Agrobacterium was used to transfer the vector into apple seedlings, and tissue culture was carried out to screen out stable transgenic lines. 3. Growth and treatment: After all the transgenic apple seedlings grew to 2.0 cm, they were rooted and grown in nutrient pots for 60 days. 4. Salt-alkali treatment and data collection: Apple seedlings were treated under salt-alkali conditions for 60 days. Physiological responses of different transgenic lines were collected and compared, including growth data, chlorophyll content, ion loss rate, etc. Expected results: MdLAC12 overexpression lines showed stronger salt and alkali tolerance, and compared with MdLAC12 interference lines and control lines, they showed lower ion loss rate and higher chlorophyll content. These two practical examples demonstrate the potential of the MdLAC12 gene in enhancing the salt tolerance of apples and the application of its mechanistic mechanisms in research. Through these methods, researchers can gain a deeper understanding and utilize genetic modification to adapt to environmental stresses, providing scientific evidence and technical support for apple cultivation.

[0034] like Figure 1 As shown in the figure, the method for extracting the MdLAC12 gene, which enhances the salt and alkali tolerance of apples, provided in this embodiment of the invention includes the following steps: S101, total RNA was extracted from the roots of apple rootstock “M9-T337”, and cDNA obtained by reverse transcription was used as a cloning template; S102, based on the apple genome database GDDH13, designed MdLAC12 primers and performed conventional polymerase chain reaction PCR. S103, the PCR product of MdLAC12 was obtained and homologously recombinated with pMD18-T. The ligation product was transformed into E. coli DH5α competent cells, and resistant plaques were selected for sequencing analysis to obtain the CDs sequence of MdLAC12.

[0035] In this embodiment of the invention, the CDs sequence of the obtained MdLAC12 is introduced into the pCambia2300 vector (pCambia2300-35S:MdLAC12) via homologous recombination. The constructed vector is then transformed into Agrobacterium (strain EHA105, purchased by Weidi Biotechnology in March 2022) for apple genetic transformation. A 397bp segment of the MdLAC12 sequence is cloned and inserted into the pK7GWIWG2D(II) interference vector, which is then transformed into Agrobacterium (strain EHA105, purchased by Weidi Biotechnology in March 2022) for apple genetic transformation.

[0036] In this embodiment of the invention, leaves of GL-3 tissue culture seedlings 30 days after subculture were selected as transgenic material, and transgenic apple lines were obtained using an Agrobacterium-mediated transformation system. The obtained apple resistant buds were subjected to DNA and RNA level detection to screen out positive transgenic apple lines.

[0037] In this embodiment of the invention, three MdLAC12 overexpression lines, two MdLAC12 lines, and GL-3 were subcultured. After subculturing to a certain number, the lines that grew to 2.0 cm were selected for rooting culture. After culturing in rooting medium for 30 days, they were transferred to nutrient pots and grown in nutrient pots for 60 days. After growing in nutrient pots, they were subjected to salt and alkali treatment. After 60 days of treatment, relevant physiological indicators were statistically analyzed.

[0038] like Figure 2 As shown, an embodiment of the present invention provides an extraction system for the MdLAC12 gene, which enhances the salt and alkali tolerance of apples, comprising: The reverse transcription module is used to extract total RNA from the roots of the apple rootstock “M9-T337” and use the cDNA obtained by reverse transcription as a cloning template. The chain reaction module is used to design MdLAC12 primers based on the apple genome database GDDH13 and perform conventional polymerase chain reaction PCR. The sequencing analysis module is used to perform homologous recombination between the obtained MdLAC12 PCR product and pMD18-T, transform the ligation product into E. coli DH5α competent cells, select resistant plaques for sequencing analysis, and obtain the CDs sequence of MdLAC12.

[0039] This invention discloses a gene, MdLAC12, for enhancing salt and alkali tolerance in apples and its applications. The coding region sequence of the MdLAC12 gene in 'M9-T337' is shown in SEQ ID NO: 1. This invention utilizes transgenic technology driven by a strong 35S promoter to overexpress and suppress the MdLAC12 gene in apples, with the interference sequence shown in SEQ ID NO: 2, to obtain transgenic apple materials. Overexpression of MdLAC12 in apples significantly improves their salt and alkali tolerance, while suppressing MdLAC12 expression inhibits their salt and alkali tolerance. The apple gene MdLAC12 of this invention can enhance the salt and alkali tolerance of apples, providing a theoretical basis for breeding salt- and alkali-tolerant rootstocks.

[0040] Example 1: Cloning of the coding region (CDS) of MdLAC12 100 mg of leaves from 'M9-T337' tissue culture seedlings were ground into powder in liquid nitrogen and transferred to a 2 mL centrifuge tube. Total RNA was extracted using the CTAB method. The integrity of the total RNA was checked on a 2% agarose gel. Its quality was assessed using a NanoDrop2000c micro-UV spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). cDNA was synthesized using the PrimeScript RTReagent Kit and gDNA Eraser (TaKaRa Bio, Shiga, Japan). MdLAC12 primers were designed based on the apple genome database (GDDH13), and PCR amplification was performed using the obtained cDNA as a template. The PCR cloning system followed the instructions for the rapid PCR polymerase PrimeSTAR® Max DNA Polymerase (TaKaRa Bio, Shiga, Japan), with a reaction volume of 25 μL. The PCR reaction conditions were: 98℃ pre-denaturation for 10 sec, 55℃ annealing for 5 sec, 72℃ extension for 5 s / 1 kb, 35 cycles. PCR products were detected using 1% agarose gel electrophoresis. The target fragment of the expected size was recovered by gel cutting. The gel recovery procedure was based on the instructions of the Tiangen General Agarose Gel DNA Recovery Kit (DP209).

[0041] The recovered PCR product was ligated into the p-MD-18T vector. The ligation product was then transferred into 50 μL of *E. coli* DH5α competent cells and incubated at 37°C on a shaker at 200 rpm for 40 min. After brief centrifugation at 12000 rpm, the supernatant was removed, and 200 μL of the liquid was collected, mixed thoroughly, and spread onto solid LB agar plates containing ampicillin antibiotic. The plates were incubated at 37°C for 12 h. Positive clones were picked for colony PCR, plasmids were extracted, and sequencing was performed. The sequencing results were sent to a company for analysis. Figure 3 As shown.

[0042] Figure 4 Detection of DNA and RNA in MdLAC12 transgenic apple lines overexpressed and interfered with.

[0043] Example 2 Phenotypic Identification of MdLAC12 Transgenic Plants To further investigate the function of MdLAC12, the coding region sequence of MdLAC12 was inserted into the pCambia2300 overexpression vector. Simultaneously, a 397bp segment of the MdLAC12 sequence was cloned and inserted into the pK7GWIWG2D(II) interference vector. The interference sequence of MdLAC12 is shown in SEQ ID NO: 2. The vector was then transformed into Agrobacterium (strain EHA105). Specific transformation steps: 0.1-1 μg of plasmid was added to 50 μg of Agrobacterium competent cells, incubated on ice for 5 min, flash-frozen in liquid nitrogen for 5 min, incubated in a water bath at 37℃ for 5 min, and then incubated on ice for another 5 min. 600 μL of liquid LB medium was added, and the mixture was incubated at 28℃ and 200 rpm for 2-3 h. After brief centrifugation at 12000 rpm, the supernatant was removed, and 200 μL of the liquid was collected, mixed thoroughly, and spread onto solid LB agar plates containing antibiotics. After incubation at 28°C for 2-3 days, single-clone plaques were picked for detection. Positive bacterial cultures were added to an equal volume of 50% glycerol and stored at -80°C for subsequent genetic transformation experiments. The stored Agrobacterium was streaked onto LB solid medium (containing rifampin and the corresponding antibiotic for the vector) at a concentration of 50 μg / ml and incubated at 28°C.

[0044] (1) Select tender leaves with uniform growth at the top of wild-type 'GL-3' apple tissue culture seedlings (grown in culture medium for 25 days) that are in good condition. (2) Collect 35S:MdLAC12-GFP cells, suspend the cells in the prepared infection solution, pour the bacterial solution into a petri dish, transfer the leaves to the bacterial solution, gently make wounds with a scalpel, and soak for 8-10 minutes. (3) Place the infected leaves on sterile filter paper to remove excess bacterial solution, and then transfer them to a culture medium without antibiotics for co-culture in the dark for 1-3 days. (4) Transfer the leaves to a differentiation medium containing cephalosporin (250 mg / L) and kanamycin (50 μg / L), culture in the dark for one week, and then transfer them to light culture, changing the culture medium every 10 days. (5) Transfer the new shoots differentiated on the culture medium to a new culture medium for growth and propagation. (6) The plants induced by differentiation culture were subjected to DNA and RNA level detection to obtain stable transgenic apple seedlings.

[0045] The test results of the apple MdLAC12 transgenic line are as follows: Figure 5 As shown, three MdLAC12 overexpression lines and two MdLAC12 interference lines were obtained. Figure 5 DNA level identification was performed on wild-type and MdLAC12-overexpressing apple transgenic lines. An insertion of the 35S:MdLAC12 fragment was found in the genome of the MdLAC12-overexpressing apple transgenic lines. Figure 5B identified MdLAC12 overexpression and interference lines in apples at the RNA level. The results showed that the expression level of MdLAC12 in the overexpression lines was 12-15 times that of the wild-type 'GL-3', while in the MdLAC12 interference transgenic apple lines, the expression level of MdLAC12 decreased by 10%-20% compared with the wild type.

[0046] Three MdLAC12 overexpression lines, two MdLAC12 lines, and the wild-type 'GL-3' were subcultured. The subculture medium consisted of 4.43 g M powder, 30 g sucrose, 7.8 g agar, 0.2 mg 6-BA, and 0.2 mg IBA per liter. After subculturing to a certain number, plants reaching 2.0 cm in height were selected for rooting culture. The rooting medium consisted of 2.215 g M powder, 20 g sucrose, 8 g agar, and 1 mg IBA per liter. After 30 days of rooting, the plants were transferred to seedling pots and grown for 60 days. Then, a 300 mM compound saline-alkali treatment (NaCl:NaHCO3 1:1 molar ratio) was applied. After 60 days of treatment, photographs were taken, and the survival rate, relative water content of leaves, and malondialdehyde (MDA) content were statistically analyzed. Relative water content (RWC) was determined by measuring the relative water content of mature, healthy leaves in the middle of the branches after stress treatment. Relative moisture content: RWC (%) = [(FW - DW) / (TW - DW)] × 100%, FW: fresh weight of leaves, TW: weight of leaves after recovering water absorption in a 4℃ refrigerator for 24 h, DW: weight of the above leaves after drying in a 65℃ oven for 48 h. Malondialdehyde (MDA) determination: Refer to the MDA-2-Y malondialdehyde (MDA) test kit instructions (Suzhou Keming Biotechnology Co., Ltd.).

[0047] The obtained phenotypic and physiological data of the three MdLAC12 overexpression lines and GL-3 salt-alkali treatment were measured as follows: Figure 5 and Figure 6 As shown. From Figure 5 and Figure 6 It can be seen that MdLAC12 positively regulates the salt and alkali tolerance of apples. Overexpression of MdLAC12 in wild-type 'GL-3' under salt and alkali treatment can enhance the salt and alkali tolerance of apples. By measuring the survival rates of apple lines overexpressing MdLAC12, apple lines with interference with MdLAC12, and wild-type 'GL-3' after salt and alkali treatment, it can be concluded that overexpression of MdLAC12 increases the survival rate of apples, while the survival rate of transgenic apple lines with interference with MdLAC12 is significantly reduced under salt and alkali treatment compared with wild type. Figure 5B, 6B). Relative leaf water content reflects the water loss of plants under salt-alkali stress and is an important indicator of salt-alkali tolerance. Lower relative water content indicates more severe salt-alkali stress. Measurements of the relative leaf water content of wild-type 'GL-3' and transgenic apple lines after salt-alkali treatment revealed that the relative leaf water content of MdLAC12-expressing transgenic apples was significantly higher than that of wild-type, while the relative leaf water content of MdLAC12-interfered transgenic apples was significantly lower than that of wild-type. Figure 5 C, 6C). Furthermore, the malondialdehyde (MDA) content in wild-type and overexpression lines under saline-alkali treatment was determined. The results showed that the MDA accumulation in the overexpressing MdLAC12 apple transgenic lines was significantly lower than that in the wild-type 'GL-3', while the MDA content in the interference lines was significantly higher than that in the wild-type (C, 6C). Figure 5 (D, 6D) further demonstrates that MdLAC12 can positively regulate the salt and alkali tolerance of apples. In summary, MdLAC12 enhances the salt and alkali tolerance of apples.

[0048] MdLAC12 Nucleic Acid Sequence Listing SEQ ID NO: 1 MdLAC12 interference sequence listing SEQ ID NO: 2 TCTTGAGGCAGGCGACTATGACAGGAGCAGCTCCAAATGTTTCTGATGCATACACCATCAATGGTCAACCTGGCGATCTTTACAACTGCTCAAGCCAAGACACTGTCATAGTTCCTATAGACTCCGGCGAGACCAACCTTCTTAGAGTCATCAACGCTGCACTCAACCAACCTCTTTTCTTCTCCGTGG CCAACCACAAGCTCACCGTTGTTAGTGCTGATGCCTCCTACACCAAACCTTTCACTACCACGGTTCTCATGCTAGGGCCTGGGCAGACCACTGATGTTTTAATCACCGGTGACCAGTCACCAGCCCGGTACTACTTGGCGGCGAGTGCTTATTTCAGCGCGCAAAATGCAGCATTCGACAACACCACCAC The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any modifications, equivalent substitutions, and improvements made by those skilled in the art within the scope of the technology disclosed in the present invention, and within the spirit and principles of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. An application of the MdLAC12 gene to enhance the salt and alkali tolerance of apples, characterized in that, The nucleotide sequence of the MdLAC12 gene is shown in SEQ ID NO:

1.

2. The application of the MdLAC12 gene to enhance the salt and alkali tolerance of apples as described in claim 1, characterized in that, The interference sequence of the MdLAC12 gene is shown in SEQ ID NO:

2.

3. A method for extracting the MdLAC12 gene that enhances the salt and alkali tolerance of apples, characterized in that, Includes the following steps: Step 1: Extract total RNA from the roots of apple rootstock "M9-T337" and use the cDNA obtained by reverse transcription as a cloning template; Step 2: Based on the apple genome database GDDH13, design MdLAC12 primers and perform conventional polymerase chain reaction PCR. Step 3: The PCR product of MdLAC12 was homologously recombinated with pMD18-T, and the ligation product was transformed into E. coli DH5α competent cells. Resistant plaques were selected for sequencing analysis to obtain the CDs sequence of MdLAC12.

4. The method for extracting the MdLAC12 gene that enhances the salt and alkali tolerance of apples as described in claim 3, characterized in that, The obtained CDs sequence of MdLAC12 was introduced into the pCambia2300 vector through homologous recombination. The constructed vector was then transformed into Agrobacterium for apple genetic transformation. A segment of the cloned MdLAC12 sequence was inserted into the pK7GWIWG2D interference vector and transformed into Agrobacterium for apple genetic transformation.

5. The method for extracting the MdLAC12 gene that enhances the salt and alkali tolerance of apples as described in claim 3, characterized in that, Leaves from GL-3 tissue culture seedlings 30 days after subculture were selected as transgenic materials, and transgenic apple lines were obtained using an Agrobacterium-mediated transformation system. DNA and RNA levels of resistant apple buds were detected to screen for positive transgenic apple lines.

6. The method for extracting the MdLAC12 gene that enhances the salt and alkali tolerance of apples as described in claim 3, characterized in that, Three MdLAC12 overexpressing lines, two MdLAC12 interference lines, and GL-3 were subcultured. After subculturing to a certain number, plants that grew to 2.0 cm were selected for rooting culture. After culturing in rooting medium for 30 days, they were transferred to nutrient pots and grown for 60 days. Then, they were subjected to salt-alkali treatment. After 60 days of treatment, relevant physiological indicators were recorded.

7. A system for implementing the method of extracting the MdLAC12 gene that enhances the salt and alkali tolerance of apples as described in any one of claims 3-6, characterized in that, The system includes: The reverse transcription module is used to extract total RNA from the roots of the apple rootstock "M9-T337" and use the cDNA obtained by reverse transcription as a cloning template. The chain reaction module is used to design MdLAC12 primers based on the apple genome database GDDH13 for routine polymerase chain reaction PCR. The sequencing analysis module is used to perform homologous recombination between the PCR product of MdLAC12 and pMD18-T, transform the ligation product into E. coli DH5α competent cells, and select resistant plaques for sequencing analysis to obtain the CDs sequence of MdLAC12.