ERA-Cas12a primer, probe, crRNA and kit for detecting insertion of PLCP gene into EV-G

By designing specific ERA-Cas12a primers and probes and leveraging the bypass cleavage activity of the Cas12a protein, a rapid, sensitive, and specific detection of PLCP gene insertion EV-G was achieved. This solves the problems of complex detection methods and expensive equipment in existing technologies and is suitable for rapid on-site diagnosis of porcine enterovirus EV-G.

CN122012809APending Publication Date: 2026-05-12YUNNAN ANIMAL SCI & VETERINARY INST
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202512012084.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-29
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Current technologies lack methods for rapid, sensitive, and specific detection of PLCP gene insertion in porcine enterovirus EV-G, making early diagnosis particularly difficult under field conditions. Furthermore, existing methods suffer from issues such as expensive equipment, complex operation, and insufficient sensitivity.

Method used

Using ERA-Cas12a primers, probes, and crRNA, combined with isothermal amplification technology and lateral flow test strips, specific primers and probes were designed to utilize the bypass cleavage activity of the Cas12a protein to achieve rapid detection of PLCP gene insertion EV-G.

Benefits of technology

It enables rapid, sensitive, and specific detection of PLCP gene insertion EV-G under low-temperature isothermal conditions, suitable for on-site diagnosis, improving detection efficiency and sensitivity, applicable to early clinical sample detection, and requires no expensive equipment; results can be determined visually.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012809A_ABST
    Figure CN122012809A_ABST
Patent Text Reader

Abstract

The invention relates to an ERA-Cas12a primer, a probe, crRNA and a kit for detecting insertion of a PLCP gene into EV-G, and belongs to the technical field of animal virus molecular biology detection. The kit comprises an ERA-Cas12a primer for detecting insertion of the PLCP gene into EV-G, a probe and crRNA, and further comprises a negative control template, a positive control template, a reverse transcription and ERA amplification reagent, a double-index nucleic acid detection test strip, Cas12a protein, an FAM / Biotin reporter and a lateral flow detection test strip. The kit provided by the invention has the advantages of specificity, sensitivity, rapidness, high efficiency, isothermal amplification, on-site rapid diagnosis and the like, and is easy to popularize and apply.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of animal virus molecular biology detection technology, specifically relating to an ERA-Cas12a primer, probe, crRNA, and kit for detecting PLCP gene insertion into EV-G. Background Technology

[0002] Porcine enterovirus (EV-G) is a member of the Picornaviridae family. It is mainly transmitted through the fecal-oral route and is widespread in pig herds worldwide, with most infections being asymptomatic. However, with the continuous discovery of EV-Gs with the papain-like cysteine ​​protease (PLCP) gene insertion of porcine circovirus (PToV) belonging to the family Coronaviridae of the order Nidovirales, including EV-G1, 2, 8, 10, 12, and 17 in Belgium, the United States, South Korea, Japan, and China, increasing evidence suggests that the insertion of the PLCP gene may enable EV-Gs to antagonize the host cell's innate immune system. Infection with EV-G-PLCP strains is usually associated with clinical symptoms such as diarrhea, fever, and decreased daily weight gain in piglets, as well as many necropsy and pathological features such as enteritis, congestion of the intestinal mucosa and mesenteric lymph nodes, thinning of the intestinal wall, and loss of small intestinal villi.

[0003] EVs (Vibrio Species-G1) possess a single-stranded positive-sense RNA genome of 7400 to 7500 nucleotides (nt) in length, containing only one open reading frame. The polyprotein precursor encoded by this genome can be cleaved by proteases to produce four structural proteins (VP1 to VP4) and seven non-structural proteins (2Apro, 2B, 2C, 3A, 3B, 3Cpro, and 3Dpol). The diversity of the gene encoding the VP1 protein forms the molecular biological basis for further classifying EVs into 20 genotypes (EV-G1–20). The 3Dpol protein is an RNA-dependent RNA polymerase (RdRp) that plays a crucial role in the viral life cycle; its encoding gene is the 3D gene. The 3D gene is highly conserved among single-stranded positive-sense RNA viruses and is often used as a basis for classifying members of the Picornaviridae family.

[0004] Viral infection-induced intestinal barrier damage is a significant factor contributing to impaired nutrient absorption, weakened immunity, and decreased production performance in piglets. Furthermore, frequent intestinal diseases can lead to food and environmental safety issues such as antibiotic overuse. To understand the prevalence and distribution of EVs with PLCP gene insertion in my country and to develop scientific prevention and control strategies, it is essential to establish corresponding rapid on-site diagnostic methods.

[0005] Li Zhanhong et al. have developed quantitative real-time polymerase chain reaction (qRT-PCR) and loop-mediated isothermal amplification (LAMP) methods for the detection of EV-Gs, but these methods all have shortcomings. First, qRT-PCR requires expensive equipment (approximately 300,000 RMB); second, it requires highly trained technicians to perform the experiments; third, the qRT-PCR process requires strictly controlled temperature cycling processes such as denaturation (95℃) and extension (72℃), while stable power supplies are difficult to provide for field and on-site detection; finally, the target sequences of the currently established qRT-PCR methods are limited to the EV-Gs genome and do not include the PLCP gene. Although visual LAMP detection methods can complete amplification under isothermal and constant-temperature conditions, reducing the requirements for temperature-changing cycling processes and allowing for visual interpretation of results, this method requires at least two primer pairs to complete one amplification reaction. Because primer dimers easily form between multiple primer pairs, leading to non-specific amplification, it is difficult to use for detecting two or more viral genes. Therefore, this method can only determine whether the sample is EV-G positive, but cannot determine whether the PLCP gene is inserted into the sample's genome, severely reducing detection efficiency.

[0006] In summary, there is currently no detection method that combines the advantages of specificity, sensitivity, high efficiency, and convenience, especially lacking means for early and rapid diagnosis of clinical samples on-site. Therefore, establishing a method and kit for the rapid on-site diagnosis of EV-Gs pathogens with PLCP gene insertion would not only compensate for the shortcomings of existing technologies but also provide technical support and knowledge reserves for the diagnosis and prevention of EV-Gs in my country.

[0007] Over the past few decades, various isothermal amplification techniques have emerged, such as the widely used LAMP, recombinase polymerase amplification (RPA), and enzymatic recombinase amplification (ERA). RPA and ERA are similar in principle, with the amplification primarily involving three proteins: a recombinase to unwind the DNA double helix, a single-stranded DNA-binding protein to stabilize the unwound DNA, and a polymerase to synthesize DNA. Both RPA and ERA require only a pair of primers and / or a probe, incubated at a constant temperature of 37°C to 45°C for 10-15 minutes to complete the amplification reaction. Furthermore, after the amplification reaction, the products can be detected not only by agarose gel electrophoresis but also visually by using lateral flow test strips, greatly facilitating rapid on-site diagnosis.

[0008] The CRISPR-Cas system is an adaptive immune defense system in bacteria and archaea, capable of targeting and cleaving exogenous genetic material (DNA or RNA) to resist viral invasion. In recent years, molecular diagnostic technologies developed based on the CRISPR-Cas system have been driving revolutionary developments in the field of detection due to their high specificity and efficiency. The Cas12a protein belongs to the class 2 VA CRISPR-Cas system. When forming a ternary complex of Cas12a, crRNA, and target DNA, it performs bypass cleavage on non-target single-stranded DNA. Therefore, by amplifying the target sequence using isothermal amplification technology and introducing crRNA complementary to the target sequence and a single-stranded DNA reporter labeled with 5-carboxyfluorescein (FAM) and biotin, the bypass cleavage activity of the Cas12a protein, combined with lateral flow test strips (CRISPR), allows for direct visual interpretation of test results, greatly promoting the development of rapid on-site diagnostic technologies.

[0009] RPA and ERA have been applied to the detection of various pathogens, including viruses and bacteria, and have advantages such as strong characteristics, high sensitivity, fast detection speed, and the ability to perform isothermal amplification. Similarly, CRISPR-Cas12a protein has been widely used in nucleic acid detection, cancer biomarker detection, and biosensors. More importantly, this technology has five major advantages: speed, sensitivity, low cost, portability, and ease of operation. However, there is currently no commercially available ERA-nfo-Cas12a lateral flow test strip method for detecting EV-Gs with PLCP gene insertion. Summary of the Invention

[0010] The purpose of this invention is to overcome the shortcomings of the prior art and provide an ERA-Cas12a primer, probe, crRNA and kit for detecting PLCP gene insertion in EV-G, so as to achieve rapid on-site diagnosis of EV-Gs with PLCP gene insertion.

[0011] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The first aspect of the present invention provides primers for detecting ERA-Cas12a of PLCP gene insertion into EV-G, including ERA-nfo-dual-index nucleic acid detection test strip primer pair for EV-G 3D gene and ERA-Cas12a-lateral flow test strip primer pair for PLCP gene; The primer pair for the ERA-nfo dual-index nucleic acid detection test strip for the EV-G 3D gene includes the upstream primer 3D_F and the downstream primer 3D_R, with the following nucleotide sequences: Upstream primer 3D_F: ttaatgattctgttgctatgagatgctattt; (SEQ ID NO.1); Downstream primer 3D_R: TAMRA-cagagcatcctgatggcattcctcccttaac; (SEQ ID NO.2); The primer pair for ERA-Cas12a-lateral flow test strip detection of the PLCP gene includes the upstream primer PLCP_F and the downstream primer PLCP_R, with the following nucleotide sequences: Upstream primer PLCP_F: aatctgtgcaaggtttagtctatcgttttg; (SEQ ID NO.3); Downstream primer PLCP_R: tcatcaaaaacataccattcaccattaagtt; (SEQ ID NO.4).

[0012] A second aspect of the present invention provides a probe for use with the primers described above for detecting PLCP gene insertion into EV-G in ERA-Cas12a, wherein the probe is an nfo probe; The nucleotide sequence of the nfo probe is as follows: 3D_Probe:DIG-tgtttgaggcccttcagatggttcttgaga[THF]aattggatttggaga[C3-spacer]; (SEQ ID NO. 5).

[0013] A third aspect of the present invention provides a crRNA for use with the primers described above for detecting PLCP gene insertion into EV-G's ERA-Cas12a, wherein the nucleotide sequence of the crRNA is: crRNA: uaauuucuacuaaguguagaugagaacaacaugaugcaguuga; (SEQ ID NO. 6).

[0014] A fourth aspect of the present invention provides a kit containing the primers for detecting PLCP gene insertion into EV-G in ERA-Cas12a, the probe, and the crRNA.

[0015] Furthermore, the kit also includes: a negative control template, a positive control template, reverse transcription and ERA amplification reagents, a dual-index nucleic acid detection strip (Biotin-FITC / Digoxin-TAMRA), Cas12a protein, FAM / Biotin reporter, and a lateral flow detection strip (CRISPR).

[0016] Furthermore, the negative control template is RNase-free water; the positive control template is the EV-G 3D gene ssRNA fragment and the PLCP gene ssRNA fragment; the reverse transcription and ERA amplification reagents include RT-probe type lyophilized microspheres, activator MC and RNase-free water.

[0017] Furthermore, the copy number of the positive control template is: 5.2 × 10⁻⁶ for the EV-G 3D gene ssRNA fragment. 10 The copy number of the PLCP gene ssRNA fragment is 5.5 × 10⁻⁶ copies / μL. 10 The concentration of Cas12a protein was 10 μmol / L, and the concentration of FAM / Biotin reporter was 100 μmol / L.

[0018] Furthermore, the reverse transcription and ERA amplification system of the kit is as follows: RT-probe type lyophilized microspheres, 1 tube; Upstream primer 3D_F, 10 μmol / L, 1.5 μL; Downstream primer 3D_R, 10 μmol / L, 1.5 μL; Upstream primer PLCP_F, 10 μmol / L, 2.0 μL; Downstream primer PLCP_R, 10 μmol / L, 2.0 μL; nfo probe 3D_Probe, 10μmol / L, 0.5μL; Total RNA extracted from the sample to be tested, 5.0 μL; Activator MC, 2.0 μL; RNase-free water, 35.5μL; Total: 50.0 μL; The reverse transcription and ERA amplification program was as follows: 41℃, 15 min, for one cycle; ERA amplification products were obtained; reverse transcriptase, recombinase, polymerase and endonuclease IV were inactivated: 85℃, 10 min, for one cycle.

[0019] Furthermore, the detection system for the EV-G 3D gene in the aforementioned kit is as follows: ERA amplification product, 5.0 μL; ddH2O, 200.0 μL; Total: 205.0 μL; Insert the dual-index nucleic acid test strip (Biotin-FITC / Digoxin-TAMRA) into the EV-G 3D gene detection system for detection. The liquid level should not exceed the Max line of the dual-index nucleic acid test strip (Biotin-FITC / Digoxin-TAMRA). The testing procedure is as follows: room temperature, 7-10 minutes.

[0020] Furthermore, the cleavage system for the PLCP gene Cas12a protein in the kit is as follows: ERA amplification product, 45.0 μL; 10×Reaction Buffer, 6.0μL; Cas12a protein, 10 μmol / L, 2.0 μL; FAM / Biotin reporter, 100 μmol / L, 0.6 μL; crRNA, 10 μmol / L, 0.6 μL; ddH2O, 5.8 μL; Total: 60.0 μL; The cleavage procedure was as follows: 40℃, 30 min, for one cycle; Cas12a protein cleavage product was obtained; Cas12a protein inactivation: 85℃, 5 min, for one cycle; The detection system for the PLCP gene in the kit is as follows: Cas12a protein cleavage product, 30.0 μL; ddH2O, 30.0 μL; Total: 60.0 μL; Insert the CRISPR lateral flow test strip into the detection system for the PLCP gene described above for detection. The liquid level should not exceed the Max line of the CRISPR lateral flow test strip. The testing procedure is as follows: room temperature, 7-10 minutes.

[0021] In this invention, the negative control template is RNase-free water; the positive control template is a single-strand RNA (ssRNA) fragment transcribed using the EV-G3D gene fragment as a template and an ssRNA fragment transcribed using the PLCP gene fragment as a template.

[0022] In this invention, RT-probe type lyophilized microspheres and activator MC are the names of the components in the purchased ERA kit. Reverse transcriptase, recombinase, polymerase, and endonuclease IV are all components in the lyophilized microspheres of the purchased ERA kit.

[0023] This invention provides primers, nfo probes, crRNA, and a detection kit for an enzymatic recombination isothermal amplification (ERA)-nfo-Cas12a-lateral flow test strip for detecting the EV-G 3D gene and the papain-like (PLCP) gene inserted into the EV-G genome.

[0024] This invention provides a 3D gene downstream primer (3D_R) for rapid on-site detection of EV-Gs with PLCP gene insertion. The 5' end of the primer is labeled with 5-carboxytetramethylrhodamine (TAMRA). The 5' end of the nfo probe (3D_Probe) is labeled with a digoxigenin (DIG) group; a blocking group (C3-spacer) is added to the 3' end of the nfo probe (3D_Probe); and tetrahydrofuran (THF) is present at position 31 of the nfo probe (3D_Probe).

[0025] This invention provides primers, an nfo probe, a dual-index nucleic acid detection strip (Biotin-FITC / Digoxin-TAMRA), Cas12a protein, crRNA, and a FAM / Biotin reporter, a CRISPR lateral flow test strip, and a detection kit for detecting EVs with PLCP gene insertion. The method involves extracting total RNA from the sample, performing reverse transcription and ERA amplification, and then detecting the amplified products using the dual-index nucleic acid detection strip (Biotin-FITC / Digoxin-TAMRA). The amplified products are further cleaved and detected using Cas12a protein, crRNA, the FAM / Biotin reporter, and the CRISPR lateral flow test strip, achieving accurate detection of EVs with PLCP gene insertion in the sample. The primers, nfo probe, crRNA, and detection kit provided by this invention can be used for rapid on-site diagnosis of EVs with PLCP gene insertion, playing a crucial role in the prevention and control of EVs in my country.

[0026] The kit of this invention provides RNase-free water as a negative control template and EV-G 3D gene ssRNA fragments and PLCP gene ssRNA fragments as positive control templates. Specifically, when the reverse transcription and ERA amplification systems react with the negative control template, the template is RNase-free water; when the reverse transcription and ERA amplification systems react with the positive control template, the template is the EV-G 3D gene ssRNA fragment and / or the PLCP gene ssRNA fragment; when the reverse transcription and ERA amplification systems react with the sample template, the template is total RNA extracted from EV-G culture medium, suspected EV-G infected animal tissue, blood, or feces. Using the primers, nfo probe, Cas12a protein, crRNA, and FAM / Biotin reporter provided in this invention, reverse transcription and ERA amplification were performed on negative control templates, positive control templates, and test sample templates, respectively. The ERA amplification products were detected using a dual-index nucleic acid detection strip (Biotin-FITC / Digoxin-TAMRA). Then, the ERA amplification products were cleaved with Cas12a protein, and the cleavage products of Cas12a protein were detected using a lateral flow detection strip (CRISPR).

[0027] If a blue control line and a red test line similar to the positive control template appear simultaneously on both the control band (C) and test band 2 (T2) of the dual-index nucleic acid test strip (Biotin-FITC / Digoxin-TAMRA), and only a red control line (C) appears on the lateral flow test strip (CRISPR) without a red test line (T) similar to the positive control template, the EV-G nucleic acid is positive without PCLP gene insertion. If a blue control line appears on the control band (C) of the dual-index nucleic acid test strip (Biotin-FITC / Digoxin-TAMRA) but no red test line similar to the positive control template appears on test band 2 (T2), and both a red control line (C) and a red test line similar to the positive control template (T) appear on the lateral flow test strip (CRISPR), it indicates that the virus carrying the PLCP gene is positive, but not that the virus is positive for EV-G nucleic acid. If a blue control line and a red test line similar to the positive control template appear simultaneously on both the control band (C) and test band 2 (T2) of the dual-index nucleic acid test strip (Biotin-FITC / Digoxin-TAMRA), and a red control line (C) and a red test line similar to the positive control template (T) appear simultaneously on the lateral flow test strip (CRISPR), then the EV-G nucleic acid with PLCP gene insertion is positive. If a blue control line appears on the control band (C) of the dual-index nucleic acid test strip (Biotin-FITC / Digoxin-TAMRA) but no red test line similar to the positive control template appears on test band 2 (T2), and only a red control line (C) appears on the lateral flow test strip (CRISPR) but no red test line (T) similar to the positive control template appears, the test is considered double negative for EV-G nucleic acid and PLCP gene nucleic acid. Results that do not show a blue control line on the control band (C) of the Biotin-FITC / Digoxin-TAMRA dual-index nucleic acid test strip or a red control line on the control band (C) of the CRISPR lateral flow test strip are invalid and require retesting.

[0028] The specific principle of this invention is as follows: Specific primers and nfo probes for ERA-nfo dual-index nucleic acid detection (Biotin-FITC / Digoxin-TAMRA) are designed targeting the 3D gene sequence of EV-Gs. The 5' end of the downstream primer (3D_R) of the 3D gene is labeled with the TAMRA group; the 5' end of the 3D gene nfo probe (3D_Probe) is labeled with the DIG group; to prevent erroneous extension during amplification, a blocking group C3-spacer is added to the 3' end of the 3D gene nfo probe (3D_Probe); the 31st position of the 3D gene nfo probe (3D_Probe) is THF. Using a positive control as a template, reverse transcription and ERA amplification reactions are performed. The endonuclease IV within the RT-probe type lyophilized microspheres (ERA method) recognizes THF within the nfo probe and cleaves the phosphodiester bond linked to THF, exposing the free hydroxyl terminus. The polymerase within the RT-probe-type lyophilized microspheres (ERA method) reagent lyophilized microspheres continues to synthesize DNA using a cleaved nfo probe as a primer, and labeling groups are continuously incorporated into the amplification products during the amplification process. Specific membrane-borne antibodies on a dual-index nucleic acid detection test strip (Biotin-FITC / Digoxin-TAMRA) identify amplification products containing both TAMRA and DIG groups, resulting in blue control lines (C) and red detection lines (T2) on the control band (C) and corresponding detection band 2 (T2). Specific primers and crRNA were designed for the PLCP gene sequence using an ERA-Cas12a-lateral flow test strip (CRISPR) for detection. Using a positive control as a template, reverse transcription and ERA amplification reactions were performed. The polymerase within the RT-probe type lyophilized microspheres (ERA method) synthesized target DNA using PLCP gene-specific primers (PLCP_F and PLCP_R). After amplification, the reverse transcriptase, recombinase, polymerase, and endonuclease IV in the reverse transcription and ERA amplification system were inactivated by incubation at 85°C for 10 min. Then, a certain concentration of Cas12a protein, crRNA complementary to the target sequence, and FAM and Biotin-labeled reporters were introduced, followed by incubation at 40°C for 30 min, and finally incubation at 85°C for 5 min to inactivate the Cas12a protein. Specific membrane-borne antibodies on CRISPR lateral flow test strips recognized the FAM and Biotin groups, resulting in red control lines (C) and red test lines appearing simultaneously on the control band (C) and the corresponding test band (T).

[0029] Using EV-G genomic cDNA with PLCP gene insertion as a template, the amplification products of the 3D gene Q5 high-fidelity enzyme and the PLCP gene Q5 high-fidelity enzyme were amplified, recovered, and purified. The amplification primers are as follows: 3D gene F: 5'-gatatcgaattcctgcagcccttaatgattctgttgctatgagatg-3' (SEQ IDNO.7); 3D gene R: 5'-tctagaactagtggatccccccccagagcatcctgatggcatt-3' (SEQ IDNO.8); PLCP gene F: 5'-gatatcgaattcctgcagcccaatctgtgcaaggtttag-3' (SEQ IDNO.9); PLCP gene R: 5'-tctagaactagtggatccccctcatcaaaaacataccattcac-3' (SEQ IDNO.10) The Q5 high-fidelity enzyme amplification products are 375bp for the 3D gene fragment and 361bp for the PLCP gene fragment.

[0030] The amplification system is as follows: Q5 High-Fidelity 2×Master Mix, 12.5μL; Upstream primer, 10 μmol / L, 1.25 μL; Downstream primer, 10 μmol / L, 1.25 μL; Template, 1.0 μL; ddH2O, 9.0 μL; Total: 25.0 μL.

[0031] The EV-G whole-genome cDNA with PLCP gene insertion was used as a template.

[0032] The amplification procedure is as follows: Pre-denaturation at 98℃ for 30 seconds, for one cycle; denaturation at 98℃ for 10 seconds, annealing for 20 seconds, extension at 72℃ for 20 seconds, for a total of 35 cycles; post-extension at 72℃ for 2 minutes, for one cycle.

[0033] Specifically, the annealing temperature for 3D gene fragment amplification is 53.5℃; and the annealing temperature for PLCP gene fragment amplification is 52.0℃.

[0034] The pBluescript II SK(+) vector was linearized with Sma I restriction endonuclease, and the linearized pBluescript II SK(+) vector was purified and recovered.

[0035] The enzyme digestion system is as follows: pBluescript II SK(+) vector, 2.0 μg; FlyCut ® Sma I, 1.0 μL; 10×FlyCut ® Buffer, 5.0 μL; Add ddH2O to a total volume of 50.0 μL; The enzyme digestion procedure is as follows: 25℃, 16h.

[0036] With LightNing ® DNA Assembly Mix Plus ligated the Q5 high-fidelity enzyme amplification products of the 3D gene and the PLCP gene into the Sma I linearized pBluescript II SK(+) vector, respectively, and verified the constructed plasmids by sequencing to obtain the 3D gene pBluescript II SK(+) plasmid and the PLCP gene pBluescript II SK(+) plasmid.

[0037] The FlyCut connection system is as follows: LightNing ® LightNing DNA Assembly Mix Plus, 5.0μL; Linearized pBluescript II SK(+) vector, 60.0 ng; Insert fragment, 15.0ng; Add ddH2O to a total volume of 10.0 μL; The insert fragment is a high-fidelity amplification product of the 3D gene or the PLCP gene Q5 enzyme; the ligation procedure is as follows: 50℃, 30min.

[0038] The 3D gene pBluescript II SK(+) plasmid and the PLCP gene pBluescript II SK(+) plasmid were linearized using Hind III, respectively, to obtain linearized 3D gene pBluescript II SK(+) plasmid and linearized PLCP gene pBluescript II SK(+) plasmid.

[0039] The enzyme digestion system is as follows: 3D gene pBluescript II SK(+) plasmid or PLCP gene pBluescript II SK(+) plasmid, 2.0 μg; FlyCut ®Hind III, 1.0 μL; 10×FlyCut ® Buffer, 5.0 μL; Add ddH2O to a total volume of 50.0 μL; The enzyme digestion procedure is as follows: 37℃, 16h.

[0040] Using T3 RNA polymerase, the 3D gene fragment and the PLCP gene fragment were transcribed using linearized 3D gene pBluescript II SK(+) plasmid and linearized PLCP gene pBluescript II SK(+) plasmid, respectively, to obtain the corresponding ssRNA fragments. The transcribed ssRNA fragments were purified and recovered as positive control templates.

[0041] The transcription system is as follows: 10×Reaction Buffer, 2.0μL; rNTP mixture, 0.5 mmol / L; Template, 0.2-1.0 μg; RNase Inhibitor, 1.0 U / μL; T3 RNA polymerase, 2.0 μL; Add RNase-free water to a total volume of 20.0 μL; The transcription procedure is as follows: 37℃, 4 hours.

[0042] Finally, ERA-Cas12a primers, probes, crRNA, and kits suitable for rapid on-site detection of EV-Gs with PLCP gene insertion were constructed.

[0043] Compared with the prior art, the beneficial effects of this invention are as follows: (1) The present invention designs primers, nfo probes and crRNA for detecting EV-Gs with PLCP gene insertion, and on this basis constructs an ERA-Cas12a kit that can detect EV-Gs nucleic acid with PLCP gene insertion. The kit has the advantages of being specific, sensitive, rapid, efficient and capable of isothermal amplification and rapid diagnosis on site. (2) The ERA-Cas12a primers, probes, crRNA, and kits for detecting EV-Gs with PLCP gene insertions involved in this invention have high specificity. For example... Figure 1As shown, the 3D gene upstream and downstream primers (3D_F and 3D_R) and the nfo probe (3D_Probe) involved in this invention only produce a specific red detection line 2 (T2) for EV-Gs, and do not cross-react with other species of viruses, including the triple attenuated live vaccine of porcine epidemic diarrhea virus (PEDV), porcine rotavirus (PRoV), and transmissible gastroenteritis coronavirus (TGEV), as well as positive nucleic acids of porcine sapelovirus (PSV), porcine teschovirus (PTV), and porcine circovirus (PToV), which belong to the same family as EV-Gs in the Picornaviridae family. The PLCP gene upstream and downstream primers (PLCP_F and PLCP_R) and crRNA involved in this invention only guide Cas12a protein to cleave the amplification products of two EV-G17-PLCP strains with PLCP gene insertion and PToV positive nucleic acid, producing a specific red detection line (T). However, one EV-G1 strain, two EV-G6 strains without PLCP gene insertion, and PEDV, PRoV, TGEV, PSV, and PTV do not produce a specific red detection line (T). Figure 1 ); (3) In the early stages of EV-G infection in animals, the viral load in their feces is low. The ERA-Cas12a kit for detecting EV-Gs with PLCP gene insertion, as described in this invention, has good detection sensitivity and is suitable for detection in early clinical samples. Sensitivity test results show that the lower limits of detection for EV-G 3D gene and inserted PLCP gene by the ERA-Cas12a primers, probes, crRNA, and kit for detecting EV-Gs with PLCP gene insertion, as described in this invention, are 5.2 copies / μL and 5.5 copies / μL, respectively (e.g., ...). Figure 2 ); (4) Since the 3D sequences of EV-Gs are highly conserved, this invention designs primers for the 3D sequences of EV-Gs strains. The ERA-Cas12a kit of this invention was used to detect EV-Gs strains, and the detection results were 100% consistent with the virus isolation and identification results (Table 2), indicating that the detection kit of this invention can effectively detect all EV-Gs strains isolated in this laboratory. In the application example, the ERA-Cas12a kit of this invention was used to detect 50 piglet fecal samples, and the results were 98.0% consistent with the qRT-PCR detection method for EV-Gs and 92.9% consistent with the RT-PCR detection method for PLCP genes (Table 3). This shows that the ERA-Cas12a primers, probes, crRNA and kit of this invention can not only be used for clinical sample detection, but also have good sensitivity, specificity and reliability, and can be used for rapid on-site diagnosis of EV-Gs-related diseases. (5) Although there are reports by Li Zhanhong et al. on qRT-PCR and LAMP detection methods designed for the 5' uncoding region of EV-Gs, the qRT-PCR detection method requires expensive instruments (about 300,000 yuan), the experimental operation requires professional technicians, and the qRT-PCR detection process requires temperature cycling processes such as denaturation (95℃) and extension (72℃), which places high demands on a stable power supply. Therefore, it is difficult to apply the qRT-PCR detection method to rapid on-site diagnosis. The ERA-Cas12a primers, probes, crRNA, and kit for detecting EV-Gs with PLCP gene insertion involved in this invention can not only complete the amplification reaction under low temperature and isothermal (41℃) conditions, but also has a fast detection speed. The entire detection process (including reverse transcription and ERA amplification, enzyme inactivation, detection by a dual-index nucleic acid test strip (Biotin-FITC / Digoxin-TAMRA), Cas12a protein cleavage, Cas12a protein inactivation, and detection by a lateral flow test strip (CRISPR)) can be completed within 60-70 minutes. Furthermore, this detection kit does not require expensive instruments and equipment; the detection results can be determined directly by visual inspection, greatly facilitating rapid on-site detection. In addition, the detection sensitivity of the ERA-Cas12a kit for detecting EV-Gs with PLCP gene insertion involved in this invention is 100 copies / μL, which is higher than the 101 copies / μL of the qRT-PCR detection method. (6) The EV-Gs visualization LAMP detection method involved by Li Zhanhong et al. can also achieve rapid on-site diagnosis of EV-Gs. Compared with the above-mentioned EV-Gs visualization LAMP detection method, the ERA-Cas12a primers, probes, crRNA and kits involved in this invention have the advantage of being able to simultaneously detect whether PLCP gene insertion exists, which doubles the work efficiency. In addition, the detection sensitivity of the ERA-Cas12a kit for detecting EV-Gs with PLCP gene insertion involved in this invention is 100 copies / μL, which is also higher than the 101 copies / μL of the visualization LAMP detection method. Attached Figure Description

[0044] Figure 1 The specificity test results of the ERA-Cas12a kit involved in this invention are shown in the figure; from left to right: 1 EV-G1 strain, 2 EV-G6 strains, 2 EV-G17-PLCP strains, PEDV, PRoV and TGEV trivalent attenuated live vaccine strains, PSV strain, PTV strain and PToV positive nucleic acid and negative control were used as templates for specificity analysis; Figure 2 The sensitivity test results of the ERA-Cas12a kit involved in this invention are shown in the figure; from left to right: the concentrations are 5.2 × 10⁻⁶. 8 Copies / μL ~ 5.2 × 10⁻⁶ 0 Positive control: EV-G 3D gene ssRNA fragment (copy / μL) and 5.5 × 10⁻⁶ copies / μL. 8 Copies / μL ~ 5.5 × 10⁻⁶ 0 Sensitivity analysis was performed using positive and negative controls of PLCP gene ssRNA fragments (copies / μL) as templates. Detailed Implementation

[0045] The present invention will now be described in further detail with reference to the embodiments.

[0046] Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be construed as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed in accordance with the techniques or conditions described in the literature in the field or according to the product instructions. Materials or equipment whose manufacturers are not specified are all conventional products that can be obtained by purchase.

[0047] (1) Experimental materials EV-Gs strains are documented in First Identification and Pathogenicity Evaluation of an EV-G17 Strain Carrying a Torovirus Papain-like Cysteine ​​Protease (PLCP)Gene in China, Zhan-Hong Li, Zhuo-Ran Li, Pei Zhu, Zhen-Xing Zhang, Jian-LingSong, Viruses, 2023, 15: 1747 and First isolation, identification, and pathogenicity evaluation of an EVG6 strain in China, Pei Zhu, Zhan-Hong Li, Zhuo-Ran Li, Zhen-Xing Zhang, Jian-Ling Song, Frontiers in Veterinary Science, 2024, 11: 1431180; PSV strain is recorded in First Isolation and Characterization of Three Strains of PorcineSapelovirus in Yunnan Province, China, Pei Zhu, Zhanhong Li, Zhuoran Li, Li Meng, Peng Liu, Xiutao Sun, Qi Yang, Jianling Song, Viruses, 2025, 17: 505; The above-mentioned EV-Gs and PSV strains are available to the public from the Yunnan Academy of Animal Science and Veterinary Medicine. Commercially available PEDV, PRoV, and TGEV trivalent attenuated live vaccines are manufactured by Jilin Zhengye Biological Products Co., Ltd. The EV-G 3D gene ssRNA fragment and the PLCP gene ssRNA fragment were prepared by the Yunnan Academy of Animal Science and Veterinary Medicine according to the method for preparing the positive control template of this invention.

[0048] (2) Reagents and instruments MagMAX TM -96 Viral RNA Isolation Kit purchased from Thermo Fisher Scientific; HiPure Gel Pure DNA mini Kit purchased from Guangzhou Meiji Biotechnology Co., Ltd.; LightNing ®DNAAssembly Mix Plus was purchased from Jiangsu Baishimei Biotechnology Co., Ltd.; GoldView II (100×) and agarose were purchased from Solarbio; RNAeasy TM Viral RNA extraction kit and carrier RNA were purchased from Beyotime Biotechnology; FlyCut ® Sma Ⅰ and FlyCut ® Hind III restriction endonucleases were purchased from TransGen Biotech; PrimeScript TM RT reagent Kit with gDNA Eraser (Perfect Real Time), TB Green ® Premix Ex Taq TM II (Tli RNaseH Plus) and Premix Taq TM (TaKaRa Taq TM Version 2.0) was purchased from TaKaRa Bio; Q5 ® High-Fidelity 2× Master Mix, T3 RNA polymerase, rNTP mixture, mouse RNase inhibitor, and Monarch ® The RNA purification kit using the centrifugation column method was purchased from NEB; the RT-probe type lyophilized microsphere (ERA method) kit, dual-index nucleic acid detection strips (Biotin-FITC / Digoxin-TAMRA), Cas12a protein (10 μmol / L), FAM / Biotin reporter and lateral flow detection strips (CRISPR) were purchased from Suzhou Xianda Gene Technology Co., Ltd.

[0049] KingFisher Flex platform (Thermo Fisher Scientific); Veriti 96 Well Thermal Cycler gradient PCR instrument (ABI); ABI QuantStudio3 real-time quantitative PCR instrument (ABI); Nano Vue Plus UV spectrophotometer (GE); OSE-96 dry thermostatic metal bath (Tiangen Biotech Co., Ltd.); 1-14 benchtop centrifuge (Sigma).

[0050] (3) Design primers and nfo probes Specific primers, nfo probes, and crRNA were designed for the detection of EV-Gs with PLCP gene insertions using the ERA-nfo-Cas12a-lateral flow test strip targeting the EV-G 3D gene and the inserted PLCP gene sequence. The 5' end of the downstream primer of the 3D gene was labeled with the TAMRA group; the 5' end of the nfo probe was labeled with the DIG group; a blocking group C3-spacer was added to the 3' end of all nfo probes; and THF was added to position 31 of the nfo probe. The sequences of the primers, nfo probes, and crRNA are shown in Table 1.

[0051] Table 1. Primer, nfo probe, and crRNA sequence information used in the ERA-Cas12a kit involved in this invention.

[0052] (4) Preparation of positive control template Based on the whole genome sequence of EV-Gs with PLCP gene insertion in NCBI (accession number: OQ988093), two pairs of specific primers were designed: 3D gene F: 5'-gatatcgaattcctgcagcccttaatgattctgttgctatgagatg-3' (SEQ IDNO.7); 3D gene R: 5'-tctagaactagtggatccccccccagagcatcctgatggcatt-3' (SEQ IDNO.8); PLCP gene F: 5'-gatatcgaattcctgcagcccaatctgtgcaaggtttag-3' (SEQ IDNO.9); PLCP gene R: 5'-tctagaactagtggatccccctcatcaaaaacataccattcac-3' (SEQ IDNO.10) The two primer pairs described above were used to amplify the EV-G 3D gene fragment and the PLCP gene fragment, with amplification product lengths of 375 bp and 361 bp, respectively. The nucleic acid sequences obtained by PCR amplification are shown in SEQ ID NO.11 and SEQ ID NO.12.

[0053] The specific method is as follows: Use "RNAeasy" TM Viral RNA extraction kit and Carrier RNA (Beyotime Biotechnology) were used to extract and isolate EV-G genomic RNA with PLCP gene insertion, and the RNA was extracted according to PrimeScript.TM The instructions for the RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara Bio) show that the above genomic RNA is reverse transcribed into cDNA to obtain EV-G whole-genome cDNA with PLCP gene insertion.

[0054] The reverse transcription system is as follows: 5×PrimeScript RT Master Mix, 2.0μL; 5.0 μL of extracted EV-G genomic RNA with PLCP gene insertion; RNase-free water, 3.0μL; Total: 10.0 μL.

[0055] The reverse transcription procedure is as follows: Reverse transcription: 37℃, 15 min, 1 cycle; Reverse transcriptase inactivation: 85℃, 5 s, 1 cycle.

[0056] Using the aforementioned 3D gene fragment amplification primer pair (3D gene F and 3D gene R) and PLCP gene fragment amplification primer pair (PLCP gene F and PLCP gene R), with EV-G whole-genome cDNA containing PLCP gene insertion as a template, according to "Q5 ® The 3D gene fragment and the PLCP gene fragment were amplified separately using the High-Fidelity 2× Master Mix (NEB) instructions, resulting in the 3D gene Q5 high-fidelity enzyme amplification product (SEQ ID NO.11) and the PLCP gene Q5 high-fidelity enzyme amplification product (SEQ ID NO.12).

[0057] The amplification system is as follows: Q5 High-Fidelity 2×Master Mix, 12.5μL; Upstream primer, 10 μmol / L, 1.25 μL; Downstream primer, 10 μmol / L, 1.25 μL; Template, 1.0 μL; ddH2O, 9.0 μL; Total: 25.0 μL.

[0058] The amplification procedure is as follows: Pre-denaturation at 98℃ for 30 seconds, for one cycle; denaturation at 98℃ for 10 seconds, annealing for 20 seconds, extension at 72℃ for 20 seconds, for a total of 35 cycles; post-extension at 72℃ for 2 minutes, for one cycle.

[0059] Specifically, the annealing temperature for 3D gene fragment amplification is 53.5℃; and the annealing temperature for PLCP gene fragment amplification is 52.0℃.

[0060] according to" Sma Linearize pBluescript II SK(+) vector according to the instructions of "I Restriction Endonuclease" (TransGen Biotech).

[0061] The enzyme digestion system is as follows: pBluescript II SK(+) vector, 2.0 μg; FlyCut ® Sma I, 1.0 μL; 10× FlyCut ® Buffer, 5.0 μL; Add ddH2O to a total volume of 50.0 μL; The enzyme digestion procedure is as follows: 25℃, 16h.

[0062] Following the instructions of the "HiPure Gel Pure DNAmini Kit" (Guangzhou Meiji Biotechnology Co., Ltd.), the 3D gene Q5 high-fidelity enzyme amplification product (SEQ ID NO.11), the PLCP gene Q5 high-fidelity enzyme amplification product (SEQ ID NO.12), and the linearized pBluescript II SK(+) vector were recovered and purified. Following the instructions of "LightNing..." ® The DNAAssembly Mix Plus (Jiangsu Baishimei Biotechnology Co., Ltd.) instructions specify that the 3D gene Q5 high-fidelity enzyme amplification product (SEQ ID NO.11) and the PLCP gene Q5 high-fidelity enzyme amplification product (SEQ ID NO.12) are respectively ligated... Sma The plasmids were linearized into the pBluescript II SK(+) vector and validated by sequencing to obtain the 3D gene pBluescript II SK(+) plasmid and the PLCP gene pBluescript II SK(+) plasmid.

[0063] The connection system is as follows: LightNing ® DNA Assembly Mix Plus, 5.0μL; Linearized pBluescript II SK(+) vector, 60.0 ng; Insert fragment, 15.0ng; Add ddH2O to a total volume of 10.0 μL; The inserted fragment is the 3D gene (SEQ ID NO.11) or the PLCP gene Q5 high-fidelity enzyme amplification product (SEQ ID NO.12). The connection procedure is as follows: 50℃, 30min.

[0064] according to" Hin The 3D gene pBluescript II SK(+) plasmid and the PLCP gene pBluescript II SK(+) plasmid were linearized according to the instructions of "d III restriction endonuclease" (TransGen Biotech), respectively, to obtain linearized 3D gene pBluescript II SK(+) plasmid and linearized PLCP gene pBluescript II SK(+) plasmid.

[0065] The enzyme digestion system is as follows: 3D gene pBluescript II SK(+) plasmid or PLCP gene pBluescript II SK(+) plasmid, 2.0 μg; FlyCut ® Hin d Ⅲ, 1.0 μL; 10× FlyCut ® Buffer, 5.0 μL; Add ddH2O to a total volume of 50.0 μL; The enzyme digestion procedure is as follows: 37℃, 16h.

[0066] Following the instructions of the "HiPure Gel Pure DNAmini Kit" (Guangzhou Meiji Biotechnology Co., Ltd.), the linearized 3D gene pBluescript II SK(+) plasmid and the linearized PLCP gene pBluescript II SK(+) plasmid were recovered and purified. Using T3 RNA polymerase (NEB), the 3D gene fragment and the PLCP gene fragment were transcribed using the linearized 3D gene pBluescript II SK(+) plasmid and the linearized PLCP gene pBluescript II SK(+) plasmid as templates to obtain the corresponding ssRNA fragments.

[0067] The transcription system is as follows: 10×Reaction Buffer, 2.0μL; rNTP mixture, 0.5 mmol / L; Template, 0.5 μg; RNase Inhibitor, 1.0 U / μL; T3 RNA polymerase, 2.0 μL; Add RNase-free water to a total volume of 20.0 μL; The transcription procedure is as follows: 37℃, 4 hours.

[0068] According to "Monarch" ® The transcribed ssRNA fragments purified using the "Centrifugation Column RNA Purification Kit" (NEB) served as positive control templates, with concentrations of 12.2 ng / μL for the 3D gene ssRNA fragment and 12.5 ng / μL for the PLCP gene ssRNA fragment. The ssRNA copy number was calculated using the formula: Copy number (copies / μL) = ssRNA concentration (ng / μL) × 6.02 × 10⁻⁶. 23 (copy / mol) × 10 -9 The copy numbers of the EV-G 3D gene and the PLCP gene positive control templates were calculated using the formula (340 × transcribed ssRNA bases), and were 5.2 × 10⁻⁶. 10 copies / μL and 5.5×10 10 Copy / μL.

[0069] (5) Specificity analysis Using “RNAeasy TM Genomic RNA was extracted from one EV-G1 strain, two EV-G6 strains, two EV-G17-PLCP strains, a PEDV, PRoV and TGEV trivalent attenuated live vaccine strain, a PSV strain and a PTV strain using a viral RNA extraction kit and Carrier RNA (Beyotime Biotechnology).

[0070] Using 5.0 μL of the viral genomic RNA as a template, reverse transcription and ERA amplification reactions were performed according to the instructions of the "RT-Probe-Type Lyophilized Microspheres (ERA Method) Kit" (Suzhou Xianda Gene Technology Co., Ltd.) to obtain the corresponding ERA amplification products.

[0071] The reverse transcription and ERA amplification system is as follows: RT-probe type lyophilized microspheres (ERA method), 1 tube; Upstream primer 3D_F, 10 μmol / L, 1.5 μL; Downstream primer 3D_R, 10 μmol / L, 1.5 μL; Upstream primer PLCP_F, 10 μmol / L, 2.0 μL; Downstream primer PLCP_R, 10 μmol / L, 2.0 μL; nfo probe 3D_Probe, 10μmol / L, 0.5μL; The above-mentioned viral genomic RNA, 5.0 μL; Activator MC, 2.0 μL; RNase-free water, 35.5μL; Total: 50.0 μL.

[0072] The reverse transcription and ERA amplification program was as follows: 41℃, 15 min, for one cycle; inactivation of reverse transcriptase, recombinase, polymerase and endonuclease IV: 85℃, 10 min, for one cycle.

[0073] Take the above ERA amplification reaction products and perform amplification product detection and result determination according to the instructions of "Dual Index Nucleic Acid Test Strip (Biotin-FITC / Digoxin-TAMRA)" (Suzhou Xianda Gene Technology Co., Ltd.).

[0074] The testing system is as follows: ERA amplification product, 5.0 μL; ddH2O, 200.0 μL; Total: 205.0 μL; Insert the dual-index nucleic acid test strip (Biotin-FITC / Digoxin-TAMRA) into the above detection system for testing. Note that the liquid level should not exceed the Max line of the dual-index nucleic acid test strip (Biotin-FITC / Digoxin-TAMRA).

[0075] The testing procedure is as follows: room temperature, 7-10 minutes.

[0076] Subsequently, a certain concentration of Cas12a protein, crRNA, and FAM / Biotin reporter was introduced into the above ERA reaction solution to cleave the ERA amplification product.

[0077] The Cas12a protein cleavage system is as follows: ERA amplification product, 45.0 μL; 10×Reaction Buffer, 6.0μL; Cas12a protein, 10 μmol / L, 2.0 μL; FAM / Biotin reporter, 100 μmol / L, 0.6 μL; crRNA, 10 μmol / L, 0.6 μL; ddH2O, 5.8 μL; Total: 60.0 μL; The cleavage procedure was as follows: 40℃, 30 min, for one cycle; Cas12a protein inactivation: 85℃, 5 min, for one cycle; Cas12a protein cleavage product was obtained. The testing system is as follows: Cas12a protein cleavage product, 30.0 μL; ddH2O, 30.0 μL; Total: 60.0 μL; Insert the CRISPR lateral flow test strip into the detection system for the PLCP gene described above for detection. The liquid level should not exceed the Max line of the CRISPR lateral flow test strip. The testing procedure is as follows: room temperature, 7-10 minutes.

[0078] Based on the specificity analysis of the above two steps of detection results, the ERA-Cas12a primers, probes, crRNA, and kits for detecting EVs with PLCP gene insertions involved in this invention can specifically detect one EV-G1 strain without PLCP gene insertion, two EV-G6 strains, two EV-G17-PLCP strains with PLCP gene insertion, and PToV positive nucleic acid. There is no cross-reactivity with PEDV, PRoV, and TGEV trivalent attenuated live vaccine strains, PSV strains, and PTV strains. Figure 1 .

[0079] (6) Sensitivity analysis Using the ERA-Cas12a kit with EV-Gs containing PLCP gene insertion as described in this invention, 2.5 μL of the sample prepared in (4) had a copy number of 5.2 × 10⁻⁶. 8 Copies / μL, 5.2 × 10 6 Copies / μL, 5.2 × 10 4 Copies / μL, 5.2 × 10 2 Copies / μL, 5.2 × 10 1 copies / μL and 5.2×10 0 The copy number of the EV-G 3D gene ssRNA fragment per 2.5 μL was 5.5 × 10⁻⁶ copies / μL. 8 Copies / μL, 5.5 × 10 6 Copies / μL, 5.5 × 10 4 Copies / μL, 5.5 × 10 2 Copies / μL, 5.5 × 10 1 copies / μL and 5.5×10 0Sensitivity analysis was performed using PLCP gene ssRNA fragments (copy / μL) as positive and negative control templates. The detection limits of the ERA-Cas12a primers, probes, crRNA, and kits for detecting EV-Gs with PLCP gene insertions involved in this invention are 5.2 copies / μL of EV-G 3D gene ssRNA fragments and 5.5 copies / μL of PLCP gene ssRNA fragments. Figure 2 .

[0080] The reverse transcription and ERA amplification system is as follows: RT-probe type lyophilized microspheres (ERA method), 1 tube; Upstream primer 3D_F, 10 μmol / L, 1.5 μL; Downstream primer 3D_R, 10 μmol / L, 1.5 μL; Upstream primer PLCP_F, 10 μmol / L, 2.0 μL; Downstream primer PLCP_R, 10 μmol / L, 2.0 μL; nfo probe 3D_Probe, 10μmol / L, 0.5μL; EV-G 3D gene positive control template, 2.5 μL; PLCP gene positive control template, 2.5 μL; Activator MC, 2.0 μL; RNase-free water, 35.5μL; Total: 50.0 μL.

[0081] Application Examples A. Detection of EV-Gs strains using the ERA-Cas12a kit involved in this invention. The ERA-Cas12a kit for detecting EV-Gs with PLCP gene insertion, as described in this invention, was used to detect five EV-Gs belonging to three serotypes. The ERA-Cas12a primers, probes, crRNA, and kit for detecting EV-Gs with PLCP gene insertion involved in this invention can effectively detect all serotypes of EV-Gs and EV-Gs with PLCP gene insertion, with a 100% concordance rate with the virus isolation and identification results, as detailed in Table 2.

[0082] Table 2. Results of EV-Gs strain detection using the ERA-Cas12a kit involved in this invention.

[0083] B. Detection of clinical stool samples using the ERA-Cas12a kit and qRT-PCR method disclosed in this invention. According to "MagMAX" TM The instructions for the "-96 Viral RNA Isolation Kit" (Thermo Fisher Scientific) were used to extract total RNA from 50 piglet fecal samples.

[0084] A 5 μL fecal sample of total RNA was taken and subjected to reverse transcription and ERA amplification according to the instructions of the "RT-Probe-Type Lyophilized Microspheres (ERA Method) Kit" (Suzhou Xinda Gene Technology Co., Ltd.). The amplification products were then inactivated at 85℃ for 10 min by reverse transcriptase, recombinase, polymerase, and endonuclease IV. A dual-index nucleic acid detection strip (Biotin-FITC / Digoxin-TAMRA) (Suzhou Xinda Gene Technology Co., Ltd.) was used to detect the amplification products. Cas12a protein (Suzhou Xinda Gene Technology Co., Ltd.), crRNA, and FAM / Biotin reporter (Suzhou Xinda Gene Technology Co., Ltd.) were added to the above ERA reaction solution, and Cas12a protein was cleaved at 40℃ for 30 min. Then, Cas12a protein was inactivated at 85℃ for 5 min. Cas12a protein cleavage products were detected using a CRISPR lateral flow detection strip (Suzhou Xinda Gene Technology Co., Ltd.).

[0085] According to PrimeScript TM The total RNA from the above fecal samples was reverse transcribed into cDNA using the RT reagent kit with gDNA Eraser (Perfect Real Time) (Takara Bio). The EV-GsqRT-PCR primers reported by Li Zhanhong et al. were then used according to the "TB Green" standard. ® Premix Ex Taq TM The instructions for use of "II (Tli RNaseH Plus)" (Takara Bio) also include the detection of cDNA in the above-mentioned fecal samples.

[0086] The ERA-Cas12a primers, probes, crRNA, and kits for detecting EV-Gs with PLCP gene insertions involved in this invention can effectively detect fecal samples containing EV-Gs nucleic acid, with a concordance rate of 98.0% with qRT-PCR detection results, as shown in Table 3.

[0087] The RT-PCR primer pairs for detecting the PLCP gene, RT-PCR_F: agcaacgtattgaacctgtctg (SEQ ID NO. 13) and RT-PCR_R: gttgggaagttgtacatcatggt (SEQ ID NO. 14), were used according to the following formula: Premix TaqTM ( TaKaRa Taq TM According to the instructions of Takara Bio (Version 2.0), cDNA was amplified from 28 EV-Gs nucleic acid positive samples in 50 piglet fecal samples. The amplification program was: 98℃, 10s, 56℃, 1min, 72℃, 2min, for a total of 35 cycles. The amplified products were then detected by agarose gel electrophoresis. The amplified product without the PLCP gene was 1369bp in length, and the amplified product containing the PLCP gene was 2038bp in length. The nucleic acid sequence of the amplified product without the PLCP gene obtained by RT-PCR is shown in SEQ ID NO.15, and the nucleic acid sequence of the amplified product containing the PLCP gene is shown in SEQ ID NO.16. The ERA-Cas12a primers, probes, crRNA, and kits for detecting EV-Gs with PLCP gene insertion involved in this invention can effectively detect fecal samples containing EV-Gs nucleic acid with PLCP gene insertion, with a concordance rate of 92.9% with the RT-PCR detection results, as shown in Table 3.

[0088] Table 3. Results of clinical stool samples tested using the ERA-Cas12a kit, qRT-PCR, and RT-PCR method described in this invention.

[0089] Different detection methods have different sensitivities, and the method designed in this invention has higher sensitivity. Compared with the other two methods, the method involved in this invention detects EV-G positive samples by qRT-PCR, while the RT-PCR method detects PLCP positive samples within EV-G positive samples. There were 28 common positive samples (6 in total), and 21 common negative samples (20 in total), meaning the number of matching samples was 28 + 21 = 49 (6 + 20 = 26), and the number of non-matching samples was 1 (2 in total). The matching rate is 49 / 50 × 100% = 98.0% (26 / 28 × 100% = 92.9%).

[0090] Primer sequences, nfo probe sequences, and crRNA sequences derived from the primer pairs, nfo probes, and crRNA of this invention are also within the scope of protection of this invention. Derived sequences refer to primer sequences obtained by substituting, deleting, or adding one to ten bases based on SEQ ID NO.1 to SEQ ID NO.6.

[0091] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. Primers for detecting PLCP gene insertion into EV-G's ERA-Cas12a, characterized in that, Including the ERA-nfo dual-index nucleic acid detection test strip primer pair for the EV-G 3D gene and the ERA-Cas12a lateral flow test strip primer pair for the PLCP gene; The primer pair for the ERA-nfo dual-index nucleic acid detection test strip for the EV-G 3D gene includes the upstream primer 3D_F and the downstream primer 3D_R, with the following nucleotide sequences: Upstream primer 3D_F: ttaatgattctgttgctatgagatgctattt; (SEQ ID NO.1); Downstream primer 3D_R: TAMRA-cagagcatcctgatggcattcctcccttaac; (SEQ ID NO.2); The primer pair for ERA-Cas12a-lateral flow test strip detection of the PLCP gene includes the upstream primer PLCP_F and the downstream primer PLCP_R, with the following nucleotide sequences: Upstream primer PLCP_F: aatctgtgcaaggtttagtctatcgttttg; (SEQ ID NO.3); Downstream primer PLCP_R: tcatcaaaaacataccattcaccattaagtt; (SEQ ID NO.4).

2. A probe used in conjunction with the primers for detecting PLCP gene insertion into EV-G's ERA-Cas12a as described in claim 1, characterized in that, The probe in question is an NFO probe; The nucleotide sequence of the nfo probe is as follows: 3D_Probe:DIG-tgtttgaggcccttcagatggttcttgaga[THF]aattggatttggaga[C3-spacer]; (SEQ ID NO. 5).

3. The crRNA used in conjunction with the primers for detecting PLCP gene insertion into EV-G's ERA-Cas12a as described in claim 1, characterized in that, The crRNA nucleotide sequence is as follows: crRNA: uaauuucuacuaaguguagaugagaacaacaugaugcaguuga; (SEQ ID NO. 6).

4. A kit containing the primers for detecting PLCP gene insertion into EV-G as described in claim 1, the probe as described in claim 2, and the crRNA as described in claim 3.

5. The reagent kit according to claim 4, characterized in that, Also includes: Negative control template, positive control template, reverse transcription and ERA amplification reagents, dual-index nucleic acid detection test strips, Cas12a protein, FAM / Biotin reporter and lateral flow detection test strips.

6. The reagent kit as described in claim 5, characterized in that, The negative control template is RNase-free water; the positive control template is the ssRNA fragment of the EV-G 3D gene and the ssRNA fragment of the PLCP gene; the reverse transcription and ERA amplification reagents include RT-probe type lyophilized microspheres, activator MC and RNase-free water.

7. The kit according to claim 6, characterized in that, The copy number of the positive control template was 5.2 × 10⁻⁶ for the EV-G 3D gene ssRNA fragment. 10 The copy number of the PLCP gene ssRNA fragment is 5.5 × 10⁻⁶ copies / μL. 10 The concentration of Cas12a protein was 10 μmol / L, and the concentration of FAM / Biotin reporter was 100 μmol / L.

8. The reagent kit as described in claim 6, characterized in that, The reverse transcription and ERA amplification system of the kit is as follows: RT-probe type lyophilized microspheres, 1 tube; Upstream primer 3D_F, 10 μmol / L, 1.5 μL; Downstream primer 3D_R, 10 μmol / L, 1.5 μL; Upstream primer PLCP_F, 10 μmol / L, 2.0 μL; Downstream primer PLCP_R, 10 μmol / L, 2.0 μL; nfo probe 3D_Probe, 10μmol / L, 0.5μL; Total RNA extracted from the sample to be tested, 5.0 μL; Activator MC, 2.0 μL; RNase-free water, 35.5μL; Total: 50.0 μL; The reverse transcription and ERA amplification program was as follows: 41℃, 15 min, for one cycle; ERA amplification products were obtained; reverse transcriptase, recombinase, polymerase and endonuclease IV were inactivated: 85℃, 10 min, for one cycle.

9. The reagent kit as described in claim 8, characterized in that, The detection system for the EV-G 3D gene in the kit described above is as follows: ERA amplification product, 5.0 μL; ddH2O, 200.0 μL; Total: 205.0 μL; Insert the dual-index nucleic acid test strip into the EV-G 3D gene detection system for detection. The liquid level should not exceed the Max line of the dual-index nucleic acid test strip. The testing procedure is as follows: room temperature, 7-10 minutes.

10. The kit according to claim 8, characterized in that: The cleavage system for the PLCP gene Cas12a protein in the kit described above is as follows: ERA amplification product, 45.0 μL; 10×Reaction Buffer, 6.0μL; Cas12a protein, 10 μmol / L, 2.0 μL; FAM / Biotin reporter, 100 μmol / L, 0.6 μL; crRNA, 10 μmol / L, 0.6 μL; ddH2O, 5.8 μL; Total: 60.0 μL; The cutting procedure is: 40℃, 30min, for a total of 1 cycle; Obtain the Cas12a protein cleavage product; Cas12a protein inactivation: 85℃, 5 min, for 1 cycle; The detection system for the PLCP gene in the kit is as follows: Cas12a protein cleavage product, 30.0 μL; ddH2O, 30.0 μL; Total: 60.0 μL; Insert the lateral flow test strip into the detection system for the PLCP gene described above for detection. The liquid level should not exceed the Max line of the lateral flow test strip. The testing procedure is as follows: room temperature, 7-10 minutes.