Primer for identifying intergeneric hybrids of Chinese cabbage and brassica campestris based on KASP technology and application of primer
By using KASP-InDel technology and designing specific primer pairs, combined with fluorescence signal detection, the problems of accuracy and simplicity in identifying intergeneric hybrids of Chinese cabbage and blue mustard have been solved, realizing an efficient and low-cost identification method, which promotes the transfer of superior traits and the breeding process.
Patent Information
- Application Number
- CN202610473457.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-10
- Publication Date
- 2026-05-12
AI Technical Summary
Existing technologies are insufficient for accurately and easily identifying the authenticity of intergeneric hybrids between Chinese cabbage and blue mustard. Traditional methods are complex and costly.
Using KASP-InDel technology, specific primer pairs (BE-KASP1Fa, BE-KASP1Fb, and BE-KASP1R) were designed for PCR amplification, and fluorescence signals were used for detection. Allele loci were distinguished by FAM and VIC fluorophores, achieving efficient identification.
This method enables high-precision, low-cost, and convenient identification of intergeneric hybrids between Chinese cabbage and blue mustard, improving identification accuracy and efficiency, and promoting the transfer of superior traits and the breeding process.
Smart Images

Figure CN122012800A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular breeding, specifically relating to a primer for identifying intergeneric hybrids of Chinese cabbage and blue mustard based on KASP technology and its application. Background Technology
[0002] Chinese cabbage, a crucial vegetable crop belonging to the Brassicaceae family and the Brassica genus, holds a significant position in my country's vegetable industry. Blue mustard, a herbaceous plant belonging to the Brassicaceae family and the Brassica genus, possesses strong adaptability, disease resistance, and stress tolerance, and is widely used in roadsides, slopes, and natural sites. Through distant hybridization, the superior stress-resistance traits of blue mustard can be transferred to Chinese cabbage and other cruciferous vegetables. However, accurately verifying the authenticity of hybrid offspring has become a critical issue that urgently needs to be addressed. Currently, morphological and cytological identification is commonly used to determine the authenticity of hybrid offspring. Although molecular markers are also used for identification, their design is difficult and sometimes requires two or more pairs of primers, making the process relatively complex.
[0003] Competitive allele-specific PCR (KASP) is a genotyping technique that uses specific base matching at the primer ends to genotype SNPs or InDels, enabling the detection of the specificity of SNPs or InDels. Currently, KASP-InDel genotyping technology is widely used in plant genetic mapping, gene localization, germplasm resource analysis, marker-assisted breeding, and seed purity identification. Developing KASP-InDel markers can facilitate convenient and accurate identification of the authenticity of distant hybrid offspring in plants. Summary of the Invention
[0004] To provide a molecular identification method for identifying intergeneric hybrids of Chinese cabbage and blue mustard, the present invention provides the following technology:
[0005] In a first aspect, the present invention provides a KASP-InDel technique for identifying intergeneric hybrids of Chinese cabbage and blue mustard. This includes:
[0006] DNA was extracted from the sample, which was obtained by intergeneric hybridization of Chinese cabbage as the female parent and blue mustard as the male parent, and the material was rescued by embryo.
[0007] Using the genomic DNA of the material as a template, amplification was performed using the following KASP-InDel primer pair 1:
[0008] Forward primer BE-KASP1Fa (5'-3'):
[0009] GAAGGTCGGAGTCAACGGATTCATCAATCGGGGAAAAAATGT (SEQ ID NO: 1);
[0010] Forward primer BE-KASP1Fb (5'-3'):
[0011] GAAGGTGACCAAGTTCATGCTCATGCATATCAAACCACTCAGTAAC (SEQ ID NO: 2);
[0012] Shared reverse primer BE-KASP1R (5'-3'): CGGATTCTTCTCAAGTACATTATTGAA (SEQ ID NO:3);
[0013] The amplified product was subjected to fluorescence signal detection, and the fluorescence signal was observed to determine the authenticity of the distant hybrid.
[0014] In primer pair 1, BE-KASP1Fa and BE-KASP1Fb are two allele-specific forward primers, and BE-KASP1R is a common reverse primer.
[0015] Further, it includes using the KASP-InDel primer pair to amplify the maternal, paternal, and F1 offspring hybrids.
[0016] In a specific implementation, the primer powder was diluted to 100 μg / mL, and then the three sequences were diluted in a ratio of Fa:Fb:R:water = 24:24:48:100 to obtain a primer mixture. In a specific implementation, the KASP primer BE-KASP1 was used to test the parental Chinese cabbage '24D4', blue mustard, and their F1 hybrids. The KASP-PCR reaction was performed on a 96-well PCR instrument, with a reaction system of 5 μL: 2 μL DNA (20 ng / μL), 2 μL 2×Taq DNA Polymerase Mix, and 1 μL primer mixture.
[0017] The KASP-PCR amplification program is as follows: Stage 1: 94℃ pre-denaturation for 10 minutes; Stage 2: 94℃ denaturation for 20 seconds, followed by annealing at 61℃ for 60 seconds, for a total of 10 cycles (starting from the second cycle, the temperature is decreased by 0.6℃ for each cycle); Stage 3: 94℃ denaturation for 20 seconds, followed by annealing at 55℃ for 45 seconds, for a total of 35 cycles.
[0018] Fluorescence reading method: After the PCR amplification cycle is completed, the fluorescence value is read using a quantitative real-time PCR instrument at an environment below 40°C. In this method, the fluorophores FAM and VIC are used to distinguish between two isogenetic loci for Indel site detection.
[0019] The beneficial effects of this application include:
[0020] 1) Improved accuracy and reliability of identification: The primer pair (BE-KASP1) based on KASP-InDel technology can specifically detect the InDel site and distinguish between maternal Chinese cabbage, paternal blue mustard and their heterozygous offspring through fluorescence signals (FAM and VIC), distinguish between homozygous and heterozygous genotypes, avoid false hybrid misjudgment, and provide high-precision verification.
[0021] 2) Simple and efficient operation: KASP-PCR amplification and fluorescence quantitative PCR detection are used, requiring only one or two pairs of primers, without the need for complex multi-primer combinations. Compared with traditional morphological, cytological or other molecular marker methods, the steps are simplified and rapid, making it suitable for large-scale breeding screening.
[0022] 3) Low cost: The method relies on standard PCR equipment and fluorescence reading software. The kit contains primers and necessary reaction reagents (such as 2×Taq DNA Polymerase Mix), eliminating the need for high-throughput equipment, reducing identification costs, and facilitating laboratory and field applications.
[0023] 4) High value for breeding applications: It helps to quickly identify intergeneric hybrids of Chinese cabbage '24D4' and blue mustard, introduce the excellent traits of blue mustard such as stress resistance and disease resistance into Chinese cabbage, promote the creation of new germplasm and genetic improvement of cruciferous vegetables, and meet the needs of agricultural breeding.
[0024] 5) Universality and stability: The primers are designed based on high-throughput sequencing data, have intergeneric specificity, and have been verified to be stable in parents and F1 generation. They can be combined with embryo rescue, DNA content detection and phenotypic observation to form a comprehensive identification system and improve the efficiency of distant hybridization. Attached Figure Description
[0025] Figure 1 Phenotypes of parents and distant hybrids at the seedling and rosette stages.
[0026] Figure 2 Determination of DNA content.
[0027] Figure 3 Genotyping of five offspring from a maternal parent (Chinese cabbage 24D4), a paternal parent (blue mustard), and a hybrid was determined using BE-KASP1 primer pairs.
[0028] Figure 4 To identify the genotypes of the maternal, paternal, and hybrid offspring using BE-KASP1 primers. Detailed Implementation
[0029] To make the objectives, technical solutions, and advantages of this application clearer, the application will be further described in detail below with reference to the accompanying drawings. The described embodiments should not be regarded as limitations on this application. All other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this application.
[0030] Material
[0031] Maternal parent: Chinese cabbage; paternal parent: blue mustard; a distant hybrid of Chinese cabbage and blue mustard.
[0032] These materials were provided by the Chinese cabbage breeding research group of the College of Horticulture Science and Engineering, Shandong Agricultural University, and were planted and managed routinely at the Horticulture Experiment Station of Shandong Agricultural University.
[0033] Equipment and reagents
[0034] The main experimental instruments include: a clean bench, a ploidy analyzer, an autoclave, and a real-time PCR instrument.
[0035] Main experimental tools: light-proof spray bottle, tweezers, petri dishes, pipettes, absorbent paper, scalpels, centrifuge tubes, etc.
[0036] Main experimental reagents: distilled water, MS medium, etc.
[0037] Example 1: Distant hybridization
[0038] A hybrid cross was prepared using Chinese cabbage '24D4' as the female parent and blue mustard as the male parent. Two to three days before hybridization, the opened flowers on the male parent inflorescence were removed, and the plant was isolated by bagging. Healthy female parent plants were selected, their buds were removed, and the male and female flowers were demasked. The plants were then pollinated with blue mustard pollen, and the plants were isolated by bagging after pollination.
[0039] Example 2 Embryo rescue
[0040] Seven days after pollination, the pods were harvested and embryo rescued under aseptic conditions. Complete, plump, and undamaged pods were placed in appropriate beakers, clearly labeled with the material name or corresponding code. In a laminar flow hood, the pods were first surface-sterilized with 75% alcohol for 30 seconds, then sterilized with sodium hypochlorite for 8 minutes, followed by rinsing three times with sterilized distilled water within 10 minutes. The waste liquid was poured into a prepared waste liquid container. After rinsing, the pods were placed in petri dishes lined with filter paper using tweezers. The ovary was carefully cut along its midline with a scalpel, and the ovules inside were removed and placed evenly on the embryo rescue medium. The dishes were then sealed and placed in an incubator for dark, room-temperature culture. After approximately 20 days of culture, the emergence of new embryos could be observed. Petri dishes with emerging embryos were placed on a light-protected culture rack for further cultivation. Once the embryos had recovered and turned green, they were transferred to a subculture medium for subculture propagation to form tissue culture seedlings. The plants were then planted in pots and managed according to standard procedures, such as... Figure 1 As shown.
[0041] Example 3: Detection of plant DNA content
[0042] Take 0.2 g of fresh leaves from the parent plants and hybrid offspring as test samples, place them in a petri dish, and add 500 μL of nuclear lysis buffer from the CyStain UV Precise P kit around the sample. Chop the leaf with a sharp blade and extract for 60 seconds to ensure complete nuclei extraction. Filter the liquid from the petri dish through a 50 μm celltrics filter into a centrifuge tube. Add 2000 μL of DAPI fluorescent staining solution from the CyStain UV Precise P kit to the sample tube, stain in the dark for 2 minutes, and then test using a microcomputer. Results are as follows: Figure 2 As shown, the results indicate that the ploidy peak value of Chinese cabbage is 3.9, the ploidy peak value of blue mustard is 27, and the ploidy peak value of the hybrid is 7. Therefore, the tested hybrid is a true hybrid.
[0043] Example 4: Development and Identification of KASP-InDel Molecular Markers
[0044] Leaves from parental plants and F1 plants were collected, DNA was extracted, and libraries were constructed. High-throughput sequencing of the parents and their hybrid offspring was performed using the Illumina platform. After obtaining clean reads from high-throughput sequencing, the data was filtered to obtain clean data, which was then aligned with the Chinese cabbage reference gene (http: / / www.brassicadb.cn / # / Download / Bara_Chiifu_V3.5 / ) to obtain mapped data. Based on the positional information of the aligned genome reads, StringTie was used to assemble the reads into transcripts. The assembled transcripts were then compared with the genome annotation information using GffCompare. After detecting InDel using GATK, ANNOVAR was used to annotate the variant sites, obtaining the InDel analysis results and annotation information.
[0045] Based on the InDel information, a large fragment insertion was found at position 26457243 on chromosome A05 of Chinese cabbage, and KASP-InDel primer pair 1 was designed based on this site.
[0046] Using genomic DNA as a template, the following KASP-InDel primer pair 1 was amplified:
[0047] Forward primer BE-KASP1Fa (5'-3'):
[0048] GAAGGTCGGAGTCAACGGATTCATCAATCGGGGAAAAAATGT (SEQ ID NO: 1);
[0049] Forward primer BE-KASP1Fb (5'-3'):
[0050] GAAGGTGACCAAGTTCATGCTCATGCATATCAAACCACTCAGTAAC (SEQ ID NO: 2);
[0051] Shared reverse primer BE-KASP1R (5'-3'):
[0052] CGGATTCTTCTCAAGTACATATTGAA (SEQ ID NO: 3).
[0053] The amplified product was subjected to fluorescence signal detection, and the fluorescence signal was observed to determine the authenticity of the distant hybrid.
[0054] In primer pair 1, BE-KASP1Fa and BE-KASP1Fb are two allele-specific forward primers, and BE-KASP1R is a common reverse primer.
[0055] Further, it includes amplification of the maternal and paternal parents using the KASP-InDel primer pair.
[0056] In a specific implementation, the primer powder was diluted to 100 μg / mL, and then the three sequences were diluted in a ratio of Fa:Fb:R:water = 24:24:48:100 to obtain a primer mixture. In a specific implementation, the KASP primer BE-KASP1 was used to test the parental Chinese cabbage '24D4', blue mustard, and their F1 hybrids. The KASP-PCR reaction was performed on a 96-well PCR instrument, with a reaction system of 5 μL: 2 μL DNA (20 ng / μL), 2 μL 2×Taq DNA Polymerase Mix, and 1 μL primer mixture.
[0057] The KASP-PCR amplification program is as follows: Stage 1: 94℃ pre-denaturation for 10 minutes; Stage 2: 94℃ denaturation for 20 seconds, followed by annealing at 61℃ for 60 seconds, for a total of 10 cycles (starting from the second cycle, the temperature is decreased by 0.6℃ for each cycle); Stage 3: 94℃ denaturation for 20 seconds, followed by annealing at 55℃ for 45 seconds, for a total of 35 cycles.
[0058] Fluorescence reading method: After the PCR amplification cycle is completed, the fluorescence value is read using a quantitative real-time PCR instrument at an environment below 40°C. In this method, the fluorophores FAM and VIC are used to distinguish between the two allele loci for Indel locus detection.
[0059] We analyzed the results using the LGC_OMEGA genotyping software (Kluster Caller). In this software, VIC and FAM data were plotted on the x and y axes, respectively. Indel genotyping results: signal points from the maternal parent (Chinese cabbage) were red, clustered near the y-axis; signal points from the paternal parent (blue mustard) were blue, clustered near the x-axis; signal points from distant hybrid offspring were green, clustered near the diagonal. The BE-KASP1 marker significantly distinguished between two homozygous genotypes and could also identify heterozygous genotypes, indicating successful marker development. Figure 3 (As shown).
[0060] We verified the hybrids in different varieties of Chinese cabbage, blue mustard, and hybrids, and the results are as follows: Figure 4 As shown, the results confirm that the above-mentioned KASP-InDel primer pair marker combination can specifically distinguish between Chinese cabbage and intergenous hybrids of the genus *Brassica rapa*.
Claims
1. A KASP-InDel primer pair composition for identifying interspecific hybrids of Chinese cabbage and blue mustard, characterized in that, The sequence includes the following: forward primer BE-KASP1Fa: SEQ ID NO:1; forward primer BE-KASP1Fb: SEQ ID NO:2; and common reverse primer BE-KASP1R: SEQ ID NO:
3.
2. The primer pair composition according to claim 1, characterized in that, The primer pair was designed to insert a large fragment into the InDel site at position 26457243 on chromosome A05 of Chinese cabbage, and is used to specifically distinguish the genotypes of intergeneric hybrids of Chinese cabbage and blue mustard.
3. A kit for identifying intergeneric hybrids of Chinese cabbage and blue mustard, characterized in that, The kit comprises the primer pair composition of claim 1.
4. The reagent kit according to claim 3, characterized in that, It also contains reagents for the KASP-PCR reaction, including 2×Taq DNA Polymerase Mix and primer mixture.
5. A method for identifying intergenous hybrids of Chinese cabbage and blue mustard based on KASP-InDel technology, characterized in that, Includes the following steps: Obtain genomic DNA from the sample to be identified as a template; The composition is amplified using the primers described in claim 1; the amplified product is subjected to fluorescence signal detection; and the authenticity of the hybrid is determined based on the fluorescence signal.
6. The method according to claim 5, characterized in that, The amplification was performed using the KASP-PCR program, which included 10 cycles of pre-denaturation at 94°C for 10 minutes, denaturation at 94°C for 20 seconds, and annealing at 61°C for 60 seconds, with each cycle decreasing by 0.6°C; and 35 cycles of denaturation at 94°C for 20 seconds and annealing at 55°C for 45 seconds.
7. The method according to claim 5 or 6, characterized in that, The fluorescence signal detection uses FAM and VIC fluorophores to distinguish alleles, and ROX is used as a passive reference dye. The readings are performed using a real-time PCR instrument at temperatures below 40°C.
8. The method according to any one of claims 5 to 7, characterized in that, Dilute the primer powder to 100 μg / mL, and then dilute the three sequences in a ratio of Fa:Fb:R:water = 24:24:48:100 to obtain a primer mixture.
9. The method according to any one of claims 5 to 8, characterized in that, The KASP-PCR reaction system consists of 5 μL of: 2 μL of 20 ng / μL DNA, 2 μL of 2×Taq DNA Polymerase Mix, and 1 μL of primer mixture.
10. The application of the primer pair composition of claim 1, the kit of claim 3 or 4, or the method of claims 5 to 9 in the identification of the authenticity of intergeneric hybrids obtained by crossing Chinese cabbage '24D4' with blue mustard.