Application of primer group of molecular marker in identification of pig backfat thickness and / or lean meat percentage

By using a primer set based on molecular markers to perform PCR amplification and sequencing at specific sites in the pig DUSP1 gene, the problem of identifying backfat thickness and lean meat percentage in pigs using traditional breeding methods has been solved. This enables precise breeding and genetic improvement of pigs, thereby enhancing the economic benefits of the livestock industry.

CN122012748AActive Publication Date: 2026-05-12JILIN ACAD OF AGRI SCI
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202610466289.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-10
Publication Date
2026-05-12
Estimated Expiration
2046-04-10

AI Technical Summary

Technical Problem

Traditional breeding methods are insufficient to meet the modern livestock industry's demand for pork products with high lean meat percentage. Especially in the context of frequent diseases and climate change, the lack of scientific means to optimize pig breeding programs makes it difficult to achieve precise matching and improved environmental adaptability.

Method used

Using a molecular marker primer set, specifically targeting the SNP site at 21 bp of exon 4 of the porcine DUSP1 gene, PCR amplification and sequencing analysis were performed to identify backfat thickness and lean meat percentage in pigs, providing a simple and stable detection system.

Benefits of technology

This enabled precise early breeding of pigs, significantly improving the lean meat percentage and backfat thickness, thereby enhancing the economic benefits and market competitiveness of pig farming.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012748A_ABST
    Figure CN122012748A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of genetic breeding, in particular to application of a molecular marker primer group to identification of pig backfat thickness and / or lean meat percentage, the site of an SNP molecular marker is located at the 21bp position of the fourth exon of a pig DUSP1 gene with the gene version number of ENSSSCT00085019601.1, and nucleotide at the site is G or A; the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO. 3; the nucleotide sequence of an upstream primer of the primer group is as shown in SEQ ID NO.1, and the nucleotide sequence of a downstream primer of the primer group is as shown in SEQ ID NO.2. By detecting the genotype of the SNP site, the backfat thickness and the lean meat percentage of the pig can be effectively identified, a rapid and accurate molecular assisted breeding tool is provided for early breeding of the pig, and the improvement of the lean meat percentage and the optimization of the carcass quality are facilitated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic breeding technology, specifically to the application of a molecular marker primer set in identifying backfat thickness and / or lean meat percentage in pigs. Background Technology

[0002] With changing market demands and increasing complexity in the farming environment, traditional breeding methods are no longer sufficient to meet the needs of modern animal husbandry. Especially against the backdrop of frequent diseases, climate change, and consumers' ever-increasing demands for pork quality, optimizing pig breeding programs through scientific means, and systematically improving the genetics, precise mating, and environmental adaptability of pig herds have become crucial for enhancing industry competitiveness.

[0003] In the current consumer market, consumers prefer pork products with a high lean meat percentage. Selecting pig breeds with thin backfat is of significant production importance because backfat thickness is negatively correlated with lean meat percentage; thinner backfat means a higher lean meat percentage, resulting in more lean meat products that meet market demand, thus effectively improving the economic benefits of pig farming. Using backfat thickness as one of the core breeding traits has a clear market orientation.

[0004] Therefore, in order to further improve pork quality, it is urgent to develop a new technology that can accurately identify and screen the genetic potential related to backfat thickness and lean meat percentage at an early stage. This is of great significance for accelerating the genetic improvement process and achieving precise breeding. Summary of the Invention

[0005] To address the above problems, this invention provides an application of a molecular marker primer set in identifying backfat thickness and / or lean meat percentage in pigs.

[0006] This invention is achieved through the following technical solution: Application of a primer set of a molecular marker in identifying backfat thickness and / or lean meat percentage in pigs, wherein the SNP molecular marker is located at a site in pig gene version number ENSSSCT00085019601.1. DUSP1 At the 21 bp of exon 4 of the gene, the nucleotide at this site is G or A; the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO. 3.

[0007] The nucleotide sequence of the upstream primer of the primer set is shown in SEQ ID NO. 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 2.

[0008] SEQ ID NO. 3: The sequence GGTGGCCCAGTGGAGATCCTGCCCTTTCTCTACCTGGGGAGTGCCTACCATGCTTCTCGCAAGGACATGCTGGATGCCTTGGGTATCACTGCCTTGATCAACGTCTCGGCCAACTGTCCCAACCATTTTGAGGGTCACTACCAGTACAAGAGCATCCCCGTTGAGGACAACCACAAGGCGGACATCAGCTCCTGGTTCAATGAGGCAATCGATTTCATCG has a 5′→3′ orientation. A G / A mutation exists at the 21st bp starting from the 5′ end, resulting in three genotypes: GG, GA, or AA.

[0009] Preferably, it includes the following steps: The aforementioned primer set was used to perform PCR amplification on a pig DNA template to obtain PCR products.

[0010] The PCR products were subjected to agarose gel electrophoresis and sequencing to determine the pig... DUSP1 Genotype at position 21bp of exon 4 of the gene.

[0011] Individuals with the GA genotype have a lower back fat thickness than individuals with the GG or AA genotypes, and / or a higher lean meat percentage than individuals with the GG or AA genotypes.

[0012] Preferably, the PCR amplification reaction system is as follows: 10 μL of 2xTaq MasterMix, 1.2 μL of DNA, 0.4 μL of upstream primer, 0.4 μL of downstream primer, and ddH2O added to a final volume of 20 μL.

[0013] Preferably, the concentrations of both the upstream and downstream primers are 10 μmol / L.

[0014] Preferably, the PCR amplification reaction program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, annealing at 55.8℃ for 30 s, extension at 72℃ for 35 s, for a total of 30 cycles; 72℃ extension for 5 min; storage at 4℃.

[0015] The application of the primer set in pig breeding.

[0016] Preferably, it includes the following steps: The aforementioned primer set was used to perform PCR amplification on a pig DNA template to obtain PCR products.

[0017] The PCR products were sequenced or analyzed by gel electrophoresis to determine the pig... DUSP1 Genotype at position 21bp of exon 4 of the gene.

[0018] Individuals with the GA genotype were selected as parents for breeding.

[0019] Preferably, the pig is a Duroc pig.

[0020] Compared with the prior art, the present invention has the following beneficial effects: This invention provides an application of a primer set of molecular markers in identifying backfat thickness and / or lean meat percentage in pigs, wherein the SNP molecular marker site is located in pig gene version number ENSSSCT00085019601.1. DUSP1 At the 21 bp of exon 4 of the gene, the nucleotide at this site is either G or A; the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO. 3; the nucleotide sequence of the upstream primer of the primer set is shown in SEQ ID NO. 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 2. This invention discloses for the first time the nucleotide sequence of the pig SNP molecular marker. DUSP1 A significant association was found between the G / A SNP locus at exon 4, 21 bp, and backfat thickness and lean meat percentage in pigs. This invention provides a molecular marker and its dedicated primer set for identifying backfat thickness and / or lean meat percentage in pigs. PCR amplification and sequencing analysis of pig genomic DNA using the primer set provided in this invention can accurately and rapidly determine the genotype of this SNP locus. Experimental results show that individuals with the GA genotype in this population exhibit significantly lower backfat thickness and significantly higher lean meat percentage, demonstrating superior carcass traits. This invention not only provides a new molecular marker resource for the genetic improvement of pigs but also establishes a simple and stable detection system, enabling precise selection of pigs at an early stage, effectively accelerating the breeding process, and significantly improving the economic benefits of pig farming and the market competitiveness of pork products. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 For the present invention Duroc DUSP1 The results of sequence alignment of exon 4 of the gene.

[0023] Figure 2 For the present invention Duroc DUSP1 Sequencing diagram of the GG genotype on exon 4 of the gene.

[0024] Figure 3 For the present invention Duroc DUSP1 Sequencing diagram of the AA genotype on exon 4 of the gene.

[0025] Figure 4 For the present invention Duroc DUSP1 Sequencing diagram of the GA genotype on exon 4 of the gene. Detailed Implementation

[0026] To facilitate understanding of the present invention, a more comprehensive description is provided below, along with preferred embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0027] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this invention and in its specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0028] The beneficial effects of the present invention will be illustrated below through specific embodiments.

[0029] Example 1 1. Materials and Methods 1.1 Sample Collection 236 healthy Duroc pigs of similar weight were selected from the pig farm of the Jilin Academy of Agricultural Sciences. Ear tissues the size of soybeans were collected using punch forceps, placed in 1.5 mL centrifuge tubes containing 75% ethanol, labeled with ear number and date, and brought back to the laboratory for storage at 4°C for later use.

[0030] 1.2 Genomic DNA Extraction Take 30mg of Duroc pig ear tissue, cut it into small pieces, and use a tissue genomic DNA extraction kit (purchased from TIANGEN, catalog number DP304) to extract DNA from the ear tissue according to the instructions. Detect the concentration and purity of the DNA using an ultra-micro spectrophotometer and store at -80℃.

[0031] 1.3 Primer Design and Synthesis pig DUSP1 The marker of the 4th exon of the gene is DUSP1 -4, according to Ensemble DUSP1 Primers were designed based on the nucleotide sequence of -4, and the primer sequence information is shown in Table 1. The sequences were synthesized by Suzhou Genewiz Biotechnology Co., Ltd. DUSP1 The gene version number is ENSSSCT00085019601.1.

[0032] Table 1 DUSP1 -4 Primer sequence

[0033] 1.4 PCR Amplification PCR reaction system: 10 μL of 2xTaq MasterMix, 1.2 μL of DNA, 0.4 μL of 10 μmol / L upstream primer, 0.4 μL of 10 μmol / L downstream primer, and ddH2O to a final volume of 20 μL.

[0034] PCR reaction procedure: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, annealing at 55.8℃ for 30 s, extension at 72℃ for 35 s, for a total of 30 cycles; 72℃ extension for 5 min; storage at 4℃. After the PCR products were confirmed to be correct by agarose gel electrophoresis, they were sent to Suzhou Genewiz Biotechnology Co., Ltd. for Sanger sequencing.

[0035] 1.5 DUSP1 Gene polymorphism testing DNAMAN software was used to study Duroc pigs. DUSP1 -4 Sanger sequencing results were compared with nucleotide sequences to find mutation sites. Chromas software was used to analyze the sequencing peak diagram to determine the specific genotype.

[0036] 2. Results 2.1 Analysis of PCR product sequencing results Through Danman DUSP1 -4 The sequencing results of the PCR products were compared with the pig genomic DNA sequence published by Ensemble, and the results are as follows: Figure 1 As shown. DUSP1 A G / A SNP mutation exists at the 21st base of nucleotide -4. Chromas analysis revealed that this site exhibits three genotypes: GG, AA, and GA. Figures 2-4 As shown.

[0037] 2.2 Duroc DUSP1 Genetic analysis of SNP loci 2.2.1 Genotype frequency and gene frequency Duroc DUSP1 The genotype frequencies, gene frequency calculations, and chi-square fitness test results for the G / A loci are shown in Table 2. The GA genotype was the most abundant and was the dominant genotype; G was the dominant gene. The chi-square fitness test indicated that the gene distribution at the G / A loci in Duroc pigs conformed to Hardy-Weinberg equilibrium. P >0.05.

[0038] Table 2 Duroc DUSP1 -4 genotype frequency and gene frequency

[0039] Note: " / " indicates that this item is not present.

[0040] 2.2.2 Population genetic diversity DUSP1 Table 3 shows the Ho, He, Ne, and PIC SNP sites of -4 in the population. SNP site He is at a moderate level; Ne is close to 2, indicating that these alleles are evenly distributed in the population; PIC shows moderate polymorphism, 0.25 < PIC < 0.5.

[0041] Table 3 Duroc DUSP1 -4 Genetic diversity of SNP loci

[0042] 2.3 DUSP1 Association analysis of gene SNP sites with growth performance and carcass traits DUSP1 -4 Association analysis of SNP loci with Duroc pig growth performance data including average daily feed intake, average daily weight gain, feed conversion ratio, and live backfat thickness and live lean meat percentage, as shown in Table 4. The GG, AA, and GA genotypes showed no significant correlation with average daily feed intake, average daily weight gain, or feed conversion ratio, but were significantly correlated with live backfat thickness and live lean meat percentage. Compared to the GG and AA genotypes, individuals with the GA genotype had the lowest backfat thickness, significantly lower than those with the AA genotype, and the highest lean meat percentage, significantly higher than those with the AA genotype, but no significant difference compared to individuals with the GG genotype.

[0043] Table 4 Duroc DUSP1 Association analysis of gene SNP sites with growth performance and carcass traits

[0044] Note: Different lowercase letters indicate significant differences. P <0.05, where the same letter indicates no significant difference. P >0.05.

[0045] The test results show that DUSP1 -4 SNP loci were not significantly correlated with the growth performance of Duroc pigs, but were significantly correlated with the carcass traits of live backfat thickness and live lean meat percentage. Among them, the GA genotype had the best individual traits, with thin backfat and high lean meat percentage, followed by the GG genotype, and the AA genotype had the worst traits.

[0046] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0047] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. Those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this invention should be determined by the appended claims.

Claims

1. The application of a molecular marker primer set in identifying backfat thickness and / or lean meat percentage in pigs, characterized in that, The SNP molecular marker is located in pigs with gene version number ENSSSCT00085019601.

1. DUSP1 At the 21st bp of exon 4 of the gene, the nucleotide at this site is either G or A; the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO. 3; The nucleotide sequence of the upstream primer of the primer set is shown in SEQ ID NO. 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, Includes the following steps: The primer set described in claim 1 was used to perform PCR amplification on a pig DNA template to obtain PCR products; The PCR products were subjected to agarose gel electrophoresis and sequencing to determine the pig... DUSP1 Genotype at position 21bp of exon 4 of a gene; Individuals with the GA genotype have a lower back fat thickness than individuals with the GG or AA genotypes, and / or a higher lean meat percentage than individuals with the GG or AA genotypes.

3. The application according to claim 2, characterized in that, The PCR amplification reaction system was as follows: 10 μL of 2xTaq MasterMix, 1.2 μL of DNA, 0.4 μL of upstream primer, 0.4 μL of downstream primer, and ddH2O added to a final volume of 20 μL.

4. The application according to claim 3, characterized in that, The concentrations of both the upstream and downstream primers were 10 μmol / L.

5. The application according to claim 2, characterized in that, The PCR amplification reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, annealing at 55.8℃ for 30 s, extension at 72℃ for 35 s, for a total of 30 cycles; extension at 72℃ for 5 min; storage at 4℃.

6. The application of the primer set according to claim 1 in the breeding of pigs.

7. The application according to claim 6, characterized in that, Includes the following steps: The primer set described in claim 1 was used to perform PCR amplification on a pig DNA template to obtain PCR products; The PCR products were sequenced or analyzed by gel electrophoresis to determine the pig... DUSP1 Genotype at position 21bp of exon 4 of a gene; Individuals with the GA genotype were selected as parents for breeding.

8. The application according to claim 1, characterized in that, The pig in question is a Duroc pig.