Molecular marker related to content of neutral detergent fibers in medicago sativa and application of molecular marker

By developing SNP genotyping T/G markers and KASP detection primers for chromosome Chr7 position 52012545 in alfalfa, the problem of long breeding cycles in traditional breeding was solved, seedling genotyping was achieved, breeding efficiency and accuracy were significantly improved, and the breeding process of alfalfa with low neutral detergent fiber content was promoted.

CN122012802APending Publication Date: 2026-05-12INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610483996.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-14
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Traditional breeding methods are time-consuming and make it difficult to quickly and effectively select alfalfa varieties with low neutral detergent fiber content and high digestibility.

Method used

Molecular markers for T/G genotyping of SNP at chromosome Chr7 position 52012545 were developed, and a combination of KASP detection primers was designed. Neutral detergent fiber content in alfalfa was predicted at the seedling stage through genotyping, and breeding-assisted selection was carried out using molecular marker chips and kits.

Benefits of technology

It significantly shortens the breeding cycle, improves breeding accuracy, eliminates environmental interference, enables accurate prediction and selection of neutral detergent fiber content, and promotes the genetic improvement of alfalfa with low neutral detergent fiber content.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012802A_ABST
    Figure CN122012802A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of molecular biology, and relates to a molecular marker related to the content of neutral detergent fibers in medicago sativa and application of the molecular marker. The technical problem to be solved by the invention is that the period of a traditional breeding mode is long. The technical scheme of the invention is a molecular marker related to the content of neutral detergent fibers in medicago sativa. The specific information is as follows: chromosome: Chr7; the position is 52012545; sNP (Single Nucleotide Polymorphism) typing: T / G. By adopting the molecular marker and the KASP typing primer disclosed by the invention, genotype screening can be completed in a seedling stage, and selection can be performed without waiting for plant maturity, so that the breeding period is greatly shortened.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology and relates to a molecular marker related to the content of neutral detergent fiber in alfalfa and its application. Background Technology

[0002] Alfalfa, an irreplaceable high-quality roughage in dairy farming, directly impacts the dry matter intake (DMI) of dairy cows, thus determining their milk production performance. In the alfalfa quality evaluation system, neutral detergent fiber (NDF) is a major component of alfalfa cell walls, containing cellulose, hemicellulose, and lignin; its content directly determines the dry matter intake. Unlike acid detergent fiber (ADF), which primarily affects digestibility, NDF is the primary factor limiting dairy cow feed intake: higher NDF content leads to a stronger filling effect in the rumen, making cows feel full more easily, thus limiting dry matter intake and inhibiting milk production potential. High-quality alfalfa typically has an NDF content below 40%, requiring a high proportion of digestible components and a low proportion of indigestible components (such as lignin). Therefore, breeding alfalfa varieties with low NDF and high digestibility has become a key breakthrough in balancing feed intake and energy supply. However, NDF content is a quantitative trait controlled by multiple genes. Traditional breeding relies on phenotypic selection, requiring multiple generations of field planting and continuous observation for more than 10 years to obtain genetically stable superior lines. Furthermore, it is difficult to effectively distinguish the interaction between genotype and environment. Molecular marker-assisted selection, by locating QTLs (quantitative trait loci) associated with NDF content, allows for indirect selection at the seedling stage, shortening the breeding cycle to 3-5 years and significantly improving the accuracy of selection. This provides technical support for the rapid development of breakthrough alfalfa varieties with both low NDF and high digestibility. Summary of the Invention

[0003] The technical problem that this invention aims to solve is the long cycle of traditional breeding methods.

[0004] The technical solution of this invention is a molecular marker related to the neutral detergent fiber content of alfalfa, with the following specific information: chromosome: Chr7; position: 52012545; SNP genotype: T / G.

[0005] Specifically, the nucleotide sequence of the molecular marker is shown in SEQ ID No. 1 or SEQ ID No. 2.

[0006] The present invention also provides primer combinations for KASP detection and genotyping of the molecular markers, the nucleotide sequences of which are shown in SEQ ID No. 3-5.

[0007] The present invention also provides a molecular marker detection kit, comprising primers shown in SEQ ID No. 3-5.

[0008] The present invention also provides a molecular marker chip, comprising primers shown in SEQ ID No. 3-5.

[0009] The present invention also provides the use of the molecular marker, the primer combination for amplifying the molecular marker, the kit and / or the molecular marker chip in any one of the following: a. Predict the neutral detergent fiber content of alfalfa; b. Identification and screening of alfalfa with different neutral detergent fiber contents; c. Molecular marker-assisted breeding of alfalfa; d. Alfalfa breeding; e. Prepare products for alfalfa breeding.

[0010] This invention also provides a method for screening alfalfa materials with different neutral detergent fiber contents or predicting the neutral detergent fiber content of alfalfa, comprising the following steps: extracting genomic DNA from the alfalfa material to be tested, amplifying molecular markers using primers described in SEQ ID No. 3~5, sequencing the amplified products, and screening by typing.

[0011] Specifically, the amplification program is as follows: 94℃ for 15 min; 95℃ for 20 sec, 65~56℃ for 60 sec, 10 cycles, with the annealing extension temperature decreasing by -0.8℃ in each cycle; 94℃ for 20 sec, 57℃ for 60 sec, 10 cycles.

[0012] Specifically, the classification and screening criteria are as follows: if the classification result is TT, it is a material with low neutral detergent fiber content; if the classification result is TG or GG, it is a material with medium neutral detergent fiber content.

[0013] The beneficial effects of this invention are as follows: By sequencing and analyzing 165 alfalfa germplasm materials, this invention identified a SNP locus located near chromosome 52.0 Mb of the alfalfa genome (Chr7) that is significantly associated with neutral detergent fiber content. KASP genotyping primers were developed for this locus, and 81 materials were tested. The results showed that there were significant differences in neutral detergent fiber content among different genotypes. Using the molecular markers and KASP genotyping primers of this invention, genotype screening can be completed at the seedling stage, eliminating the need to wait for plant maturity, significantly shortening the breeding cycle, and eliminating the interference of environmental factors, thus significantly improving the accuracy and efficiency of target trait selection. The molecular markers of this invention have good application value, enabling pre-selection of neutral detergent fiber content in test materials and molecular-assisted breeding, which has important theoretical and practical significance for accelerating the genetic improvement of alfalfa with low neutral detergent fiber content. Attached Figure Description

[0014] Figure 1 Obtaining sites that are significantly associated with neutral detergent fibers.

[0015] Figure 2 KASP marker typing results at Chr7_52012545 site.

[0016] Figure 3 Comparative analysis of the content of neutral detergent fiber in materials with different allelic genotypes. Detailed Implementation

[0017] To further illustrate the technical means and effects of the present invention in achieving its intended purpose, the following detailed description of the specific implementation methods, structures, features, and effects of the present invention, in conjunction with the accompanying drawings and preferred embodiments, is provided below.

[0018] Example 1: Obtaining Significantly Associated Sites The experimental population consisted of 165 alfalfa germplasm materials, representing different regions and phenotypes. Considering the variability among individual plants of the same alfalfa variety, cuttings were taken from the germplasm resource nursery in 2022 and propagated by cuttings in a greenhouse. After successful rooting, these germplasm materials were transplanted to experimental fields in Langfang, Hebei Province, and Changping, Beijing. In these experimental sites, a randomized block design was used to establish the experimental population, with three replicates, each containing 15 cuttings. To ensure sufficient growing space, the interval between replicates was 150 cm, and the distance between rows and plants was set to 150 cm and 60 cm, respectively. During the growing season, no fertilization or irrigation was applied; only manual weeding was performed. Winter watering was provided to help the plants overwinter.

[0019] Alfalfa was harvested at the initial flowering stage in two experimental plots. After harvesting, whole alfalfa plants were placed in nylon mesh belts and air-dried in a well-ventilated and shaded greenhouse, avoiding direct sunlight, until the stems became brittle and easily broken. These samples were then placed in a constant-temperature oven and dried thoroughly at 60°C for 6 hours. After drying, the samples were crushed using a cyclone mill to a particle size that could pass through a 40-mesh sieve, and packaged in resealable bags (keeping them dry and avoiding direct sunlight) for subsequent analysis. The neutral detergent fiber content was then determined using a NIRS D2500F near-infrared spectroscopy system (three technical replicates, average value).

[0020] 100 mg of young alfalfa leaves were selected, flash-frozen in liquid nitrogen, and then total plant DNA was extracted using the CWBIO Plant Genomic DNA Extraction Kit (Cowin Biosciences, Taizhou, China) according to the manufacturer's instructions. The concentration and quality of the total DNA were detected using a micro spectrophotometer (Nano Photometer NP80, Germany), and then sequenced on the BGIDNBSEQ next-generation sequencing platform (BGI, Shenzhen, China).

[0021] Each material yielded approximately 30.5 GB of raw data. The raw sequencing data was processed using Trimmomatic (version 0.39) (Bolger et al., 2014) software to remove the adapter and filter out low-quality base sequences. The cleaned sequencing data was then aligned to the haplotype reference genome of 'Zhongmu 1' alfalfa using BWA-MEM. SAMtools (version 1.13) was used to filter multiple alignments and low-quality sequences, resulting in filtered BAM files, which were then sorted. PCR repetitive sequences were marked using the Mark Duplicates function in the Picard toolkit (version 2.23.0). Finally, the processed BAM files were used for variant detection using GATK Haplotype Caller (version 4.2.3.062). The following parameters were set as screening criteria in the SNP filtering strategy: Quality By Depth (QD) less than 2.0, Fisher Strand (FS) greater than 60.0, MQ Rank Sum Test less than -12.5, Read PosRank Sum less than -8.0, SOR (Strand Odds Ratio) greater than 3.0, and Mapping Qualities (MQ) less than 40.0. Subsequently, the selection criteria for a subset of alfalfa SNP markers were defined, including: (1) using VCFtools (version 0.1.16) to remove SNP markers with a deletion rate greater than 20% and a minor allele frequency (MAF) less than 0.05%, thereby creating a basic SNP set containing only biallelic SNP markers; (2) using Plink (version 1.90b6.21) to filter the basic SNP set based on linkage disequilibrium (LD), setting the LD filter window size to 100 SNPs, the window step size to 50 SNPs, and the r2 threshold to 0.2, to obtain a core SNP marker set. The missing genotypes in the LD-filtered SNP marker set were then filled using Beagle software with default parameters. Similarly, VCFtools was used to filter Indel markers, retaining only biallelic markers with a deletion rate less than 20% and a MAF greater than 0.05%.

[0022] GWAS analysis was performed using 2,821,247 high-quality SNP markers. To ensure the accuracy and reliability of the analysis, various software and statistical models were used: TASEEL 5.0 (GLM and MLM) (Bradbury PJ et al., 2007), BLINK (v1.01) (Huang et al., 2019). QQ plots (quantile-quantile plots) are used to measure the reliability of the model. By comparing the QQ plots generated by different models, the MLM model in TASSEL 5.0 performed better. Therefore, the MLM model in TASSEL 5.0 was selected to present the final results. Principal component analysis was performed on the SNP data, and the first three principal component variables were used as covariates to correct for population structure. The Manhattan plot visualization was performed using the R package CMplot (Yin et al., 2021). A locus significantly associated with neutral detergent fiber content was found on chromosome 7, with a LOD value of 8.77 and an explainable phenotypic contribution of 8.9% (…). Figure 1 ).

[0023] Example 2: Development of the KASP marker at the Chr7_52012545 locus The Chr7_52012545 locus is located near chromosome 52.0 Mb on the Chr7 chromosome of the alfalfa genome. The upstream and downstream reference sequences are shown in SEQ ID No. 1 and SEQ ID No. 2. Specific information about the Chr7_52012545 locus is as follows: Chromosome: chr7; Location: 52012545; SNP genotype: T / G.

[0024] SEQ ID No. 1, where lowercase letters represent SNP sites; TGCCATGATGCTTTGGTTTTTTCTCTTCTACTTTCTGTTCTGCCTGTGACCTGGAAAGTTTTAATTTAGATATATAGTTTGACTGTTAGGAAAATCGTGAATTTGAGAGACAAATTATGGACTTCTAACTTTAATGATGTTGGTTTTTTTAGTCTGCTCAGTTCCTAATTCTATTCTCATCATTGATTTACTCATTCGCCTACtGATACTTGCATGCGTTCATGCAATCATAAACAAAACTAGTGACACTTTGAGACATATTATAGTTTATGATGTTAAACTTGACTGGATTTTATTATAGGCCGCAAAACATGACCGGAATTGATTAAAGCTATTAACCTTCAGTTTTGTCTGTGTAACATGATCAATTTCCTTTTGCAGATTTTCGAACTTCTTCGAAATCATTATTGGTATGTACCAAGATGCCAGATTTATACAAAGTTG。

[0025] SEQ ID No.2, where lowercase letters represent SNP sites; TGCCATGATGCTTTGGTTTTTTCTCTTCTACTTTCTGTTCTGCCTGTGACCTGGAAAGTTTTAATTTAGATATATAGTTTGACTGTTAGGAAAATCGTGAATTTGAGAGACAAATTATGGACTTCTAACTTTAATGATGTTGGTTTTTTTAGTCTGCTCAGTTCCTAATTCTATTCTCATCATTGATTTACTCATTCGCCTACgGATACTTGCATGCGTTCATGCAATCATAAACAAAACTAGTGACACTTTGAGACATATTATAGTTTATGATGTTAAACTTGACTGGATTTTATTATAGGCCGCAAAACATGACCGGAATTGATTAAAGCTATTAACCTTCAGTTTTGTCTGTGTAACATGATCAATTTCCTTTTGCAGATTTTCGAACTTCTTCGAAATCATTATTGGTATGTACCAAGATGCCAGATTTATACAAAGTTG。

[0026] KASP primers were designed for the Chr7_52012545 site and flanking sequence using Bacthprimer 3 software. Each KASP marker consisted of two specific primers and one universal primer. Fluorescent adapter sequences were ligated to the 5' end of the specific primers (GAAGGTGACCAAGTTCATGCT is the FAM fluorescent adapter sequence; GAAGGTCGGAGTCAACGGATT is the HEX fluorescent adapter sequence).

[0027] Specific primer 1 (SEQ ID No. 3): GAAGGTGACCAAGTTCATGCTGCATGAACGCATGCAAGTATCA; Specific primer 2 (SEQ ID No. 4): GAAGGTCGGAGTCAACGGATTGCATGAACGCATGCAAGTATCC; Universal primer (SEQ ID No. 5): TCATCATTGATTTACTCATTCGCCTA.

[0028] Example 3: Application of the Chr7_52012545 site Eighty-one alfalfa germplasm materials were planted (using the same planting method as in Example 1). Then, 100 mg of young alfalfa leaves were selected, flash-frozen in liquid nitrogen, and total plant DNA was extracted using the CWBIO Plant Genomic DNA Extraction Kit (Cowin Biosciences, Taizhou, China) according to the manufacturer's instructions. The concentration and quality of the total DNA were then determined using a Nano Photometer NP80 (Germany).

[0029] KASP marker validation and detection were performed using Douglas Scientific's ArrayTape system. The ArrayTape genotyping platform includes NEXAR for PCR amplification system assembly, SOELLEX for PCR amplification, ARAYA for signal scanning, and INTELLICS for data analysis.

[0030] The PCR system was assembled using NEXAR, and the PCR reaction system is shown in Table 1.

[0031] Table 1 KASP Reaction System .

[0032] Primer C represents a universal primer, while Primer X and Primer Y represent specific primers 1 and 2, respectively. PCR amplification was performed using a SOELLEX instrument. The touch-down PCR amplification conditions were as follows: 94℃ for 15 min; 95℃ for 20 sec, 65~56℃ for 60 sec, 10 cycles, with the annealing extension temperature decreasing by -0.8℃ per cycle; 94℃ for 20 sec, 57℃ for 60 sec, 10 cycles.

[0033] After the PCR reaction was completed, the fluorescence signal of the reaction system was scanned using ARAYA; then, data analysis and genotyping were performed using INTELLICS. A schematic diagram of the marker genotyping is shown below. Figure 2 As shown in Table 2, red indicates the TT allele at this locus, blue indicates the GG allele, and purple indicates the T / G heterozygous type. The allele types of the 81 germplasm materials at this locus are shown in Table 2. Statistical analysis of the neutral detergent fiber content of the three allele types was performed using the t-test method. It was found that the neutral detergent fiber content of the TT allele was significantly lower than that of the T / G and GG types (P<0.01) (see Table 2). Figure 3 ).

[0034] Table 2. Allelic types of 81 germplasm materials at this locus. .

[0035] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. A molecular marker related to the neutral detergent fiber content of alfalfa, characterized in that: The specific information is as follows: Chromosome: Chr7; Location: 52012545; SNP type: T / G.

2. The molecular marker according to claim 1, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID No. 1 or SEQ ID No.

2.

3. The primer combination for KASP detection and genotyping of the molecular marker as described in claim 1 or 2, characterized in that: Its nucleotide sequence is shown in SEQ ID No. 3~5.

4. A molecular marker detection kit, comprising primers shown in SEQ ID No. 3-5.

5. A molecular marker chip, comprising primers shown in SEQ ID No. 3-5.

6. The use of the molecular marker of claim 1 or 2, the primer combination of claim 3, the kit of claim 4, and / or the molecular marker chip of claim 5, in any one of the following: a. Predict the neutral detergent fiber content of alfalfa; b. Identification and screening of alfalfa with different neutral detergent fiber contents; c. Molecular marker-assisted breeding of alfalfa; d. Alfalfa breeding; e. Prepare products for alfalfa breeding.

7. A method for screening alfalfa materials with different neutral detergent fiber contents or predicting the neutral detergent fiber content of alfalfa, characterized in that: The procedure includes the following steps: extracting genomic DNA from the alfalfa material to be tested, amplifying molecular markers using primers described in SEQ ID No. 3~5, sequencing the amplified products, and screening by typing.

8. The method according to claim 7, characterized in that: The amplification program is as follows: 94℃ for 15 min; 95℃ for 20 sec, 65~56℃ for 60 sec, 10 cycles, with the annealing extension temperature decreasing by -0.8℃ in each cycle; 94℃ for 20 sec, 57℃ for 60 sec, 10 cycles.

9. The method according to claim 7, characterized in that: The classification and screening criteria are as follows: if the classification result is TT, it is a material with low and neutral detergent fiber content; if the classification result is TG or GG, it is a material with medium and high neutral detergent fiber content.