Primer combination for identifying hardness of apple fruits, product and application thereof
By designing specific primer combinations and conducting two rounds of PCR verification, the false positive problem in apple fruit firmness identification was solved, enabling accurate identification of fruit firmness and supporting precise genetic improvement in apple breeding.
Patent Information
- Application Number
- CN202610443089.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-07
- Publication Date
- 2026-05-12
AI Technical Summary
In existing technologies, it is difficult to accurately predict the phenotypic trait of apple fruit firmness using a single genetic locus, and ordinary PCR molecular markers are prone to false positives, resulting in inaccurate fruit firmness identification and limiting the precision of apple breeding.
A specific primer pair was designed, including a first primer pair and a second primer pair. The results were verified by two rounds of PCR. The first primer pair was used for preliminary amplification, and the second primer pair was used to verify the variant sites. The genotype was determined by combining the results of the two rounds to ensure the accuracy of identification.
It improves the accuracy of apple fruit firmness assessment, provides a better tool for assessing the quality of hybrid offspring, and supports precise genetic improvement in the apple breeding process.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of germplasm resources and F1 population identification technology, and in particular to primer combinations, products and applications for identifying apple fruit firmness. Background Technology
[0002] Fruit texture, primarily encompassing firmness, crispness, and juiciness, is a key indicator for evaluating fruit quality, directly impacting consumer purchasing intentions and market competitiveness. Higher fruit firmness helps maintain a good commercial appearance and storability, while excessively low firmness or overly softened fruit makes it susceptible to pathogen infection, significantly shortening shelf life and reducing economic value. In apple breeding, firmness at maturity is one of the five key traits, closely related to the decline in firmness during fruit maturity and post-harvest storage, and is a complex quantitative trait regulated by multiple genes. Currently, fruit texture quality has become a focus of modern apple breeding and industry research. In-depth elucidation of the genetic molecular mechanisms underlying apple fruit firmness formation, and the discovery and utilization of key genes and functional genetic loci, have significant theoretical and applied value for guiding hybridization breeding practices, cultivating high-quality fruits, and promoting industrial quality improvement and efficiency enhancement.
[0003] As a typical climacteric fruit, apple ripening and softening research has long revolved around the hormone ethylene. Two key rate-limiting enzymes in ethylene biosynthesis—ACS synthase and ACC oxidase—directly regulate its biosynthesis. In breeding practice, firmness-related molecular markers such as MdACS1 (166bp) and MdACO1 (66bp) are often used to select for ideal fruit texture. However, although these markers are closely related to ethylene synthesis, they typically only explain limited phenotypic variation in the firmness phenotype, thus significantly limiting their application in marker-assisted breeding. Besides hormonal pathways, the degradation and structural disruption of cell wall components reduce intercellular adhesion and are closely linked to the fruit softening process. This typically involves the metabolism of cell wall polysaccharides (pectin, cellulose, hemicellulose), the regulation of related cell wall degrading enzymes (polygalacturonase PG, pectin lyase PL, cellulase, etc.), and the synergistic effect of non-enzymatic expansin (EXP).
[0004] Fruit firmness at maturity is closely linked to maturity and postharvest storage characteristics. Currently known molecular markers such as MdACS1, MdACO1, MdPG1, MdEXP7, and MdERF4 are all significantly associated with fruit firmness at maturity, primarily involving the ethylene synthesis pathway. Since fruit firmness is regulated by multiple genes, a single genetic locus cannot accurately predict phenotypic traits; therefore, it is still necessary to explore more major genes and functional genetic variations. With the development of high-throughput sequencing, abundant high-quality genomes have been constructed. Many studies have shown that structural variations (SVs) largely contribute to diverse phenotypic variations. Therefore, next-generation high-throughput sequencing strategies should be utilized to identify genetic variations more closely related to fruit firmness at maturity. Identifying key genetic loci and variations specifically associated with fruit firmness, aiming to separate them from complex ethylene synthesis pathways, and developing primer pairs capable of accurate identification will enable precise genetic improvement of this trait. Summary of the Invention
[0005] The purpose of this invention is to provide primer combinations, products, and applications for identifying the firmness of apple fruits, in order to solve the problems existing in the prior art.
[0006] To achieve the above objectives, the present invention provides the following solution: The present invention provides a primer combination for identifying the firmness of apple fruit, the primer combination comprising a first primer pair and a second primer pair; The first primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.2; The second primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.4.
[0007] This invention provides the application of the above-described primer combination in the preparation of products for identifying the firmness of apple fruits.
[0008] Optionally, the product includes reagents, reagent kits, and chips.
[0009] The present invention provides a product for identifying fruit firmness, the product comprising the primer combination described above.
[0010] Optionally, the product includes reagents, reagent kits, and chips.
[0011] This invention provides the application of the above-described primer combinations or the above-described products in determining the firmness of apple fruits.
[0012] This invention provides a method for determining the firmness of apple fruit. Using the DNA of the apple to be tested as a template, PCR amplification is performed using the first primer pair in the above-mentioned primer combination, and PCR amplification is performed using the second primer pair in the above-mentioned primer combination. The firmness of the apple fruit is determined based on the results of the two PCR amplifications.
[0013] Optionally, if a specific band appears at 1013 bp in the first-round PCR product and no band appears in the second-round amplification product, it can be defined as a homozygous deletion genotype, which can be identified as a high-firm apple fruit; if a specific band appears at 2179 bp in the first-round PCR product and a specific band appears at 955 bp in the second-round amplification product, it can be defined as a homozygous insertion genotype, which can be identified as a low-firm apple fruit.
[0014] Optionally, the PCR amplification reaction system consists of 5 μL of 2×PCR polymerase mixture, 3 μL of sterile water, 0.5 μL of upstream primer, 0.5 μL of downstream primer, and 1 μL of template.
[0015] Optionally, the PCR amplification program is as follows: 94℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds; 60℃ annealing for 30 seconds; 72℃ extension for 1-2 minutes, for a total of 35 cycles, and a final extension at 72℃ for 10 minutes.
[0016] The present invention discloses the following technical effects: Conventional PCR molecular marker validation procedures are prone to false positives. When a sample has a heterozygous genotype, low-fragment bands are easily amplified during PCR validation, making it difficult to determine the true genotype. This invention designs specific primers (first primer pair) for conventional PCR validation of samples. The results showed that almost all 40 F1 progeny strains with extremely high and low genotypes only amplified small bands, inconsistent with the expected results from parental genetics. Therefore, this invention innovatively designs a second primer pair. The upstream identification primer in the second primer pair is placed before the del-1166 mutation site, and the downstream primer is placed in the middle of the del-1166 mutation site. The presence of the mutation site is determined by whether the PCR product of the second primer pair shows the target band. If no band appears in the second round of PCR amplification, the site is considered a homozygous deletion genotype in the progeny genome; if the target band appears in the second round of PCR amplification, the site is considered a heterozygous genotype in the progeny genome. Therefore, this invention innovatively proposes a dual PCR verification method using two pairs of primers to jointly confirm the accurate genotype of the test sample. This discovery improves the accuracy of the primer combination verification provided by this invention. In addition, the primer combination provided by this invention has good application prospects in quality-assisted breeding of apple hybrid offspring and also provides a reference for similar genetic variations.
[0017] This invention also provides a method for identifying apple fruit firmness. This method, through an optimized two-round PCR reaction, can efficiently and accurately identify the target genotype of hybrid progeny, providing a new tool for molecular marker-assisted breeding of apple fruit texture. Moreover, the method provided by this invention is innovative and of reference value, and is more conducive to its application in the identification of firmness quality in hybrid offspring during apple assisted breeding. Detailed Implementation
[0018] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0019] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0020] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0021] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This specification and embodiments are merely exemplary.
[0022] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0023] All 'Fuji' and 'Pink Lady' F1 offspring sample materials in the following examples were obtained from the Baishui Apple Test Station, and the applicant has committed to distributing them to the public for 20 years from the date of application.
[0024] Example 1: Primer pair design This embodiment designs a primer pair based on the apple MD16G1070600 gene (NCBI accession number CP168780.1, chromosome 16, positions 4955055 to 4956221). The primer pair includes a first primer pair and a second primer pair, with the following sequences: The upstream sequence of the first primer pair is: TTATTCATGCACATTCAGTTATGCA (SEQ ID NO.1), and the downstream sequence of the first primer pair is: CTGCACACATAAGTAAAACCATTCA (SEQ ID NO.2). The upstream primer of the second primer pair is GTAAGTAAGGGCTTTTCGGAGTG (SEQ ID NO.3), and the downstream primer of the second primer pair is TGTTATTATTATGTGTTGTTTG (SEQ ID NO.4).
[0025] Example 2: Application of primer pairs (1) The high-hardness variety 'Pink Lady' and the low-hardness variety 'Fuji' were used as parents to cross and obtain hybrid F1 offspring, which were then grafted onto M26 rootstock.
[0026] (2) The firmness of F1 offspring apple trees was measured during the fruit ripening period.
[0027] (3) Use the Tiangen polysaccharide polyphenol DNA extraction kit to extract the DNA from the leaves of the offspring screened in step (2), and at the same time extract the DNA from the leaves of the parents 'Pink Lady' and 'Fuji'.
[0028] (4) The primer combination designed in Example 1 was used to perform two rounds of ordinary PCR amplification reaction on the parents and the offspring screened in step (2). The separation and analysis were performed in 1.5% agarose gel to obtain the genotype data of the parents and the hybrid population. The results of the first round of PCR amplification are shown in Table 1, and the results of the second round of PCR amplification are shown in Table 2.
[0029] The first round of PCR amplification reaction system is as follows: the amplification system is 10 μL in total, specifically: 5 μL of 2×PCR polymerase mixture, 3 μL of sterile water, 0.5 μL of the upstream primer of the first primer pair of 10 μM, 0.5 μL of the downstream primer of the first primer pair of 10 μM, and 1 μL of 50-100 ng / μL DNA sample template (DNA obtained in step (3)); The first round of PCR amplification reaction program is as follows: 94℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds; 60℃ annealing for 30 seconds; 72℃ extension for 2 minutes, for a total of 35 cycles, and 72℃ final extension for 10 minutes. The second round of PCR amplification reaction system is as follows: the amplification system is 10 μL in total, specifically: 5 μL of 2×PCR polymerase mixture, 3 μL of sterile water, 0.5 μL of the upstream primer of the 10 μM second primer pair, 0.5 μL of the downstream primer of the 10 μM second primer pair, and 1 μL of 50-100 ng / μL DNA sample template (DNA obtained in step (3)); the second round of PCR amplification reaction program is as follows: 94℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds; 60℃ annealing for 30 seconds; 72℃ extension for 1 minute, for a total of 35 cycles, and 72℃ final extension for 10 minutes.
[0030] Table 1 Results of the first round of PCR amplification Table 2 Results of the second round of PCR amplification (5) Since heterozygous progeny are prone to false positives in the first round of PCR, a second round of PCR verification was performed using downstream primers for the variant site and upstream primers from the first round. The results of the second round of PCR analysis were combined with those of the first round of PCR analysis to jointly determine the genotype of the extreme progeny. The results were as follows: when a specific band appeared at 1013 bp in the first round of PCR amplification product and no band appeared in the second round of amplification product, it could be defined as a homozygous deletion genotype and could be identified as a high-hardness progeny; when a specific band appeared at 2179 bp in the first round of PCR amplification product and a 955 bp band appeared in the second round of amplification product, it could be defined as a homozygous insertion genotype and could be identified as a low-hardness progeny. The detection results are shown in Tables 1 and 2. The results show that when a specific band appeared at 1013 bp in the first round of PCR amplification product and no band appeared in the second round of amplification product, it could be defined as a homozygous deletion genotype and was indeed a high-hardness progeny. This proves the effectiveness of the primer pairs provided by this invention.
[0031] Example 3: Application of primer pairs (1) Using 'Ruiyang' and 'Yimei' as parents, hybridization was carried out to obtain hybrid F1 offspring, which were then grafted onto M26 rootstock.
[0032] (2) The firmness of F1 offspring apple trees was measured during the fruit ripening period.
[0033] (3) Use the Tiangen polysaccharide polyphenol DNA extraction kit to extract the leaf DNA of the offspring selected in step (2), and at the same time extract the leaf DNA of the parents 'Ruiyang' and 'Yimei'.
[0034] (4) The primer combination designed in Example 1 was used to perform two rounds of conventional PCR amplification reactions on the parents and the offspring in step (2). The separation and analysis were performed in 1.5% agarose gel to obtain the genotype data of the parents and the hybrid population. The results of the first round of PCR amplification are shown in Table 3, and the results of the second round of PCR amplification are shown in Table 4.
[0035] The first round of PCR amplification reaction system is as follows: the amplification system is 10 μL in total, specifically: 5 μL of 2×PCR polymerase mixture, 3 μL of sterile water, 0.5 μL of the upstream primer of the first primer pair of 10 μM, 0.5 μL of the downstream primer of the first primer pair of 10 μM, and 1 μL of 50-100 ng / μL DNA sample template (DNA obtained in step (3)); The first round of PCR amplification reaction program is as follows: 94℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds; 60℃ annealing for 30 seconds; 72℃ extension for 2 minutes, for a total of 35 cycles, and 72℃ final extension for 10 minutes. The second round of PCR amplification reaction system is as follows: the amplification system is 10 μL in total, specifically: 5 μL of 2×PCR polymerase mixture, 3 μL of sterile water, 0.5 μL of the upstream primer of the 10 μM second primer pair, 0.5 μL of the downstream primer of the 10 μM second primer pair, and 1 μL of 50-100 ng / μL DNA sample template (DNA obtained in step (3)); the second round of PCR amplification reaction program is as follows: 94℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds; 60℃ annealing for 30 seconds; 72℃ extension for 1 minute, for a total of 35 cycles, and 72℃ final extension for 10 minutes.
[0036] Table 3 Results of the first round of PCR amplification Table 4 Results of the second round of PCR amplification (5) Since heterozygous progeny are prone to false positives in the first round of PCR reaction, downstream primers for the variant site were designed and used in a second round of PCR verification with the upstream primers from the first round. The results of the second round of PCR analysis were combined with those of the first round of PCR analysis to jointly determine the genotype of the extreme progeny. The results were as follows: when a specific band appeared at 1013 bp in the first round of PCR amplification product and no band appeared in the second round of amplification product, it could be defined as a homozygous deletion genotype and could be identified as a high-hardness progeny; when a specific band appeared at 2179 bp in the first round of PCR amplification product and a band of 955 bp appeared in the second round of amplification product, it could be defined as a homozygous insertion genotype and could be identified as a low-hardness progeny. The test results are shown in Tables 3 and 4. The results show that when a specific band appears at 1013 bp in the first-round PCR amplification product and no band appears in the second-round amplification product, it can be defined as a homozygous deletion genotype, confirming a high-firmness offspring. Conversely, when a specific band appears at 2179 bp in the first-round PCR product and a specific band appears at 955 bp in the second-round amplification product, it can be defined as a homozygous insertion genotype, confirming a low-firmness apple fruit. These experimental results further demonstrate the effectiveness of the primer pairs provided in this invention.
[0037] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A primer combination for determining the firmness of apple fruit, characterized in that, The primer pair includes a first primer pair and a second primer pair; The first primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.2; The second primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.
4.
2. The application of the primer combination according to claim 1 in the preparation of a product for identifying the firmness of apple fruit.
3. The application according to claim 2, characterized in that, The products include reagents, reagent kits, and chips.
4. A product for determining fruit firmness, characterized in that, The product comprises the primer combination as described in claim 1.
5. The product according to claim 4, characterized in that, The products include reagents, reagent kits, and chips.
6. The application of the primer combination of claim 1 or the product of claim 4 or 5 in determining the firmness of apple fruit.
7. A method for determining the firmness of apple fruit, characterized in that, Using the DNA of the apple to be tested as a template, PCR amplification was performed using the first primer pair in the primer combination described in claim 1, and PCR amplification was performed using the second primer pair in the primer combination described in claim 1. The firmness of the apple fruit was determined based on the results of the two PCR amplifications.
8. The method according to claim 7, characterized in that, When a specific band appears at 1013bp in the first round of PCR products and no band appears in the second round of amplification products, it can be defined as a homozygous deletion genotype and can be identified as a high-firm apple fruit. When a specific band appears at 2179 bp in the first-round PCR product and a specific band appears at 955 bp in the second-round amplification product, it can be defined as a homozygous insertion genotype, and can be identified as a low-firm apple fruit.
9. The method according to claim 7, characterized in that, The PCR amplification reaction system consisted of 5 μL of 2×PCR polymerase mixture, 3 μL of sterile water, 0.5 μL of upstream primer, 0.5 μL of downstream primer, and 1 μL of template.
10. The method according to claim 7, characterized in that, The PCR amplification program is as follows: 94℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds; 60℃ annealing for 30 seconds; 72℃ extension for 1-2 minutes, for a total of 35 cycles, and a final extension at 72℃ for 10 minutes.