Construction method and application of DNA library with modified nucleotide

Abstract

The invention relates to a method for detecting DNA modification, in particular to a construction method of a DNA library with modified nucleotide, a detection method, a kit set and application. According to the scheme provided by the invention, the necessity of designing degenerate primers is avoided, the design difficulty of multiple primers is greatly reduced, the specificity of multiple PCR amplification is improved, and the formation of primer dimers is reduced.

Description

Technical Field

[0001] This application belongs to the field of library construction technology and relates to a method for detecting DNA modifications, specifically a method for constructing a DNA library with modified nucleotides, a detection method, a reagent kit, and its application. Background Technology

[0002] DNA modifications, such as methylated DNA, have become important biomarkers and prognostic indicators. Accurate qualitative and quantitative verification of DNA methylation levels is of great value for both clinical applications and basic scientific research, leading to the development of numerous DNA methylation analysis methods. Next-generation sequencing (NGS) technology provides single-base resolution of CpG methylation levels with high statistical significance. Bisulfite-based methylation next-generation sequencing technologies mainly include whole-genome bisulfite sequencing (WGBS), reduced bisulfite sequencing (RRBS / dRRBS / XRBS), multiplex PCR-based targeted methylation sequencing (MBPS), and (h)MeDIP-seq, among others. While whole-genome bisulfite sequencing (WGBS) can detect single-base methylation levels across the entire genome at high resolution, its drawbacks include a certain requirement for large sample sizes of input DNA, high cost, and the need for substantial computational resources. Compared to WGBS, Reduced Representation Bisulfite Sequencing (RRBS) is less expensive. It reduces sequencing redundancy by obtaining partial genome sequences (6%-12% CpGs), primarily covering promoter regions and repetitive sequences that are relatively difficult to analyze using conventional methods. However, the restriction endonucleases used in RRBS cannot cover all CpG-rich regions of the genome, and some regions have very low depths. The non-proofreading polymerases used in the PCR step also increase PCR sequencing errors in RRBS. In contrast, Hi-MethylSeq technology directs sequencing to more information-rich parts of the genome, thus reducing costs and becoming the preferred method for cost-effective and targeted analysis of the human methylome at base-pair resolution. Multiplex Bisulphite PCR Sequencing (MBPS) is currently the most cost-effective, scalable, and reproducible methylation detection protocol, widely used for methylation biomarker screening, validation, and clinical translation applications.

[0003] Bisulfite (BS) conversion is a core step in DNA methylation detection. Treating DNA with sodium bisulfite converts all unmethylated cytosine (C) to uracil (U), while methylated cytosine remains unchanged. Because bisulfite conversion causes extreme alterations to the DNA sequence, methylation-targeted capture has developed two technical routes: pre-BS capture and post-BS capture. The order of conversion and capture leads to differences in probe design; the former captures the normal genome, while the latter targets the BS-converted sequence. Pre-BS capture involves capturing a pre-library before BS conversion, when the genome's base diversity, Tm value, and GC content are relatively normal, effectively avoiding the extreme sequence modifications caused by BS conversion. However, since current PCR technology cannot replicate C base methylation, pre-BS capture cannot perform PCR enrichment (PCR-free) before capture. The lack of signal amplification from the pre-library amplification process may lead to template loss, directly affecting detection sensitivity. Primer design for Post-BS Capture targets sequences transformed by BS. After BS treatment, the richness of genome sequences decreases, primer specificity is not easily guaranteed, and Tm values ​​and GC content become particularly extreme, making primer design even more difficult.

[0004] Primer design and PCR amplification of target genomic regions using conventional bisulfite multiplex PCR-CPR techniques can enrich target regions. Multiplex detection with PCR primers in a single reaction allows for the generation of multiple amplicons in a single bisulfite PCR reaction. Nested PCR can also be used to perform two rounds of PCR amplification of the target gene with two sets of primers, further increasing the sensitivity and reliability of detection. This allows for the simultaneous querying and generation of methylation data for multiple target regions in a single experiment. Anchored multiplex PCR targeted sequencing technology can also be used. Universal adapters are pre-added to the DNA template, and the 5' adapter is used as an anchoring primer to anchor the target-specific nested primers to one side, resulting in efficient and specific amplification of nucleic acid fragments. This has significant advantages in targeted methylation sequencing. Simultaneous amplification of multiple targets in a single PCR reaction, combined with high-throughput sequencing technology, allows for the detection of the methylation status of multiple genes.

[0005] However, the development of multiplex assays is often complicated by challenges associated with complex PCR mixtures, such as primer dimers and PCR competition. Methylation detection methods typically target high-GC-content regions, which can exacerbate primer dimers or secondary structures, leading to performance degradation. The greatest technical challenge lies in primer design. Methylated libraries are more complex, containing many repetitive regions after transformation, with a higher proportion of dimers than in conventional multiplex PCR. CpG is present within the primer-binding region, and a common solution is to replace the bases at the cytosine position for degeneracy. Methylated and unmethylated regions have different nucleotide sequence compositions after bisulfite transformation, meaning that for certain regions, unmethylated (T-rich) or methylated (C-rich) sequences may be preferentially amplified. Amplification bias towards specific sequences will significantly affect the accuracy of methylation quantification. Methylation-specific single-end anchored multiplex PCR amplicon sequencing technology utilizes a 5' end-specific universal adapter and relies on degenerate primers designed at the 3' end region after bisulfite or enzymatic transformation of the DNA template for targeted amplification. Therefore, the greatest technical challenge remains primer design.

[0006] Therefore, how to perform PCR amplification after transformation of modified DNA, fully amplify the signal, and ensure high-quality capture in the subsequent process is an urgent problem to be solved in targeted modification amplicon sequencing. Summary of the Invention

[0007] This application aims to at least address one of the aforementioned technical problems existing in the prior art. In view of this, this application provides a method for constructing a DNA library with modified nucleotides, a detection method, a reagent kit, and its application.

[0008] According to one aspect of this application, a method for constructing a DNA library with modified nucleotides is provided, comprising the following steps:

[0009] DNA single-strand substitution: A DNA double-stranded fragment is provided, and a new strand complementary to the 5' end sequence is formed at the 3' end of the DNA double-stranded fragment to obtain a DNA double-stranded product, wherein the nucleotides in the new strand that have the same base as the target modified nucleotide are all modified nucleotides;

[0010] Adapter ligation: The DNA double-stranded product is ligated to a double-linker to obtain a ligation product; wherein at least one single strand of the double-linker is a adapter-substituted single strand, and the nucleotides in the adapter-substituted single strand that have the same base as the target modified nucleotide are all modified nucleotides.

[0011] Unmodified nucleotide conversion: The ligation product is converted to obtain a DNA double-strand conversion product;

[0012] PCR amplification: At least one round of PCR amplification is performed on the DNA double-stranded transformation product using at least one forward universal primer and at least one reverse specific primer to obtain the DNA library; wherein the forward universal primer is designed for the adapter replacement single strand, and the reverse specific primer is designed for the newly formed strand.

[0013] According to some embodiments of this application, compared with existing methylation-specific single-end anchored multiplex PCR amplicon sequencing, the technical solution of this application, after transformation with unmodified nucleotides, maintains the genetic information unchanged because the newly formed single strands with modified nucleotides introduced at the 3' end of the DNA double strand and the adapter replacement single strands at the double-linked head retain the genetic information, eliminating the need to design reverse degenerative primers. Therefore, only the 3' end of the target region needs to be known to specifically enrich the target region. This means a significant reduction in primer design difficulty and a lower rate of primer dimer formation, which will also avoid the problem of reduced complexity in traditional methylated sequences by achieving high pyrimidine coverage. In the case of nested PCR, the formation of chimeric fragments may further improve the accuracy of DNA modification alignment.

[0014] According to some embodiments of this application, the modification of the modified nucleotide includes methylation modification. In some embodiments, the modified nucleotide includes at least one of a modified pyrimidine nucleotide and a modified purine nucleotide. In some embodiments, the modified nucleotide includes at least one of methylated cytosine (including 5-methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC)) and methylated adenine (including N6-methyladenine (6mA)). For unmethylated cytosine (C), bisulfite or enzymatic conversion will form uracil (U), which will be converted to thymine (T) in subsequent amplification or reverse transcription, while the methylated cytosine (5mC and 5hmC) remain unchanged. For unmethylated adenine (A), nitrite or enzymatic conversion will form hypoxanthine (I), which will be converted to guanine (G) in subsequent amplification or reverse transcription, while the methylated adenine (6mA) remains unchanged.

[0015] In some embodiments, DNA double-stranded fragments are provided by breaking the DNA double strand using sonication or enzymatic digestion. In some preferred embodiments, DNA double-stranded fragments are provided by breaking the DNA double strand using enzymatic digestion. In some embodiments, the provided DNA double-stranded fragments have single-stranded sticky ends, including 5' single-stranded sticky ends. In some embodiments, the provided DNA double-stranded fragments have notches on the single strands.

[0016] In some preferred embodiments, a nuclease is used to break the DNA double strand to provide DNA double-stranded fragments. More preferably, the nuclease includes at least one selected from deoxyribonuclease I (DNase I), deoxyribonuclease II (DNase II), micrococcal nuclease (MNase), double-strand specific DNAase (dsDNase), salt-active nuclease (SAN), and nuclease Vvn. In some preferred embodiments, the concentration of the nuclease in the reaction system is 0.00001 U / μL-0.1 U / μL; more preferably 0.0001 U / μL-0.005 U / μL; and even more preferably 0.0002 U / μL. In some preferred embodiments, the enzymatic digestion is carried out at 14-45°C for 5-60 min; preferably at 16-40°C for 10-50 min; more preferably at 25-40°C for 10-40 min; and even more preferably at 37°C for 15-30 min.

[0017] In some preferred embodiments, the enzymatic hydrolysis is carried out in the presence of calcium ions and magnesium ions and / or manganese ions. Preferably, the concentration of magnesium ions and / or manganese ions is 0.1-200 mmol / L; more preferably, the concentration of magnesium ions and / or manganese ions is 0.5-100 mmol / L; even more preferably, the concentration of magnesium ions and / or manganese ions is 1-50 mmol / L. Preferably, the concentration of calcium ions is 0.001-50 mmol / L; more preferably, the concentration of calcium ions is 0.01-25 mmol / L; even more preferably, the concentration of calcium ions is 0.1-10 mmol / L.

[0018] In some preferred embodiments, the enzymatic digestion is performed in a buffer solution. More preferably, the buffer solution includes citrate buffer, MES buffer solution, phosphate buffer, Bis-tris buffer, and Tris hydrochloride buffer. More preferably, the pH of the buffer solution is 6-9; more preferably, the pH of the buffer solution is 6.5-8.5; and even more preferably, the pH of the buffer solution is 7-8. Those skilled in the art can select the buffer solution and adjust its pH value according to the specific type of endonuclease used and the desired effect.

[0019] In some preferred embodiments, the provided DNA double-stranded fragment is less than 1000 bp. More preferably, the DNA double-stranded fragment is 150-800 bp. Even more preferably, the DNA double-stranded fragment is 350-500 bp.

[0020] In some specific embodiments, the endonuclease is deoxyribonuclease I (DNase I). DNase I is a non-specific endonuclease that can cleave single-stranded or double-stranded DNA by hydrolyzing phosphodiester bonds to produce monodeoxynucleotides and oligodeoxynucleotides containing 5'-phosphate groups and 3'-OH groups. 2+ It can be oxidized by divalent metal ions Mg 2+ Mn 2+ Wait for activation. In Mg 2+ In its presence, DNase I can randomly identify and cleave any site on either strand of double-stranded DNA; while in Mn 2+ In the presence of DNase I, DNase I can recognize and cleave nearly identical sites on both strands of DNA, producing DNA fragments with blunt ends or sticky ends with 1-2 nucleotide protrusions.

[0021] In some implementations, DNA double-stranded fragments provided by enzymatic hydrolysis can be used to form new strands without purification. Therefore, DNA double-stranding and the formation of new strands can be carried out in the same tube or reactor.

[0022] In some embodiments, the DNA double-stranded fragments provided by breaking the DNA double helix by enzymatic digestion may have single-stranded sticky ends, including 5' single-stranded sticky ends; the single strands of the provided DNA double-stranded fragments may also have gaps.

[0023] In some implementations, a nucleic acid polymerase is used to form a new strand complementary to the 5' end sequence at the 3' end of the DNA double-stranded fragment.

[0024] In some embodiments, for a DNA double-stranded fragment with a 5' single-stranded sticky end, a nuclease with 5'-3' polymerase activity is used to form a new strand complementary to the 5' single-stranded sticky end from the 3' end of the DNA double-stranded fragment. The 5' single-stranded sticky end of the DNA double-stranded fragment can be finished using a nuclease with 5'-3' polymerase activity. For the provided 5' single-stranded sticky end of the DNA double-stranded fragment, the nuclease with 5'-3' polymerase activity extends using the 5' single-stranded sticky end as a template to form a new 3' single strand.

[0025] In some preferred embodiments, the nucleic acid polymerase having 5'-3' polymerase activity is a DNA-dependent DNA polymerase. In some more preferred embodiments, the nucleic acid polymerase includes at least one of T4 DNA polymerase, DNA polymerase I (Klenow) large fragment (Klenow fragment), T7 DNA polymerase, DNA polymerase I, Taq DNA polymerase, Bst DNA polymerase, and Phi29 DNA polymerase. Those skilled in the art can also reasonably adjust the specific selection of the above enzymes according to actual usage requirements, using enzymes with completely identical or similar functions as substitutes.

[0026] In some embodiments, for DNA double-stranded fragments with gaps in their single strands, a nucleic acid polymerase with 5'-3' strand substitution activity is used to form a new strand complementary to the 5' end sequence from the gap at the 3' end of the DNA double-stranded fragment. The nucleic acid polymerase with 5'-3' strand substitution activity can dissociate the hydrogen bonds of the DNA strand already bound to the DNA template, and then synthesize a new DNA strand.

[0027] In some preferred embodiments, the nucleic acid polymerase having 5'-3' strand substitution activity is a DNA-dependent DNA polymerase. In some more preferred embodiments, the nucleic acid polymerase includes T4 DNA polymerase, DNA polymerase I (Klenow) large fragment (Klenow fragment), Klenow fragment (3'→5' exo-), and... DNA polymerase, (exo-)DNA polymerase, Deep DNA polymerase, Deep At least one of (exo–)DNA polymerase, DNA polymerase I, Taq DNA polymerase, Bst DNA polymerase, and Phi29 DNA polymerase. Those skilled in the art can also reasonably adjust the specific selection of the above enzymes according to actual usage requirements, using enzymes with completely identical or similar functions as substitutes.

[0028] In some embodiments, the target modified nucleotide includes at least one of methylated cytosine (including 5-methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC)) and methylated adenine (including N6-methyladenine (6mA)). A nucleotide having the same base type as the target modified nucleotide refers to a nucleotide having the same base type as the nucleotide to be detected, including modified and unmodified nucleotides of that base type (adenine A, thymine T, cytosine C, guanine G). The original single strand of the nascent strand introduced at the 3' end of the DNA double helix may contain both modified and unmodified nucleotides, but nucleotides in the nascent strand having the same base type as the target modified nucleotide are replaced with the modified nucleotide.

[0029] According to some embodiments of this application, in the DNA single-strand replacement step, to ensure that all nucleotides in the newly formed strand that share the same bases as the target modified nucleotide are modified nucleotides, targeted modified dNTPs are used in the dNTPs of the reaction system. In some embodiments, all dNTPs that share the same bases as the target modified nucleotide are modified dNTPs. For example, when the aim is to detect methylated cytosine (5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC)), 5m-dCTP or 5hm-dCTP is used instead of unmethylated dCTP, thereby ensuring that both modified and unmodified cytosine nucleotides in the original single strand form methylated cytosine nucleotides (5mC or 5hmC) in the newly formed strand. For example, when the goal is to detect methylated adenine (6mA), 6m-dATP is used in the dNTPs instead of unmethylated dATP, so that both modified and unmodified adenine nucleotides in the original single strand form methylated adenine nucleotides (6mA) in the nascent strand. Similarly, when the goal is to detect both methylated cytosine (5mC, 5hmC) and methylated adenine (6mA), or other modified nucleotides, the dNTPs of the corresponding modified nucleotides are used instead of unmodified dNTPs of the same base.

[0030] The embodiments proposed in this application are not limited to detecting the modified nucleotides specifically listed in this application. Rather, they are applicable as long as there is a suitable conversion method for the target modified nucleotide that can convert the modified or unmodified nucleotide into nucleotides with different bases, so that the detection method can distinguish the nucleotides with different bases after conversion.

[0031] In some preferred embodiments, a new strand complementary to the 5' end sequence is formed in a continuous sequence at the 3' end of the DNA double-stranded fragment. In some preferred embodiments, the length of the formed new strand can be 20-50 nt. More preferably, the length of the formed new strand can be 25-40 nt.

[0032] In some preferred embodiments, a nucleic acid polymerase possessing both 5'-3' polymerase activity and 5'-3' strand substitution activity can be selected, thereby simultaneously acting on DNA double strands with sticky single-strand ends or nicks in the single strand. In a system containing targeted modified dNTPs, this ensures that all nucleotides in the newly formed strand that share the same bases as the target modified nucleotide are modified nucleotides. In some embodiments, an enzyme mixture possessing the aforementioned functions and activities of a nucleic acid polymerase can be used to form the newly formed strand.

[0033] In some embodiments, to improve the ligation efficiency of the DNA double-stranded product and the double-linker, the DNA double-stranded product preferably has blunt ends or overhanging ends at both ends. To facilitate subsequent ligation with a double-linker having overhanging ends (e.g., one or more T bases), a corresponding number of complementary base types (e.g., A bases) can be added to the ends of the DNA double-stranded product. Those skilled in the art can also add one or more other types of overhanging bases to the ends of the DNA double-stranded product using other known techniques and employ a double-linker with complementary overhanging bases, thereby improving ligation efficiency. For example, polyG can be added to the 3' end of the DNA double-stranded product, and the double-linker can be designed accordingly to have polyC overhanging ends. In some embodiments, the DNA double-stranded product has overhanging ends. In some preferred embodiments, the DNA double-stranded product has overhanging ends at the 3' end. In some preferred embodiments, the DNA double-stranded product has one or more overhanging A bases at the end. In some more preferred embodiments, the 3' end of the nascent strand of the DNA double-stranded product has overhanging ends.

[0034] In some specific embodiments, T4 DNA polymerase, Klenow Fragment, and Taq DNA polymerase are used to form the nascent strand. T4 DNA polymerase, in the presence of a template and dNTPs, catalyzes the selective ligation of template-complementary deoxynucleotides to the 3'-OH end of the DNA strand. The Klenow Fragment is an N-terminal truncated form of DNA polymerase I, retaining the 5'→3' polymerase activity of DNA polymerase I and possessing 5'→3' strand substitution activity. Taq DNA polymerase is a thermostable enzyme that synthesizes DNA from a single-stranded template in the presence of dNTPs; it possesses 5'→3' polymerase activity; and in the presence of dATP, Taq DNA polymerase can add the base A to the 3' end of the DNA. Adding the base A to the 3' end of the nascent strand of the DNA double-strand fragment to form a protruding sticky end facilitates subsequent ligation with a double-stranded linker having a protruding sticky T end. The preferred Taq DNA polymerase is recombinant Taq DNA polymerase (r-Taq DNA polymerase), which is particularly suitable for optimizing problem templates and / or GC-rich templates.

[0035] In some preferred embodiments, the concentration of the nucleic acid polymerase having 5'-3' polymerase activity and / or 5'-3' strand displacement activity in the reaction system is 0.001 U / μL-1 U / μL; more preferably 0.005 U / μL-0.5 U / μL; and even more preferably 0.01 U / μL-0.3 U / μL. In some preferred embodiments, the formation of the nascent strand using the above-mentioned nucleic acid polymerase can be carried out simultaneously in the same tube or reactor. In some preferred embodiments, the reaction for forming the nascent strand is carried out at 50-75°C for 5-60 min; more preferably, at 55-70°C for 10-40 min; and even more preferably, at 60-65°C for 15-30 min. Those skilled in the art can, depending on the type, concentration, and desired effect of the specific nucleic acid polymerase used, thereby achieving end-repair and synthesis of nascent single strands, while simultaneously inactivating the endonuclease used to break DNA double strands.

[0036] In some preferred embodiments, the nascent chains are formed using a nucleic acid polymerase in the presence of magnesium ions. Magnesium ions (Mg...) 2+Magnesium ions, as cofactors of DNA polymerase activity, facilitate the binding of dNTPs during polymerization. Magnesium ions at the enzyme active site catalyze the formation of phosphodiester bonds between the 3'-OH group of DNA and the phosphate groups of dNTPs. Preferably, the magnesium ions are provided in the form of MgCl2 or MgSO4. More preferably, the magnesium ions are provided in the form of MgCl2. Preferably, the concentration of the magnesium ions is 0.1-200 mmol / L; more preferably, the concentration of the magnesium ions is 0.5-100 mmol / L; even more preferably, the concentration of the magnesium ions is 1-50 mmol / L.

[0037] In some preferred embodiments, the nascent strands are formed using a nucleic acid polymerase in a buffer solution. More preferably, the buffer solution includes citrate buffer, MES buffer, phosphate buffer, Bis-tris buffer, and Tris hydrochloride buffer. More preferably, the pH of the buffer solution is 6-9. More preferably, the pH of the buffer solution is 6.5-8.5; even more preferably, the pH of the buffer solution is 7-8. Those skilled in the art can select the buffer solution and adjust its pH value according to the specific type of DNA polymerase used and the desired effect.

[0038] In some alternative embodiments, the buffer solution comprises potassium ions and / or ammonium ions. Potassium ions (K... + (e.g., provided by KCl) and ammonium ions (NH4) + (For example, provided as (NH4)2SO4) can enhance the specificity of the DNA strand extension reaction. Those skilled in the art can adjust the concentration of potassium and / or ammonium ions in the buffer solution according to the specific type of nucleic acid polymerase used and the desired effect.

[0039] In some embodiments, the 5' end of the DNA double-stranded product has a phosphate group to facilitate ligation between the DNA double-stranded fragment and the double-linker. Before ligating the DNA double-stranded product to the double-linker, to avoid undesirable self-ligation between nucleic acid fragments or to improve ligation efficiency in subsequent ligation steps, the DNA double-stranded product or double-linker to be ligated may be phosphorylated or dephosphorylated. In some embodiments, phosphorylation is performed using a phosphatase. In some embodiments, a phosphatase is used to remove the phosphate groups at the 5' and / or 3' ends of the nucleic acid fragment to obtain a dephosphorylated nucleic acid fragment. In DNA double-stranded fragments formed by breaking DNA double strands using endonucleases, the 5' end typically has a phosphate group, while the 3' end has a hydroxyl group. To ensure ligation to the double-linker in the next step, optionally, a polynucleotide 5'-hydroxykinase is added to the reaction system to phosphorylate the 5' end of the DNA double-stranded fragment. Preferably, the polynucleotide 5'-hydroxykinase is T4 polynucleotide kinase (T4 PNK). T4 PNK can catalyze the transfer of phosphate groups from ATP to the 5'-hydroxyl terminus of oligonucleotide chains (double-stranded or single-stranded DNA).

[0040] In some preferred embodiments, a nucleic acid ligase is used to ligate the DNA double-stranded product to a double-linker. In some preferred embodiments, the nucleic acid ligase includes a DNA ligase. In some more preferred embodiments, the DNA ligase includes at least one of an ATP-dependent DNA ligase and an NAD+-dependent DNA ligase. In some even more preferred embodiments, the DNA ligase includes at least one of T4 DNA ligase, Taq DNA ligase, DNA ligase I, DNA ligase III, and DNA ligase IV. Those skilled in the art can also reasonably adjust the specific selection of the above enzymes according to actual usage requirements, using enzymes with completely identical or similar functions as substitutes.

[0041] In some preferred embodiments, the concentration of the nucleic acid ligase in the ligation reaction system is 0.1 U / μL-50 U / μL; more preferably 1 U / μL-20 U / μL. In some preferred embodiments, the adapter ligation reaction is carried out at 16-50°C for 5-60 min; more preferably, at 16-25°C for 10-40 min. Those skilled in the art can adjust the concentration of the selected DNA ligase, as well as the suitable reaction temperature and duration.

[0042] In some preferred embodiments, the ligation reaction system includes a buffer solution and a coenzyme factor; more preferably, the pH of the ligation reaction system is 6-9; more preferably, the pH of the buffer solution is 6.5-8.5; even more preferably, the pH of the buffer solution is 7-8. In some more preferred embodiments, the buffer solution includes citrate buffer, MES buffer solution, phosphate buffer, Bis-tris buffer, and Tris hydrochloric acid buffer. For T4 DNA ligase, the coenzyme factor includes ATP and magnesium ions (Mg²⁺). 2+ Preferably, the concentration of magnesium ions is 0.1-50 mmol / L. More preferably, the concentration of magnesium ions is 0.5-20 mmol / L. Even more preferably, the concentration of magnesium ions is 1-10 mmol / L. For Taq DNA ligase, the coenzyme factor includes NAD+. + Those skilled in the art can adjust the appropriate buffer system, salt ions, and coenzyme factors, as well as their concentrations, according to the specific DNA ligase selected.

[0043] According to some embodiments of this application, the double-linked head is a synthetic double-linked head. According to some embodiments of this application, in at least one single strand of the double-linked head, the nucleotides having the same bases as the target modified nucleotide are all modified nucleotides (hereinafter referred to as "linker-substituted single strands"), which are used to ligate to the 5' end of the DNA double-stranded fragment. However, in the other single strand of the double-linked head, besides the linker-substituted single strand, the nucleotides having the same bases as the target modified nucleotide may all be modified nucleotides, or they may not be modified.

[0044] In some embodiments, the 3' end of the adapter replacement single strand of the double-link head has a protruding end. Preferably, the 3' end of the adapter replacement single strand that connects to the 5' end of the DNA double-stranded product has a protruding end. Preferably, the protruding 3' end of the adapter replacement single strand is complementary to the protruding 3' end of the DNA double-stranded fragment, thereby enabling the double-link head to recognize and connect with the DNA double-stranded fragment. For example, when the protruding 3' end of the DNA double-stranded fragment is one or more A bases, the protruding 3' end of the double-link head replacement single strand is correspondingly designed as a corresponding number of T bases. For example, when the protruding 3' end of the DNA double-stranded fragment is polyG, the protruding 3' end of the double-link head replacement single strand is correspondingly designed as polyC.

[0045] To facilitate the ligation of the double-linker to the DNA double-stranded fragment, the 5' end of the double-linker is phosphated. The 5' phosphate group of the double-linker according to this application can be added during the synthesis of the double-linker, or it can be phosphorylated at the 5' end of the double-linker using a polynucleotide 5'-hydroxykinase before or simultaneously with the adapter ligation reaction. In some embodiments, when one strand of the double-linker is an adapter-substituted single strand and the other strand is unmodified (hereinafter referred to as a "non-adaptor single strand"), then at least the 5' end of the non-adaptor single strand is phosphated. In some embodiments, when both strands of the double-linker are adapter-substituted single strands, then at least one adapter-substituted single strand is phosphated at its 5' end. At least one strand of the double-linker with a phosphated 5' end is used to ligate to the 3' end of the DNA double-stranded product (i.e., in the previous step, a new strand complementary to the 5' end sequence is formed at the 3' end portion of the DNA double-stranded fragment). In cases where the target region of the DNA double helix is ​​not well understood, or where conversion may lead to primer matching errors, it is preferable that the double linker is designed so that only one single strand of the linker contains modified nucleotides that have the same base as the target modified nucleotide, i.e., only one linker replaces the single strand.

[0046] According to some embodiments of this application, the sequences of the two single strands of the double-linked header can be completely complementary or partially complementary. In some embodiments, the sequences of the two single strands of the double-linked header can be complementary at either end or at both ends. In some embodiments, the two single strand sequences at the end of the double-linked header that connects to the DNA double-stranded fragment are complementary (i.e., the double-linked header has a Y-shaped structure). In some embodiments, the two single strand sequences in the middle portion of the double-linked header are not complementary (i.e., the double-linked header has a bubble-like structure).

[0047] In some embodiments, the two single strands of the dual-link head may have the same number of bases, or the two single strands of the dual-link head may have different numbers of bases. In some embodiments, the two single strands of the dual-link head may each have 20-50 nt of bases. More preferably, the two single strands of the dual-link head may each have 25-40 nt of bases. In some embodiments, the length of the non-complementary portion between the two single strands of the dual-link head may be 10-30 nt. More preferably, the length of the non-complementary portion between the two single strands of the dual-link head may be 15-25 nt. In some embodiments, the total length of the complementary portion between the two single strands of the dual-link head may be 10-30 bp. More preferably, the total length of the complementary portion between the two single strands of the dual-link head may be 15-25 bp. Those skilled in the art can adjust the length of the complementary or non-complementary portions in the middle or at both ends of the designed dual-link head according to the specific sequence of the two single strands, thereby forming a stable dual-link head. In some preferred embodiments, the concentration of the dual-linker in the ligation reaction system is 100 nmol / L to 10 μmol / L. More preferably, the concentration of the dual-linker in the ligation reaction system is 200 nmol / L to 800 nmol / L. Even more preferably, the concentration of the dual-linker in the ligation reaction system is 300 nmol / L to 600 nmol / L.

[0048] DNA methylation is the process by which an organism, catalyzed by DNA methyltransferase (DMT), transfers a methyl group to a specific base using S-adenosylmethionine (SAM) as a methyl donor. In mammals, DNA methylation primarily occurs at the C of the 5'-CpG-3' group, generating 5-methylcytosine (5mC). Multiple studies have shown that DNA methylation levels are associated with organismal development, disease occurrence, tumor development, and anticancer drug resistance, making it a highly promising biomarker. Treatment with DNA bisulfite can convert unmethylated cytosine to uracil, while methylated cytosine remains unchanged. 5-Hydroxymethylcytosine (5hmC) is the hydroxylated form of 5-methylcytosine produced by oxidation by enzymes of the TET family. While 5hmC is present in lower concentrations than 5mC, it also plays a crucial biological role.

[0049] According to some embodiments of this application, the target modified nucleotide includes methylated cytosine, and the methods for converting unmethylated cytosine include bisulfite conversion and enzymatic conversion. In some embodiments, the conversion of unmethylated cytosine involves the ligation product being carried out by at least one of bisulfite conversion or enzymatic conversion. In some preferred embodiments, enzymatic conversion includes using at least one of an oxidase (Ten-Eleven Translocase, TET enzyme), T4-glucosyltransferase (T4-BGT), and cytosine deaminase (APOBEC enzyme). For both bisulfite conversion and enzymatic conversion, conversion kits are commercially available to those skilled in the art. A suitable conversion kit can completely convert unmethylated cytosine (C) to uracil (U) while minimizing DNA damage, ultimately producing a high-quality library. For example, commonly used kits for bisulfite conversion include Diagenode's Premium Bisulfite kit, Qiagen's EpiTect Bisulfite kit, Promega's MethylEdge Bisulfite Conversion System, Epigentek's BisulFlashDNA Modification kit, and so on.

[0050] Although sulfite conversion is hailed as the "gold standard" for DNA methylation detection, the later-developed enzymatic conversion has several advantages, including but not limited to: less sample-destructive and higher conversion efficiency; higher library richness, enabling the detection of more CpG sites and preserving more original sample information; compatibility with cfDNA, FFPE DNA, single-cell DNA, and other samples; lower sample input and higher data quality; and compatibility with various downstream analysis techniques, including but not limited to methylation-sensitive PCR, restriction enzyme digestion, mass spectrometry, and whole-genome sequencing. Enzymatic conversion kits are also commercially available to those skilled in the art, such as the NEBNext Enzymatic Methyl-seq Kit (EM-seq) from NEB Corporation. TM ).

[0051] In the bisulfite conversion reaction, methylated cytosine, including 5mC and 5hmC, remains unchanged, making them indistinguishable. To address this, the Epigentek BisulPlus Loci 5mC&5hmC Detection PCR kit can be used to distinguish between 5hmC and 5mC. The principle involves three main steps: (1) Bisulfite conversion of the DNA to be tested converts unmethylated C to U, which is then converted to T after PCR amplification. 5mC remains unchanged, while 5hmC is converted to 5-methylenesulfonic acid cytosine (CMS); (2) APOBEC deaminase catalyzes the bisulfite-converted DNA, converting 5mC to T, while CMS remains unchanged and remains C after PCR amplification; (3) Sequencing analysis compares the treated and untreated DNA sequences to achieve quantitative and localized detection of 5mC and 5hmC in the DNA sample.

[0052] In addition, N 6 -Methyladenine (6mA) is a methylation occurring at the 6th nitrogen atom of the adenine base. It participates in various biological processes such as RNA transcription, splicing, processing, translation, and decay. In recent years, it has been found to play an important role in the epigenetic modification of eukaryotic DNA and may have important regulatory functions. According to some embodiments of this application, the target modified nucleotide includes methylated adenine, and the methods for converting unmethylated adenine include nitrite conversion and enzymatic conversion. In the embodiments, for the conversion of unmethylated adenine, the ligation product is carried out by at least one of nitrite conversion or enzymatic conversion. For unmethylated adenine (A), nitrite or enzymatic conversion will form hypoxanthine (I), which is then converted back to guanine (G) during subsequent amplification or reverse transcription, while methylated adenine (6mA) remains unchanged. By comparing the conversion of A and G in the treated and untreated DNA sequences through sequencing analysis, the presence of 6mA modification in the nucleic acid sample can be determined and identified.

[0053] According to some embodiments of this application, at least one round of PCR amplification is performed on the DNA double-stranded transformation product after the previous step of unmodified nucleotide transformation. According to some embodiments of this application, the forward universal primer is designed for the single strand (adapter-substituted single strand) containing the modified nucleotide in the double-stranded linker. In some embodiments, the forward universal primer is designed for a portion of the sequence of the adapter-substituted single strand. According to some embodiments of this application, the reverse specific primer is designed for the nascent DNA strand. In some embodiments, the reverse specific primer is designed for the 3' end sequence of the target region of the DNA double-stranded DNA. In some embodiments, the reverse specific primer is designed for the 3' end sequence of the target region of the DNA double-stranded DNA in the nascent DNA strand.

[0054] According to some embodiments of this application, forward universal primers can be designed as partial sequences of the single strand with a linker substitution in a double-linked head, or as partial complementary sequences of the single strand with a linker substitution in a double-linked head. Since the sequences for synthesizing the double-linked head are known, the design of forward universal primers is not difficult. Furthermore, since the nucleotides in the newly formed single strand and the linker-substituted single strand that share the same bases as the target modified nucleotide are all modified nucleotides, the sequences of the newly formed single strand and the linker-substituted single strand do not change during the previous transformation step. Therefore, primer design does not require consideration of nucleotide transformation; thus, only the 3' end outside or near the target region needs to be known to design reverse specific primers, thereby greatly reducing the difficulty of primer design and the probability of primer dimer formation.

[0055] In some specific implementations, the forward universal primer can be designed with a double-linked header that connects to a partially identical sequence of the adapter-replaced single strand at the 5' end of the DNA double-stranded fragment, and a reverse specific primer can be designed for the 3' end sequence of the target region of the nascent DNA double-stranded strand. In this case, during the PCR amplification cycle, the reverse specific primer first binds to the nascent single strand in the DNA double-stranded fragment and extends the other single strand of the DNA double-stranded fragment; after denaturation, the forward universal primer then binds to the extended single strand and extends it. In this way, PCR amplification can specifically obtain the PCR amplification product of the single strand of the transformed DNA double-stranded template with the adapter-replaced single strand at the 5' end and the nascent single strand at the 3' end. This advantage of specifically detecting the single strand of the DNA double-stranded template is even more pronounced when the double-linked header is designed with only one adapter-replaced single strand, and / or when the sequences of the adapter-replaced single strand and the non-replaced single strand are not completely complementary.

[0056] According to some embodiments of this application, the DNA double-stranded transformation product after the previous step of unmodified nucleotide transformation is subjected to at least two rounds of PCR amplification. The first round of PCR amplification uses a first forward universal primer and at least one first reverse specific primer. The first forward universal primer is designed for adapter replacement single-stranded DNA at the double-stranded linker. The first reverse specific primer is designed for the nascent strand. In some embodiments, the first reverse specific primer is designed for the 3' end sequence outside or near the target region of the DNA double-stranded DNA in the nascent strand. In some embodiments, the second round of PCR amplification uses a second forward universal primer and at least one second reverse specific primer. The second forward universal primer is designed for adapter replacement single-stranded DNA at the double-stranded linker. For example, the second forward universal primer may have the exact same sequence as the first forward universal primer; it may also bind within the binding site of the first forward universal primer on the product amplified in the previous round of PCR amplification, and the second forward universal primer and the first forward universal primer may have partially identical or partially complementary sequences.

[0057] In some embodiments, the second reverse-specific primer is designed for the nascent DNA strand. In some embodiments, the second reverse-specific primer binds within the binding site of the first reverse-specific primer on the product of the previous PCR amplification. In some embodiments, the second reverse-specific primer is designed for the 3' end sequence within the target region of the double-stranded DNA in the nascent DNA strand. In some preferred embodiments, the second reverse-specific primer may be completely different from the first reverse-specific primer, or may have partially identical or partially complementary sequences. In some preferred embodiments, the second forward universal primer and the first forward universal primer, or the second reverse specific primer and the first reverse specific primer, have at least 6 nt of identical continuous sequence; more preferably, they have at least 10 nt of identical continuous sequence. More preferably, the second forward universal primer and the first forward universal primer, or the second reverse specific primer and the first reverse specific primer, have 6-18 nt of identical continuous sequence; more preferably, they have 10-18 nt of identical continuous sequence.

[0058] In some preferred embodiments, the other single strand of the double-stranded DNA template also contains modified nucleotides. In this case, the sequence of the other single strand in the double-stranded DNA template is not changed by transformation. A second first forward universal primer can be designed for the sequence of this other single strand, and a second first reverse specific primer can be used to obtain the PCR amplification product of the other strand in the transformed DNA template through the first round of PCR amplification. Since the modifications between the DNA double strands are unrelated, the unmodified nucleotides, after transformation, are no longer complementary to the nucleotides on the original complementary strand, resulting in the transformed DNA double strands not being completely complementary. When both strands of the double-stranded DNA template are designed to contain modified nucleotides, the PCR amplification products of the two non-completely complementary single strands in the transformed DNA double strand can be obtained simultaneously, allowing for the analysis of the modification information of each single strand in subsequent detection.

[0059] In some preferred embodiments, in one round of PCR amplification, two or more pairs of reverse specific primers and forward universal primers can be used to amplify two or more target regions in the DNA double helix, or two or more target regions in the two single strands of the DNA double helix can be amplified simultaneously.

[0060] One or more subsequent PCRs can be performed on the products amplified in the previous round of PCR. In some preferred embodiments, a second round of PCR is performed. In some preferred embodiments, the second round of PCR or subsequent PCR is nested PCR. Nested PCR uses two sets of PCR primers to perform two rounds of PCR amplification reactions on the target gene. The second set of primers is called nested primers, which bind inside the products amplified in the first PCR. It is readily understood by those skilled in the art that the second forward universal primer and the first forward universal primer, or the second reverse specific primer and the first reverse specific primer, may have partially identical sequences. By using the primers of nested PCR (nested primers) to amplify the products amplified in the previous round of PCR, if the previous round of amplification produced erroneous fragments, the probability of nested PCR pairing and amplifying the erroneous fragments is extremely low, and the amplification of nested PCR is highly specific. Those skilled in the art will also understand that nested PCR amplification can also be achieved if the second (subsequent) forward universal primer has partially complementary sequences to the first (previous) forward universal primer, or the second (subsequent) reverse specific primer has partially complementary sequences to the first (previous) reverse specific primer.

[0061] In some preferred embodiments, the method further includes a sequencing step. The sequencing step includes sequencing the DNA library.

[0062] In some preferred embodiments, to facilitate subsequent sequencing, at least the primers used to perform the final round of PCR amplification have sequencing tag sequences. Preferably, the primers with sequencing tag sequences can be forward primers or reverse primers, or both the forward and reverse primers used to perform the final round of PCR amplification may have sequencing tag sequences. More preferably, the sequencing tag sequences include, but are not limited to, unique molecular tag (UMI) sequences and sample tag sequences. Unique molecular tag (UMI) sequences are used to count the copy number of nucleic acid molecules in a sample. Sample tag sequences are used to distinguish different samples for subsequent multi-sample pooling sequencing. For example, sample tag sequences may be barcode sequences or index sequences. In some alternative embodiments, primers with sequencing tag sequences may be added at least during the final round of PCR amplification. By adding primers with sequencing tag sequences, nested PCR can be performed in the same round of PCR amplification, and excessively long primer lengths can be avoided.

[0063] Preferably, the additional primer with the sequencing tag sequence can be a forward primer, a reverse primer, or both. Preferably, the additional forward primer with the sequencing tag sequence shares at least partially identical or partially complementary sequences with the forward universal primer, or the additional reverse primer with the sequencing tag sequence with the reverse specific primer. Preferably, the additional forward primer with the sequencing tag sequence shares at least partially identical or partially complementary sequences with the forward universal primer, and the additional reverse primer with the sequencing tag sequence with the reverse specific primer.

[0064] Preferably, the second (subsequent) PCR amplification uses a second (subsequent) forward universal primer and at least one second (subsequent) reverse specific primer, and additionally adds a first reverse universal primer, wherein the 5' end of the second (subsequent) reverse specific primer has a universal sequence, and the 3' end of the first reverse universal primer has a sequence complementary to the universal sequence of the second (subsequent) reverse specific primer.

[0065] According to another embodiment of this application, a method for detecting DNA modification is provided, comprising the following steps:

[0066] A DNA double-stranded fragment is provided, and a new strand complementary to the 5' end sequence is formed at the 3' end of the DNA double-stranded fragment to obtain a DNA double-stranded product, wherein the nucleotides in the new strand that have the same base as the target modified nucleotide are all modified nucleotides;

[0067] The DNA double-stranded product is ligated to a double-linker to obtain a ligation product; wherein at least one single strand of the double-linker is a linker-substituted single strand, and the nucleotides in the linker-substituted single strand that have the same base as the target modified nucleotide are all modified nucleotides.

[0068] The ligation product is converted to obtain a DNA double-stranded conversion product;

[0069] The DNA double-stranded transformation product is subjected to at least one round of PCR amplification using at least one forward universal primer and at least one reverse specific primer to obtain the DNA library; wherein the forward universal primer is designed for the adapter replacement single strand, and the reverse specific primer is designed for the newly formed strand;

[0070] The DNA library was sequenced.

[0071] In some embodiments, sequencing can be performed using any method known in the art, including but not limited to the use of conventional sequencing platforms, instruments, or equipment. In some embodiments, sequencing is performed using a sequencer.

[0072] Those skilled in the art can reasonably adjust sequencing parameters based on the selected sequencing method to achieve the sequencing objective. In some embodiments of the present invention, the sequencing method further includes analyzing the sequencing data to obtain DNA modification information. According to some embodiments of this application, by aligning the sequencing reads of the transformed double-stranded DNA with the genomic reads, the accurate location of the sequencing reads is obtained. Based on the genomic alignment location, the original template strand information is then obtained, thereby obtaining accurate modification alignment information.

[0073] In some specific implementations, the constructed library is sequenced using a high-throughput sequencing platform, and the sequencing data undergoes quality control to remove low-quality reads and adapter sequences. All cytosine (C) in the reference genome is converted to thymine (T) to generate a C-to-T converted reference genome, or all adenine (A) in the reference genome is converted to guanine (G) to generate a G-to-A converted reference genome. The sequencing reads are then aligned to the converted reference genome.

[0074] Taking the detection of methylated cytosine (5mC) as an example, based on the alignment results, if a site aligns to T in the C-to-T converted reference genome but is C in the original sequence, then the site is identified as unmethylated. If it aligns to C in both the C-to-T converted reference genome and the original sequence, then the site is identified as methylated. The methylation rate is typically used to represent the proportion of methylated cytosine in total cytosine. By improving the targeting capture capability of the transformed library, the accurate alignment rate of the methylated library can be further improved, thereby evaluating the accuracy of the DNA methylation detection strategy.

[0075] In some implementations, the sequencing methods include, but are not limited to, MGI's DNBseq sequencing technology. In some specific implementations, DNBseq sequencing technology is used to sequence DNA libraries. MGI's DNBseq technology consists of three stages: denaturation and circularization of the library; amplification of DNBs (DNA nanoballs) via rolling circle amplification (RCA); and loading the DNBs onto a regular array of a sequencing chip for sequencing. By circularizing the DNA strands of the library to form a circular DNA product, and then performing rolling circle amplification with DNA polymerase, DNBseq technology not only effectively increases the copy number of the DNA to be tested, greatly enhancing the signal intensity, but also avoids the accumulation of errors during PCR amplification by using the same template for rolling circle replication, effectively improving sequencing accuracy. After circularization amplification, the DNBs are transferred onto the sequencing chip array. DNB (Digital Neural Network) hybridizes complementaryly with the adapters on the array. Catalyzed by DNA polymerase, the sequencing template binds to fluorescently labeled probes in the sequencing reagents. This excitation of fluorescent groups produces light signals, which are then captured by the instrument's camera. These signals are processed and converted into digital signals, which are then further processed to ultimately obtain the base sequence information of the sample. DNB increases the copy number of the sample's DNA and references the original template for each amplification, thereby enhancing signal strength and improving sequencing accuracy.

[0076] According to another embodiment of this application, a kit for constructing a DNA library with modified nucleotides is provided, comprising: a DNA single-strand replacement kit; a adapter ligation kit; an unmodified nucleotide conversion kit; and a PCR amplification kit.

[0077] In some embodiments, the DNA single-strand replacement kit includes: an endonuclease for breaking the DNA double strand to provide a DNA double-stranded fragment; a nucleic acid polymerase for forming a nascent strand complementary to the 5' end sequence at the 3' end of the DNA double-stranded fragment; and dNTPs, wherein all dNTPs having the same bases as the target modified nucleotide are modified dNTPs. The DNA single-strand replacement kit is used to form a nascent strand complementary to the 5' end sequence at the 3' end of the DNA double-stranded fragment, wherein all nucleotides having the same bases as the target modified nucleotide are modified nucleotides.

[0078] In some embodiments, the adapter ligation kit includes: a dual-link header, at least one single strand of which is a adapter substitution single strand, wherein the nucleotides in the adapter substitution single strand that have the same bases as the target modified nucleotide are all modified nucleotides; and a nuclease. The adapter ligation kit is used to ligate the dual-link header to a double-stranded DNA fragment.

[0079] In some embodiments, the unmodified nucleotide conversion kit for the detection of methylated cytosine includes a bisulfite conversion kit or an enzymatic conversion kit. In some embodiments, the unmodified nucleotide conversion kit for the detection of methylated adenine includes a nitrite conversion kit or an enzymatic conversion kit.

[0080] In some embodiments, the PCR amplification kit includes: at least one forward universal primer and at least one reverse specific primer; DNA polymerase; and dNTPs, including dATP, dGTP, dTTP, and dCTP. The PCR amplification kit is used to perform at least one round of PCR amplification to obtain a DNA library. Preferably, the PCR amplification kit further includes at least one reverse universal primer.

[0081] Those skilled in the art will understand that there may be no clear boundaries between the various kits categorized by reaction stage, and the kits and their reagent components are not entirely independent. For example, compatible buffer solutions or compatible salt ion mixtures may be provided for use in one or more reaction stages. Those skilled in the art are capable of reasonably determining which reagent components are suitable for use in one or more reaction stages, thus providing only a sufficient number of portions in the kit. Those skilled in the art will understand that the aforementioned kits or kits will include reagents, instruments or consumables, instructions, etc.

[0082] In some preferred embodiments, the endonuclease includes at least one of deoxyribonuclease I (DNase I), deoxyribonuclease II (DNase II), micrococcal nuclease (MNase), double-stranded specific DNAase (dsDNase), salt-active nuclease (SAN), and endonuclease Vvn.

[0083] In some embodiments, the nucleic acid polymerase has 5'-3' polymerase activity. In some preferred embodiments, the nucleic acid polymerase is a DNA-dependent DNA polymerase. In some more preferred embodiments, the nucleic acid polymerase includes at least one of T4 DNA polymerase, DNA polymerase I (Klenow) large fragment (Klenow fragment), T7 DNA polymerase, DNA polymerase I, Taq DNA polymerase, Bst DNA polymerase, and Phi29 DNA polymerase.

[0084] In some embodiments, the nucleic acid polymerase has 5'-3' strand substitution activity. In some preferred embodiments, the nucleic acid polymerase is a DNA-dependent DNA polymerase. In some more preferred embodiments, the nucleic acid polymerase includes T4 DNA polymerase, DNA polymerase I (Klenow) large fragment (Klenow fragment), Klenow Fragment (3'→5' exo-), and... DNA polymerase, (exo-)DNA polymerase, Deep DNA polymerase, Deep At least one of (exo–)DNA polymerase, DNA polymerase I, Taq DNA polymerase, Bst DNA polymerase, and Phi29 DNA polymerase.

[0085] In some preferred embodiments, the nucleic acid polymerase possesses both 5'-3' polymerase activity and 5'-3' strand substitution activity. In some preferred embodiments, the nucleic acid polymerase may be provided in the form of an enzyme mixture. In some more preferred embodiments, the enzyme mixture includes T4 DNA polymerase, Klenow Fragment, and Taq DNA polymerase. Specifically, Taq DNA polymerase can add a base A to the 3' end of DNA. By adding a base A to the 3' end of the DNA double-stranded fragment to form a sticky end, it facilitates subsequent ligation with a double-stranded linker having a sticky T end. In some further preferred embodiments, the Taq DNA polymerase is recombinant Taq DNA polymerase (r-Taq DNA polymerase).

[0086] In some preferred embodiments, the enzyme mixture further includes a nuclease. In some more preferred embodiments, the nuclease may be deoxyribonuclease I (DNase I).

[0087] In some optional embodiments, the enzyme mixture further includes a phosphokinase or a phosphatase. In some optional embodiments, the enzyme mixture further includes a polynucleotide 5'-hydroxykinase. Preferably, the polynucleotide 5'-hydroxykinase is T4 polynucleotide kinase (T4 PNK).

[0088] In some implementations, the dNTPs in the DNA single-strand replacement kit that share the same bases as the target modified nucleotide are all modified dNTPs. For example, when the target is to detect methylated cytosine (5mC or 5hmC), 5m-dCTP or 5hm-dCTP is used as the dNTP, instead of unmethylated dCTP. Similarly, when the target is to detect methylated adenine (6mA), 6m-dATP is used as the dNTP, instead of unmethylated dATP. Likewise, when the target is to detect both methylated cytosine (5mC and 5hmC) and methylated adenine (6mA), or other modified nucleotides, the dNTPs of the corresponding modified nucleotide are used, instead of unmodified dNTPs with the same bases.

[0089] In some embodiments, the DNA single-strand replacement kit further includes: magnesium ions and / or manganese ions; calcium ions. In some preferred embodiments, magnesium ions are provided in the form of MgCl2 or MgSO4; manganese ions are provided in the form of MnCl2. In some preferred embodiments, calcium ions are provided in the form of CaCl2.

[0090] In some embodiments, the DNA single-strand replacement kit further includes a buffer solution. In some preferred embodiments, the buffer solution includes citrate buffer, MES buffer, phosphate buffer, Bis-tris buffer, and Tris hydrochloric acid buffer. In some optional embodiments, the buffer solution contains potassium ions and / or ammonium ions. Preferably, potassium ions are provided in the form of KCl; ammonium ions are provided in the form of (NH4)2SO4.

[0091] In some embodiments, the nucleic acid ligase comprises a DNA ligase. In some more preferred embodiments, the DNA ligase comprises at least one of an ATP-dependent DNA ligase and an NAD+-dependent DNA ligase. In some even more preferred embodiments, the DNA ligase comprises at least one of T4 DNA ligase, Taq DNA ligase, DNA ligase I, DNA ligase III, and DNA ligase IV.

[0092] In some preferred embodiments, the connector kit further includes a connection buffer. In some preferred embodiments, the connection buffer includes citrate buffer, MES buffer, phosphate buffer, Bis-tris buffer, and Tris hydrochloride buffer.

[0093] In some preferred embodiments, the adapter ligation kit further includes a coenzyme factor. Specifically, when the DNA ligase includes T4 DNA ligase, the coenzyme factor includes ATP and magnesium ions (Mg²⁺). 2+When the Taq DNA ligase includes T4 DNA ligase, the coenzyme factor includes NAD+. + .

[0094] According to some embodiments of this application, the linker is a synthetic double-stranded linker, wherein at least one single strand of the double-stranded linker contains modified nucleotides having the same bases as the target modified nucleotide (i.e., a "linker-substituted single strand"). According to some embodiments of this application, the linker-substituted single strand is used to ligate to the 5' end of a DNA double-stranded fragment. However, the nucleotides having the same bases as the target modified nucleotides in the other single strand of the double-stranded linker (excluding the linker-substituted single strand) may all be modified nucleotides, or they may not be modified.

[0095] According to some embodiments of this application, the 3' end of the adapter replacement single strand of the double-link head has a protruding end. In some embodiments, the 3' end of the adapter replacement single strand that connects to the 5' end of the DNA double-stranded fragment has a protruding end. Preferably, the protruding end of the 3' end of the adapter replacement single strand is complementary to the protruding end of the 3' end of the DNA double-stranded fragment, thereby enabling the double-link head to recognize and connect with the DNA double-stranded fragment. For example, when the protruding end of the 3' end of the DNA double-stranded fragment is one or more A bases, the corresponding protruding end of the 3' end of the double-link head replacement single strand is designed to be the corresponding number of T bases.

[0096] In some preferred embodiments, only one single strand of the double-linked connector contains modified nucleotides with the same bases as the target modified nucleotide; that is, only one linker replaces a single strand. In some more preferred embodiments, only one linker replaces a single strand of the double-linked connector, and at least the other single strand of the double-linked connector has a phosphate group at its 5' end. The strand with the phosphate group at its 5' end in the double-linked connector is used to connect to the 3' end (i.e., the nascent strand) of the DNA double-stranded product.

[0097] According to some embodiments of this application, the sequences of the two single strands of the double-linked header can be completely complementary or partially complementary. In some embodiments, the sequences of the two single strands of the double-linked header can be complementary at either end or at both ends. In some embodiments, the two single strand sequences at the end of the double-linked header that connects to the DNA double-stranded fragment are complementary (i.e., the double-linked header has a Y-shaped structure). In some embodiments, the two single strand sequences in the middle portion of the double-linked header are not complementary (i.e., the double-linked header has a bubble-like structure).

[0098] In some embodiments, the two single strands of the dual-link head may have the same number of bases, or the two single strands of the dual-link head may have different numbers of bases. In some embodiments, the two single strands of the dual-link head may each have 20-50 nt of bases. More preferably, the two single strands of the dual-link head may each have 25-40 nt of bases. In some embodiments, the length of the non-complementary portion between the two single strands of the dual-link head may be 10-30 nt. More preferably, the length of the non-complementary portion between the two single strands of the dual-link head may be 15-25 nt. In some embodiments, the total length of the complementary portion between the two single strands of the dual-link head may be 10-30 bp. More preferably, the total length of the complementary portion at both ends of the two single strands of the dual-link head may be 15-25 bp. Those skilled in the art can adjust the length of the complementary or non-complementary portion in the middle or at both ends of the designed dual-link head according to the specific sequence of the two single strands of the dual-link head, thereby providing a stable dual-link head.

[0099] In some embodiments, the unmodified nucleotide conversion kit for detecting methylated cytosine can employ a bisulfite conversion kit or an enzymatic conversion kit. In some preferred embodiments, the bisulfite conversion kit can include, but is not limited to, Diagenode's Premium Bisulfite kit, Qiagen's EpiTect Bisulfite kit, Promega's MethylEdge Bisulfite Conversion System, Epigentek's BisulFlash DNA Modification kit, etc. In some embodiments, the unmodified nucleotide conversion kit for the differential detection of methylated cytosine at 5hmC and 5mC can employ Epigentek's BisulPlus Loci5mC&5hmC Detection PCR kit. In some preferred embodiments, the enzymatic conversion kit may include oxidases (Ten-Eleven Translocase, TET enzyme), T4-glucosyltransferase (T4-BGT), and cytosine deaminase (APOBEC enzyme). In some preferred embodiments, the enzymatic conversion kit may include, but is not limited to, the NEBNext Enzymatic Methyl-seq Kit (EM-seq) from NEB Corporation. TM ).

[0100] According to some embodiments of this application, the forward universal primer is designed for the adapter-substituted single strand of the double-linked DNA. In some embodiments, the forward universal primer is designed for a partial sequence of the adapter-substituted single strand. According to some embodiments of this application, the forward universal primer may be designed as a partial sequence of the adapter-substituted single strand of the double-linked DNA, or the forward universal primer may be designed as a partial complementary sequence of the adapter-substituted single strand of the double-linked DNA. According to some embodiments of this application, the reverse specific primer is designed for the nascent strand. In some embodiments, the reverse specific primer is designed for the 3' end sequence of the target region of the double-stranded DNA. In some embodiments, the reverse specific primer is designed for the 3' end sequence of the target region of the double-stranded DNA in the nascent strand. In some specific embodiments, the forward universal primer has at least a partial sequence identical to the adapter-substituted single strand in the double-linked DNA, and the reverse specific primer is designed for the 3' end sequence of the target region of the double-stranded DNA in the nascent strand. By PCR amplification, a PCR amplification product of a single strand with an adapter-substituted single strand at the 5' end and a nascent strand at the 3' end in a transformed double-stranded DNA template can be specifically obtained.

[0101] In some preferred embodiments, when the other single strand in the double-stranded header also contains modified nucleotides, a different forward universal primer can be designed for the sequence of that other single strand, and a different reverse specific primer can be used. This allows PCR amplification of the other strand in the transformed DNA template to be obtained. When both strands of the double-stranded header are designed to contain modified nucleotides, PCR amplification products of the two non-completely complementary single strands in the transformed DNA double strand can be obtained simultaneously, enabling analysis of the modification information of each single strand in subsequent detection.

[0102] In some preferred embodiments, during PCR amplification, two or more pairs of reverse specific primers and forward universal primers can be used to amplify two or more target regions in the DNA double helix, or two or more target regions in the two single strands of the DNA double helix can be amplified simultaneously.

[0103] One or more subsequent PCRs can be performed on the products amplified in the previous round of PCR. In some preferred embodiments, the second round of PCR or subsequent PCR is nested PCR. In some more preferred embodiments, the primers used for subsequent PCR include a second forward universal primer and at least one second reverse specific primer. The second (subsequent) forward universal primer is designed for adapter substitution single strands in double-linked heads. For example, the second (subsequent) forward universal primer can be identical to the previous round forward universal primer, or it can be designed for the region sequence in the previous round of PCR amplification products where the previous round forward universal primer binds to the PCR amplification products. The second (subsequent) forward universal primer can bind within the binding site of the first (previous round) forward universal primer on the previous round of PCR amplification products. The second (subsequent) forward universal primer and the first (previous round) forward universal primer can have partially identical or partially complementary sequences.

[0104] In some embodiments, the second (subsequent) reverse-specific primer is designed for nascent strands. In some preferred embodiments, the second (subsequent) reverse-specific primer binds within the binding site of the first (previous) reverse-specific primer on the product of the previous PCR amplification. In some preferred embodiments, the second (subsequent) reverse-specific primer may be completely different from the first (previous) reverse-specific primer, or may have partially identical or partially complementary sequences.

[0105] In some preferred embodiments, the second (subsequent) forward universal primer and the first (previous) forward universal primer, or the second (subsequent) reverse specific primer and the first (previous) reverse specific primer, have at least 6 nt of identical continuous sequence; more preferably, they have at least 10 nt of identical continuous sequence. More preferably, the second (subsequent) forward universal primer and the first (previous) forward universal primer, or the second (subsequent) reverse specific primer and the first (previous) reverse specific primer, have 6-18 nt of identical continuous sequence; more preferably, they have 10-18 nt of identical continuous sequence.

[0106] In some preferred embodiments, to facilitate subsequent sequencing, at least the primers used to perform the final round of PCR amplification have sequencing tag sequences. Preferably, the primers with sequencing tag sequences can be forward primers or reverse primers, or both the forward and reverse primers used to perform the final round of PCR amplification have sequencing tag sequences. In some more preferred embodiments, the sequencing tag sequences include, but are not limited to, unique molecular tag (UMI) sequences and sample tag sequences. In some more preferred embodiments, the sequencing tag sequences include, but are not limited to, barcode sequences or index sequences. In some alternative embodiments, primers with sequencing tag sequences may be additionally added, at least during the final round of PCR amplification. Preferably, the additional primers with sequencing tag sequences can be forward primers, reverse primers, or both. Preferably, the additional forward primers with sequencing tag sequences have at least partially identical or partially complementary sequences to the forward universal primers, or the additional reverse primers with sequencing tag sequences have at least partially identical or partially complementary sequences to the reverse specific primers. Preferably, the additional forward primer with sequencing tag sequence and the forward universal primer, as well as the additional reverse primer with sequencing tag sequence and the reverse specific primer, have at least partially identical or partially complementary sequences.

[0107] In some preferred embodiments, the PCR amplification kit further includes: PCR buffer; magnesium ions. Preferably, the magnesium ions may be provided in the form of MgCl2 or MgSO4. More preferably, the concentration of the magnesium ions is 1-50 mmol / L.

[0108] According to another embodiment of this application, a kit for detecting DNA modification is provided, comprising:

[0109] DNA single-strand replacement kit; adapter ligation kit; unmodified nucleotide conversion kit; PCR amplification kit; sequencing kit. The sequencing kit is used for sequencing DNA libraries.

[0110] In some embodiments, the sequencing kit includes sequencing reagents or sequencing aids. In some preferred embodiments, the sequencing reagents or sequencing aids include, but are not limited to, nucleic acid extraction kits, nucleic acid purification kits, sequencing chips, or sequencers.

[0111] Those skilled in the art can reasonably provide sequencing kits based on existing known sequencing technologies or other suitable sequencing technologies. In some preferred embodiments, the sequencing kit includes, but is not limited to, sequencing kits based on DNBseq sequencing technology from MGI (Mega-Machinery). According to some embodiments of this application, sequencing techniques that repeatedly sequence the same template can correct read sequences, thereby improving sequencing accuracy.

[0112] According to another embodiment of this application, the application of the above-described methods for constructing DNA libraries with modified nucleotides, methods for detecting DNA modifications, kits for constructing DNA libraries with modified nucleotides, and kits for detecting DNA modifications is provided.

[0113] In some embodiments, the methods for constructing DNA libraries with modified nucleotides, the methods for detecting DNA modifications, the kits for constructing DNA libraries with modified nucleotides, and the kits for detecting DNA modifications described in the above-described aspects are used to analyze DNA methylation information. In some embodiments, the application of analyzing DNA methylation information is for non-therapeutic or diagnostic purposes, such as for scientific research purposes. DNA methylation analysis for scientific research purposes is well known to those skilled in the art.

[0114] In some implementations, analyzing DNA methylation information includes qualitative and / or quantitative analysis of DNA methylation levels.

[0115] In some implementations, analyzing DNA methylation information includes analyzing the methylation levels of both single strands of the DNA double strand.

[0116] In some implementations, analyzing DNA methylation information includes transient or long-term analysis of individuals or groups of humans or animals.

[0117] In some implementations, the application includes analyzing the relationship between DNA methylation levels and organism development.

[0118] In some implementations, the application includes analyzing the link between DNA methylation levels and disease occurrence.

[0119] In some implementations, the application includes analyzing the link between DNA methylation levels and tumor development.

[0120] In some implementations, the application includes analyzing the relationship between DNA methylation levels and drug resistance.

[0121] According to the embodiments of this application, the various aspects provided by this application have the first aspect of the beneficial effect, including but not limited to: 1. avoiding the need to design degenerate primers, thereby greatly reducing the difficulty of multiple primer design;

[0122] 2. Improve the specificity of multiplex PCR amplification and reduce the formation of primer dimers;

[0123] 3. Compared with the traditional method of reducing the complexity of methylation sequences, it improves the pyrimidine coverage, and the formation of chimeric fragments through nested PCR can further improve the accuracy of DNA methylation alignment. Attached Figure Description

[0124] Figure 1 A schematic diagram of the structure of a dual-link header according to an embodiment of this application is shown.

[0125] Figure 2 A flowchart illustrating a method for constructing a DNA library according to an embodiment of this application is shown.

[0126] Figure 3 A schematic diagram of the structure of a specific dual-link header according to an embodiment of this application is shown.

[0127] Figure 4 The Q-Seq detection results and recovery yield according to an embodiment of this application are shown.

[0128] Figure 5 The image shows a gel electrophoresis diagram of the DNA library product constructed according to an embodiment of this application.

[0129] Figure 6 The diagram shows the base distribution after methylation conversion according to an embodiment of this application. Detailed Implementation

[0130] The following specific embodiments further illustrate the content of this application in detail. Unless otherwise specified, the raw materials, reagents, or apparatus used in the embodiments and comparative examples are all available from conventional commercial sources or can be obtained by existing technical methods. Unless otherwise specified, the testing or experimental methods are conventional methods in the art.

[0131] Unless otherwise stated, those skilled in the art will understand that the chemical terms used above and throughout this specification have their common meaning in the art. A particular term or phrase should not be considered uncertain or unclear unless specifically defined, but should be understood in its common meaning. When trade names appear herein, they are intended to refer to the corresponding product or its active ingredient.

[0132] Unless otherwise indicated or defined, all terms used herein have their usual meaning in the art, which will be clear to those skilled in the art. For example, refer to standard manuals such as Molecular Cloning: A Laboratory Manual (Sambrook et al., "Molecular Cloning: A Laboratory Manual" (4th Ed.), Vols. 1-3, ColdSpring Harbor Laboratory Press, 2012); Lewin's Genes XI (Krebs et al., "Lewin's Genes XI", Jones & Bartlett Learning, 2017); and Modern Molecular Biology (Zhu Yuxian et al., Modern Molecular Biology (5th Edition), Higher Education Press, 2019).

[0133] The subject matter of this application and the claims specifically relates to artificial products or methods of using or producing such artificial products, which may be variants of natural (wild-type) products. Although there may be a degree of sequence identity with natural structures, it is understood that the materials, methods, and uses of the present invention (e.g., specifically isolated nucleic acid sequences) are “artificial” or synthetic and should therefore not be considered as a result of “natural laws”.

[0134] The terms “first” and “second” as used herein are for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. Thus, a feature defined as “first” or “second” may explicitly or implicitly include at least one of that feature. In the description herein, “multiple” means at least two, such as two, three, etc., unless otherwise explicitly specified.

[0135] The terms “comprising,” “including,” “having,” and “containing” as used herein can be used as synonyms and should be understood as open-ended definitions that allow for the presence of other components, parts, or elements. “Comprising of…” is considered the most closed definition, containing no other elements besides those defining the constituent features. Therefore, “comprising” is broader and encompasses the definition of “comprising of…”.

[0136] As used herein, the term “about” means the same value or a value that differs from a given value by + / - 5%, specifically by + / - 2%, and more specifically by + / - 1%.

[0137] As used in this article, the term “partial” means “at least partially”, and therefore, unless there is a clear contradiction with the preceding or following text, “partially” includes both “partially” and “completely”.

[0138] As used herein and in the claims, the singular form, such as "an / a," includes the plural unless the context clearly indicates otherwise.

[0139] Example

[0140] The following examples further illustrate the method, kit, and application for detecting DNA modifications using methylated cytosine according to this application. The examples described herein are illustrative of the subject matter of this application and are not intended to limit the scope of this application. Many modifications and variations can be made to the technical solutions described and illustrated herein without departing from the scope of this application. Therefore, it should be understood that these examples are merely illustrative and do not limit the scope of the invention.

[0141] The materials used in the methods for detecting DNA modifications by detecting methylated cytosine disclosed herein are obtainable by standard, well-known methods, and many materials are commercially available. Even if not commercially available, they can be prepared and extracted using standard techniques known to those skilled in the art. The construction and / or sequencing methods provided herein comprise multiple reaction steps, each of which can be performed independently and may or may not have one or more pre- or post-processing steps. Therefore, this application aims to protect each individual reaction step of the construction and / or sequencing methods separately provided herein.

[0142] According to one embodiment of this application, a method for constructing a DNA library for detecting methylated cytosine is provided, wherein the target modified nucleotide is methylated cytosine (including 5-methylcytosine 5mC and 5-hydroxymethylcytosine 5hmC), comprising the following steps:

[0143] A DNA double-stranded fragment is provided, and a new strand is formed at the 3' end of the DNA double-stranded fragment that is complementary to the 5' end sequence and in which all cytosines are methylated cytosines, to obtain a DNA double-stranded product;

[0144] The DNA double-stranded product is ligated to a double-linker to obtain a ligation product; wherein at least one single strand of the double-linker is a linker-substituted single strand, and all cytosine in the linker-substituted single strand is methylated cytosine.

[0145] The unmethylated cytosine in the ligation product is converted into uracil to obtain the DNA double-stranded conversion product;

[0146] The DNA double-stranded transformation product is subjected to at least one round of PCR amplification using at least one forward universal primer and at least one reverse specific primer to obtain a DNA library; wherein the forward universal primer is designed for the adapter replacement single strand, and the reverse specific primer is designed for the newly formed strand.

[0147] According to some embodiments of this application, when used for "DNA double helix", the term "new strand" refers to the replacement of all nucleotides of the same base type (whether modified or not) in the continuous sequence of the 3' end portion of the DNA double helix with the modified nucleotides.

[0148] According to some embodiments of this application, compared with existing methylation-specific single-end anchored multiplex PCR amplicon sequencing, the technical solution of this application, after transformation with unmethylated cytosine, maintains the genetic information (C will not be converted to T) because the newly generated single strands with introduced methylated cytosine at the 3' end of the DNA double strand and the adapter replacement single strands at the double-stranded linker remain unchanged. Therefore, it is not necessary to design reverse degenerative primers. Thus, only the 3' end of the target region needs to be known to specifically enrich the target region. This means a significant reduction in primer design difficulty and a lower rate of primer dimer formation, which will also avoid the problem of reduced complexity in traditional methylated sequences by achieving high pyrimidine coverage. In the case of nested PCR, the formation of chimeric fragments may further improve the accuracy of DNA methylation alignment.

[0149] In some embodiments, DNA double-stranded fragments are provided by breaking the DNA double strand using sonication or enzymatic digestion. In some preferred embodiments, DNA double-stranded fragments are provided by breaking the DNA double strand using enzymatic digestion. In some embodiments, the provided DNA double-stranded fragments have single-stranded sticky ends, including a 5' single-stranded sticky end. In some embodiments, the provided DNA double-stranded fragments have notches on the single strands.

[0150] In some preferred embodiments, a nuclease is used to break the DNA double strand to provide DNA double-stranded fragments. More preferably, the nuclease includes at least one selected from deoxyribonuclease I (DNase I), deoxyribonuclease II (DNase II), micrococcal nuclease (MNase), double-strand specific DNase (dsDNase), salt-active nuclease (SAN), and nuclease Vvn. In some further preferred embodiments, the nuclease is deoxyribonuclease I (DNase I).

[0151] In some preferred embodiments, the concentration of the endonuclease in the reaction system is 0.00001 U / μL-0.1 U / μL; preferably 0.0001 U / μL-0.01 U / μL; more preferably 0.0001 U / μL-0.005 U / μL; and even more preferably 0.0002 U / μL.

[0152] In some preferred embodiments, the enzymatic hydrolysis is carried out at 14-45°C for 5-60 min; preferably at 16-40°C for 10-50 min; more preferably at 25-40°C for 10-40 min; and even more preferably at 37°C for 15-30 min.

[0153] In some preferred embodiments, the enzymatic hydrolysis is carried out in the presence of calcium ions as well as magnesium ions and / or manganese ions.

[0154] Preferably, the concentration of magnesium ions and / or manganese ions is 0.1-200 mmol / L; more preferably, the concentration of magnesium ions and / or manganese ions is 0.5-100 mmol / L; even more preferably, the concentration of magnesium ions and / or manganese ions is 1-50 mmol / L.

[0155] Preferably, the concentration of calcium ions is 0.001-50 mmol / L; more preferably, the concentration of calcium ions is 0.01-25 mmol / L; and even more preferably, the concentration of calcium ions is 0.1-10 mmol / L.

[0156] In some preferred embodiments, the enzymatic digestion is performed in a buffer solution. More preferably, the buffer solution includes citrate buffer, MES buffer solution, phosphate buffer, Bis-tris buffer, and Tris hydrochloride buffer. Preferably, the pH of the buffer solution is 6-9; more preferably, the pH of the buffer solution is 6.5-8.5; and even more preferably, the pH of the buffer solution is 7-8. Those skilled in the art can select the buffer solution and adjust its pH value according to the specific type of endonuclease used and the desired effect.

[0157] In some preferred embodiments, the provided DNA double-stranded fragment is less than 1000 bp; more preferably, the DNA double-stranded fragment is 150-800 bp; even more preferably, the DNA double-stranded fragment is 350-500 bp.

[0158] In some embodiments, DNA double-stranded fragments provided by enzymatically breaking down the DNA double helix can be used to form new strands without purification. Therefore, breaking down the DNA double helix and forming new strands can be carried out in the same tube or reactor.

[0159] In some embodiments, the DNA double-stranded fragments provided by breaking the DNA double helix by enzymatic digestion may have single-stranded sticky ends, including 5' single-stranded sticky ends; the single strands of the provided DNA double-stranded fragments may also have gaps.

[0160] In some embodiments, a nucleic acid polymerase is used to form a new strand complementary to the 5' end sequence at the 3' end of a DNA double-stranded fragment.

[0161] In some embodiments, for a DNA double-stranded fragment having a 5' single-stranded sticky end, a nucleic acid polymerase with 5'-3' polymerase activity is used to form a new strand complementary to the 5' single-stranded sticky end from the 3' end of the DNA double-stranded fragment. In some preferred embodiments, the nucleic acid polymerase with 5'-3' polymerase activity is a DNA-dependent DNA polymerase. In some more preferred embodiments, the nucleic acid polymerase includes at least one of T4 DNA polymerase, DNA polymerase I (Klenow) large fragment (Klenow fragment), T7 DNA polymerase, DNA polymerase I, Taq DNA polymerase, Bst DNA polymerase, and Phi29 DNA polymerase.

[0162] In some embodiments, for a DNA double-stranded fragment with a gap in its single strand, a nucleic acid polymerase with 5'-3' strand substitution activity is used to form a new strand complementary to the 5' end sequence from the gap at the 3' end of the DNA double-stranded fragment. Herein, the term "strand substitution activity" refers to a property of a nucleic acid polymerase that allows the DNA polymerase to "displace" one strand from an existing DNA double-strand during the synthesis of a new DNA strand, thus enabling the successful synthesis of a new DNA single strand. In some preferred embodiments, the nucleic acid polymerase with 5'-3' strand substitution activity is a DNA-dependent DNA polymerase. In some more preferred embodiments, the nucleic acid polymerase includes T4 DNA polymerase, DNA polymerase I (Klenow) large fragment (Klenow fragment), Klenow Fragment (3'→5' exo-), and... DNA polymerase, (exo-)DNA polymerase, Deep DNA polymerase, Deep At least one of (exo–)DNA polymerase, DNA polymerase I, Taq DNA polymerase, Bst DNA polymerase, and Phi29 DNA polymerase.

[0163] According to some embodiments of this application, in order to ensure that the cytosine in the formed replacement single strand is methylated cytosine (5mC or 5hmC) in the DNA single strand replacement step, methylated dCTP, i.e., 5m-dCTP or 5hm-dCTP, is used in the dNTP of the reaction system.

[0164] In some preferred embodiments, a new strand complementary to the 5' end sequence is formed in a continuous sequence at the 3' end of the DNA double-stranded fragment. In some preferred embodiments, the length of the formed new strand can be 20-50 nt; more preferably, the length of the formed new strand can be 25-40 nt.

[0165] In some embodiments, the DNA double-stranded product has blunt ends or overhanging ends at both ends. In some embodiments, the DNA double-stranded product has overhanging ends at the ends. In some preferred embodiments, the 3' end of the DNA double-stranded product has an overhanging end. In some preferred embodiments, the 3' end of the nascent strand of the DNA double-stranded product has an overhanging end with one or more A bases.

[0166] In some preferred embodiments, a nucleic acid polymerase possessing both 5'-3' polymerase activity and 5'-3' strand substitution activity is selected, thereby simultaneously acting on DNA double strands with sticky single-strand ends or nicks in the single strand. In a system containing targeted modified dNTPs, this ensures that the cytosine nucleotides in the newly formed strand are all methylated cytosine nucleotides. Those skilled in the art can also reasonably adjust the specific selection of the above enzyme according to actual usage requirements, using nucleic acid polymerases with completely identical or similar functions as substitutes.

[0167] In some preferred embodiments, an enzyme mixture having the functions and activities of the aforementioned nucleic acid polymerases is used to form the nascent strand. In some specific embodiments, T4 DNA polymerase, Klenow fragment, and Taq DNA polymerase are used to form the nascent strand.

[0168] In this paper, the term "Klenow fragment" refers to a C-terminal 605 amino acid residue fragment generated by partial hydrolysis of E. coli DNA polymerase I by trypsin or subtilisin; this fragment retains the 5'→3' polymerase of DNA polymerase I and has 5'→3' strand substitution activity.

[0169] In this paper, the term "T4 DNA polymerase" refers to an enzyme isolated from E. coli infected with bacteriophage T4. It is similar to the large fragment (Klenow fragment) of Escherichia coli DNA polymerase I and has a similar molecular weight, but its amino acid composition is different. It contains at least 15 cysteine ​​residues.

[0170] In this paper, the term "Taq DNA polymerase" refers to a thermostable DNA polymerase with a molecular weight of 65 kDa, originally extracted by Saiki et al. from a strain of aquatic thermophilic bacterium (Thermus aquaticus) isolated from hot springs. This enzyme is heat-resistant; after 2 hours of reaction at 70°C, its residual activity is greater than 90% of its original activity; after 2 hours of reaction at 93°C, its residual activity is 60% of its original activity; and after 2 hours of reaction at 95°C, its residual activity is 40% of its original activity. In molecular cloning, Taq DNA polymerase can be used for DNA sequencing and for in vitro amplification of specific DNA fragments using PCR. During PCR, because Taq DNA polymerase is not inactivated during the denaturation step (approximately 94°C), it can directly enter the second cycle, thus eliminating the need to add fresh enzyme at each cycle. This makes Taq DNA polymerase a unique enzyme in PCR reactions. Furthermore, in the presence of dATP, Taq DNA polymerase can add the base A to the 3' end of DNA. Adding the base A to the 3' end of a DNA double-strand fragment creates protruding sticky ends. The preferred Taq DNA polymerase is recombinant Taq DNA polymerase (r-Taq DNA polymerase), which is particularly suitable for optimizing problem templates and / or GC-rich templates.

[0171] The Klenow fragment, T4 DNA polymerase, and Taq DNA polymerase mentioned above can be obtained by those skilled in the art through extraction using known techniques, or they can be obtained commercially.

[0172] In some preferred embodiments, the concentration of the nucleic acid polymerase having 5'-3' polymerase activity and / or 5'-3' chain displacement activity in the reaction system is 0.001 U / μL-1 U / μL; more preferably 0.005 U / μL-0.5 U / μL; and even more preferably 0.01 U / μL-0.3 U / μL.

[0173] In some preferred embodiments, the formation of the nascent chains using the aforementioned nucleic acid polymerase can be carried out simultaneously in the same tube or reactor. In some preferred embodiments, the reaction for forming the nascent chains is carried out at 50-75°C for 5-60 min; more preferably, at 55-70°C for 10-40 min; and even more preferably, at 60-65°C for 15-30 min.

[0174] Those skilled in the art can adjust the enzyme concentration, reaction temperature, and reaction time in the reaction system according to the type of nucleic acid polymerase used and the desired effect, so as to repair and fill the ends and synthesize the replacement single strand, while inactivating the endonuclease used to break the DNA double strand.

[0175] In some preferred embodiments, the nascent chains are formed using a nucleic acid polymerase in the presence of magnesium ions. Preferably, the magnesium ions are provided in the form of MgCl2 or MgSO4; more preferably, the magnesium ions are provided in the form of MgCl2. Preferably, the concentration of the magnesium ions is 0.1-200 mmol / L; more preferably, the concentration of the magnesium ions is 0.5-100 mmol / L; even more preferably, the concentration of the magnesium ions is 1-50 mmol / L.

[0176] In some preferred embodiments, the nascent chains are formed using a nucleic acid polymerase in a buffer solution. More preferably, the buffer solution includes citrate buffer, MES buffer, phosphate buffer, Bis-tris buffer, and Tris hydrochloride buffer. More preferably, the pH of the buffer solution is 6-9; more preferably, the pH of the buffer solution is 6.5-8.5; and even more preferably, the pH of the buffer solution is 7-8. In some optional embodiments, the buffer solution contains potassium ions and / or ammonium ions. Those skilled in the art can select the buffer solution and adjust its pH value and the concentration of potassium ions and / or ammonium ions according to the specific type of nucleic acid polymerase used and the desired effect.

[0177] In some embodiments, the 5' end of the DNA double-stranded product is phosphated. In some embodiments, phosphorylation is performed using a phosphokinase. In some embodiments, a phosphatase is used to remove the phosphate groups at the 5' and / or 3' ends of the nucleic acid fragment to obtain a dephosphorylated nucleic acid fragment. In some preferred embodiments, a polynucleotide 5'-hydroxykinase is added to the reaction system to phosphorylate the 5' end of the DNA double-stranded fragment, thereby giving the 5' end of the DNA double-stranded fragment a phosphate group. Preferably, the polynucleotide 5'-hydroxykinase is T4 polynucleotide kinase (T4 PNK).

[0178] In this document, the term "T4 polynucleotide kinase" (T4 PNK) refers to a polynucleotide 5'-hydroxy kinase that catalyzes the transfer of the γ-phosphate group of ATP to the 5'-hydroxy terminus and 3'-monophosphate nucleoside of an oligonucleotide chain (double-stranded or single-stranded DNA or RNA). T4 PNK enzymes can be obtained by extraction using known techniques or commercially available.

[0179] In some preferred embodiments, a nucleic acid ligase is used to ligate the DNA double-stranded product to a double-linker. In some preferred embodiments, the nucleic acid ligase includes a DNA ligase. In some more preferred embodiments, the DNA ligase includes at least one of an ATP-dependent DNA ligase and an NAD+-dependent DNA ligase. In some more preferred embodiments, the DNA ligase includes at least one of T4 DNA ligase, Taq DNA ligase, DNA ligase I, DNA ligase III, and DNA ligase IV. Those skilled in the art can also reasonably adjust the specific selection of the above enzymes according to actual usage requirements, using enzymes with completely identical or similar functions as substitutes.

[0180] In some preferred embodiments, the concentration of the nucleic acid ligase in the ligation reaction system is 0.1 U / μL-50 U / μL; more preferably 1 U / μL-20 U / μL. In some preferred embodiments, the adapter ligation reaction is carried out at 16-50°C for 5-60 min; more preferably, at 16-25°C for 10-40 min. Those skilled in the art can adjust the concentration of the selected DNA ligase, as well as the suitable reaction temperature and duration.

[0181] In some preferred embodiments, the reaction system for adapter ligation includes a buffer solution and a coenzyme factor. In some more preferred embodiments, the buffer solution includes citrate buffer, MES buffer solution, phosphate buffer, Bis-tris buffer, and Tris hydrochloride buffer. Preferably, the pH of the buffer solution is 6-9; more preferably, the pH of the buffer solution is 6.5-8.5; and even more preferably, the pH of the buffer solution is 7-8.

[0182] For T4 DNA ligase, coenzyme factors include ATP and magnesium ions (Mg). 2+ Preferably, the concentration of magnesium ions is 0.1-50 mmol / L. More preferably, the concentration of magnesium ions is 0.5-20 mmol / L. Even more preferably, the concentration of magnesium ions is 1-10 mmol / L. For Taq DNA ligase, the coenzyme factor includes NAD+. + The T4 DNA ligase and Taq DNA ligase mentioned above can be obtained by extraction using known techniques or commercially available. Those skilled in the art can adjust the appropriate buffer system, salt ions, coenzyme factors, and their concentrations according to the specific DNA ligase selected.

[0183] In some embodiments, the dual-linker is a synthetic dual-linker. According to some embodiments of this application, at least one single strand of the dual-linker contains methylated cytosine (i.e., a “linker-replacement single strand”), which is used to link to the 5' end of the DNA double-stranded fragment. However, the cytosine in the other single strand of the dual-linker, besides the linker-replacement single strand, may be entirely methylated cytosine or may not have methylation modification.

[0184] In some embodiments, the 3' end of the adapter replacement single strand of the dual-link head has a protruding end. Preferably, the 3' end of the adapter replacement single strand that connects to the 5' end of the DNA double-stranded product has a protruding end. Preferably, the protruding 3' end of the adapter replacement single strand is complementary to the protruding 3' end of the DNA double-stranded fragment, thereby enabling the dual-link head to recognize and connect with the DNA double-stranded fragment. For example, when the protruding 3' end of the DNA double-stranded fragment is one or more A bases, the corresponding protruding 3' end of the dual-link head replacement single strand is designed to be the corresponding number of T bases.

[0185] In some preferred embodiments, only one strand of the dual-linker head contains methylated cytosine, i.e., only one adapter-substituted single strand. To facilitate the ligation of the dual-linker head to the DNA double-stranded fragment, preferably, the 5' end of the dual-linker head has a phosphate group. In some embodiments, when only one strand of the dual-linker head is an adapter-substituted single strand, and the other strand's cytosine is unmodified (i.e., a "non-adaptor single strand"), then at least the 5' end of the non-adaptor single strand has a phosphate group.

[0186] In some embodiments, the sequences of the two single strands of the double-linked header may be completely complementary or partially complementary. In some embodiments, the sequences of the two single strands of the double-linked header may be partially complementary at either end or both ends. In some embodiments, the two single strand sequences at one end of the double-linked header that is connected to the DNA double-stranded fragment are complementary. In some embodiments, the two single strand sequences in the middle portion of the double-linked header are not complementary. The double-linked header according to some embodiments of this application has... Figure 1 The bubble-like structure is shown. In some embodiments, the two single strands of the dual-link head may have the same number of bases, or the two single strands of the dual-link head may have different numbers of bases. In some embodiments, the two single strands of the dual-link head may each have 20-50 nt of bases. More preferably, the two single strands of the dual-link head may each have 25-40 nt of bases.

[0187] In some embodiments, the length of the non-complementary portion between the two single chains of the dual-link header can be 10-30 nt. More preferably, the length of the non-complementary portion between the two single chains of the dual-link header can be 15-25 nt. In some embodiments, the total length of the complementary portion between the two single chains of the dual-link header can be 10-30 bp. More preferably, the total length of the complementary portion between the two single chains of the dual-link header can be 15-25 bp. Those skilled in the art can adjust the length of the complementary or non-complementary portions in the middle or at both ends according to the specific sequence of the two single chains of the designed dual-link header, thereby forming a stable dual-link header.

[0188] In some preferred embodiments, the concentration of the dual-linker in the ligation reaction system is 100 nmol / L to 10 μmol / L. More preferably, the concentration of the dual-linker in the ligation reaction system is 200 nmol / L to 800 nmol / L. Even more preferably, the concentration of the dual-linker in the ligation reaction system is 300 nmol / L to 600 nmol / L.

[0189] In some embodiments, the conversion of unmethylated cytosine is performed by at least one of bisulfite conversion or enzymatic conversion. In some preferred embodiments, the enzyme used for enzymatic conversion includes at least one of ten-eleven translocase (TET), T4-glucosyltransferase (T4-BGT), and cytosine deaminase (APOBEC). For both bisulfite conversion and enzymatic conversion, commercially available conversion kits are available to those skilled in the art. Suitable conversion kits can completely convert unmethylated cytosine (C) to uracil (U) with minimal DNA damage, ultimately producing a high-quality library.

[0190] According to some embodiments of this application, at least one round of PCR amplification is performed on the DNA double-stranded transformation product after the previous step of unmethylated cytosine transformation. The forward universal primer is designed for single-stranded DNA (adapter-substituted single-stranded DNA) where all cytosine in the double-stranded DNA is methylated. In some embodiments, the forward universal primer is designed for a portion of the adaptor-substituted single-stranded DNA. According to some embodiments of this application, the forward universal primer may be designed as a portion of the adaptor-substituted single-stranded DNA of the double-stranded DNA, or the forward universal primer may be designed as a portion of the complementary sequence of the adaptor-substituted single-stranded DNA of the double-stranded DNA. According to some embodiments of this application, the reverse specific primer is designed for the nascent DNA. In some embodiments, the reverse specific primer is designed for the 3' end sequence of the target region of the DNA double-stranded DNA. In some embodiments, the reverse specific primer is designed for the 3' end sequence of the target region of the DNA double-stranded DNA in the nascent DNA. In some specific embodiments, the forward universal primer has at least a portion of the same sequence as the adaptor-substituted single-stranded DNA in the double-stranded DNA, and the reverse specific primer is designed for the 3' end sequence of the target region of the DNA double-stranded DNA in the nascent DNA. PCR amplification can specifically obtain PCR amplification products of single strands with adapters replacing single strands at the 5' end and nascent strands at the 3' end in a transformed double-stranded DNA template.

[0191] According to some embodiments of this application, at least two rounds of PCR amplification are performed on the DNA double-stranded transformation product after the previous step of unmethylated cytosine transformation. The first round of PCR amplification uses a first forward universal primer and at least one first reverse specific primer, wherein the first forward universal primer is designed for adapter replacement of the double-stranded DNA at the linker head, and the first reverse specific primer is designed for the newly formed strand. In some embodiments, the first reverse specific primer is designed for the 3' end sequence outside or near the target region of the DNA double-stranded DNA in the newly formed strand. The second round of PCR amplification uses a second forward universal primer and at least one second reverse specific primer, wherein the second forward universal primer is designed for adapter replacement of the double-stranded DNA at the linker head. For example, the second forward universal primer can be identical to the first forward universal primer, or it can bind within the binding site of the first forward universal primer on the product of the previous round of PCR amplification. The second forward universal primer and the first forward universal primer can have partially identical or partially complementary sequences. In some embodiments, the second reverse specific primer is designed for the newly formed strand. In some embodiments, the second reverse specific primer binds within the binding site of the first reverse specific primer on the product of the previous round of PCR amplification. In some embodiments, the second reverse specific primer is designed to target the 3' end sequence within the target region of the DNA double strand in the nascent strand. In some preferred embodiments, the second reverse specific primer may be completely different from the first reverse specific primer, or may have partially identical or partially complementary sequences.

[0192] In some preferred embodiments, the subsequent round of forward universal primers and the previous round of forward universal primers, or the subsequent round of reverse specific primers and the previous round of reverse specific primers, have at least 6 nt of identical continuous sequence; more preferably, they have at least 10 nt of identical continuous sequence. Preferably, the subsequent round of forward universal primers and the previous round of forward universal primers, or the subsequent round of reverse specific primers and the previous round of reverse specific primers, have 6-18 nt of identical continuous sequence; more preferably, they have 10-18 nt of identical continuous sequence.

[0193] In some preferred embodiments, in one round of PCR amplification, two or more pairs of reverse specific primers and forward universal primers can be used to amplify two or more target regions in the DNA double helix, or two or more target regions in the two single strands of the DNA double helix can be amplified simultaneously.

[0194] One or more subsequent PCRs can be performed on the products amplified in the previous round of PCR. In some preferred embodiments, a second round of PCR is performed. In some preferred embodiments, the second round of PCR or subsequent PCRs are nested PCRs.

[0195] According to another embodiment of this application, a method for detecting DNA modification by detecting methylated cytosine is provided, wherein the target modified nucleotide is methylated cytosine (including 5-methylcytosine 5mC and 5-hydroxymethylcytosine 5hmC), comprising the following steps:

[0196] A DNA double-stranded fragment is provided, and a new strand is formed at the 3' end of the DNA double-stranded fragment that is complementary to the 5' end sequence and in which all cytosines are methylated cytosines, to obtain a DNA double-stranded product;

[0197] The DNA double-stranded product is ligated to a double-linker to obtain a ligation product; wherein at least one single strand of the double-linker is a linker-substituted single strand, and all cytosine in the linker-substituted single strand is methylated cytosine.

[0198] The unmethylated cytosine in the ligation product is converted into uracil to obtain the DNA double-stranded conversion product;

[0199] At least one round of PCR amplification was performed on the DNA double-stranded transformation product using at least one forward universal primer and at least one reverse specific primer to obtain a DNA library; wherein the forward universal primer was designed for the adapter replacement single strand, and the reverse specific primer was designed for the newly formed strand;

[0200] The DNA library was sequenced.

[0201] In some preferred embodiments, to facilitate subsequent sequencing, at least the primers used to perform the final round of PCR amplification have sequencing tag sequences. Preferably, the primers with sequencing tag sequences can be forward primers or reverse primers, or both the forward and reverse primers used to perform the final round of PCR amplification have sequencing tag sequences. More preferably, the sequencing tag sequences include, but are not limited to, unique molecular tag (UMI) sequences and sample tag sequences. For example, the sample tag sequence can be a barcode sequence or an index sequence. In some alternative embodiments, primers with sequencing tag sequences can be added at least in the final round of PCR amplification. By adding primers with sequencing tag sequences, nested PCR can be performed in the same round of PCR amplification, and the designed primer length can be avoided. Preferably, the primers with added sequencing tag sequences can be forward primers, reverse primers, or both. Preferably, the additional primers with sequencing tag sequences include a forward primer and a forward universal primer, and a reverse primer and a reverse specific primer, wherein at least two or any one of them has partially identical or partially complementary sequences. Preferably, the second (subsequent) PCR amplification uses a second (subsequent) forward universal primer and at least one second (subsequent) reverse specific primer, and additionally adds a first reverse universal primer, wherein the 5' end of the second (subsequent) reverse specific primer has a universal sequence, and the 3' end of the first reverse universal primer has a sequence complementary to the universal sequence of the second (subsequent) reverse specific primer.

[0202] In this article, the term "Unique Molecular Identifier" (UMI) refers to molecular barcoding or molecular tagging technology, which involves attaching a unique tag sequence to each DNA fragment, amplifying it via PCR, and then sequencing them together. The unique molecular tag (UMI) sequence is primarily used to distinguish different fragments within the same sample. In subsequent data analysis, these tags help eliminate errors introduced by DNA polymerase, amplification, and sequencing processes. Molecular tags typically consist of a random sequence of approximately 10 nt (e.g., NNNNNNNNN) or degenerate bases (NNNRNYN).

[0203] In this article, "barcode sequence" or "barcode sequence" refers to the use of a specific sequence tag to distinguish different samples in high-throughput sequencing. This tag is used to differentiate samples within the same flow channel, allowing for the separation of different sample data during subsequent analysis.

[0204] In this article, "index sequence" or "index sequence" refers to a special nucleotide sequence in sequencing technology, similar to a barcode sequence, used to separate data from different samples in high-throughput sequencing. This sequence is typically ligated to both ends of the target nucleic acid fragment and hybridized with a known sequence on the sequencing chip during sequencing, thereby binding the library to the chip and initiating sequencing.

[0205] In some embodiments, sequencing can be performed using any method known in the art, including but not limited to the use of conventional sequencing platforms, instruments, or equipment. In some embodiments, sequencing is performed using a sequencer. In some embodiments, sequencing methods include, but are not limited to, MGI's DNBseq sequencing technology. In some specific embodiments, DNBseq sequencing technology is used to sequence DNA libraries.

[0206] Those skilled in the art can reasonably adjust sequencing parameters based on the selected sequencing method to achieve the sequencing objective. In some embodiments of the present invention, the sequencing method further includes analyzing the sequencing data to obtain DNA modification information. According to some embodiments of this application, by aligning the sequencing reads of the transformed double-stranded DNA with the genomic reads, the accurate location of the sequencing reads is obtained. Based on the genomic alignment location, the original template strand information is then obtained, thereby obtaining accurate methylation alignment information.

[0207] In some specific embodiments, the constructed library is sequenced using a high-throughput sequencing platform, and the sequencing data undergoes quality control to remove low-quality reads and adapter sequences. All cytosine (C) in the reference genome is converted to thymine (T), generating a C-to-T converted reference genome. Sequencing reads are then aligned to the converted reference genome. Based on the alignment results, if a site aligns to T in the C-to-T converted reference genome but is C in the original sequence, the site is identified as unmethylated. If a site aligns to C in the C-to-T converted reference genome and is also C in the original sequence, the site is identified as methylated. The methylation rate is typically used to represent the proportion of methylated cytosine in the total cytosine.

[0208] According to another embodiment of this application, a DNA library construction kit for detecting methylated cytosine is also provided, comprising: a DNA single-strand replacement kit; a adapter ligation kit; an unmodified nucleotide conversion kit; and a PCR amplification kit.

[0209] In some embodiments, the DNA single-strand replacement kit includes: an endonuclease for breaking up the DNA double strand to provide a DNA double-stranded fragment; a nucleic acid polymerase for forming a nascent strand at the 3' end portion of the DNA double-stranded fragment that is complementary to the 5' end sequence and wherein all cytosines are methylated cytosines; and dNTPs, wherein all dCTPs are 5m-dCTPs.

[0210] In some embodiments, the adapter ligation kit includes: a dual-link header, wherein at least one single strand of the dual-link header is a adapter-replaced single strand, wherein all cytosine in the adapter-replaced single strand is methylated cytosine; and a nucleoligase. The adapter ligation kit is used to ligate the dual-link header to a double-stranded DNA fragment.

[0211] In some embodiments, the unmodified nucleotide conversion kit is used for the conversion of unmethylated cytosine, including: a bisulfite conversion kit or an enzymatic conversion kit.

[0212] In some embodiments, the PCR amplification kit includes: at least one forward universal primer and at least one reverse specific primer; DNA polymerase; and dNTPs, including dATP, dGTP, dTTP, and dCTP. The PCR amplification kit is used to perform at least one round of PCR amplification to obtain a DNA library. Preferably, the PCR amplification kit further includes at least one reverse universal primer.

[0213] Those skilled in the art will understand that there may be no clear boundaries between the various kits categorized by reaction stage, and the kits and their reagent components are not entirely independent. For example, compatible buffer solutions or compatible salt ion mixtures may be provided for use in one or more reaction stages. Those skilled in the art are capable of reasonably determining which reagent components are suitable for use in one or more reaction stages, thus providing only a sufficient number of portions in the kit. Those skilled in the art will understand that the aforementioned kits or kits will include reagents, instruments or consumables, instructions, etc.

[0214] In some preferred embodiments, the endonuclease includes at least one of deoxyribonuclease I (DNase I), deoxyribonuclease II (DNase II), micrococcal nuclease (MNase), double-stranded specific DNAase (dsDNase), salt-active nuclease (SAN), and endonuclease Vvn.

[0215] In some embodiments, the nucleic acid polymerase has 5'-3' polymerase activity. In some embodiments, the nucleic acid polymerase has 5'-3' strand substitution activity. In some preferred embodiments, the nucleic acid polymerase includes T4 DNA polymerase, DNA polymerase I (Klenow) large fragment (Klenow fragment), Klenow fragment (3'→5' exo-), DNA polymerase, (exo-)DNA polymerase, Deep DNA polymerase, Deep At least one of (exo–)DNA polymerase, T7 DNA polymerase, DNA polymerase I, Taq DNA polymerase, Bst DNA polymerase, and Phi29 DNA polymerase.

[0216] In some preferred embodiments, the nucleic acid polymerase may be provided in the form of an enzyme mixture. In some more preferred embodiments, the enzyme mixture includes T4 DNA polymerase, Klenow Fragment, and Taq DNA polymerase. Specifically, the Taq DNA polymerase may add a base A to the 3' end of the DNA. By adding a base A to the 3' end of the DNA double-stranded fragment to form a sticky end, it facilitates subsequent ligation with a double-stranded linker having a sticky T end. In some further preferred embodiments, the Taq DNA polymerase is recombinant Taq DNA polymerase (r-Taq DNA polymerase).

[0217] In some preferred embodiments, the enzyme mixture further includes a nuclease. In some more preferred embodiments, the nuclease may be deoxyribonuclease I (DNase I).

[0218] In some optional embodiments, the enzyme mixture further includes a phosphokinase or a phosphatase. In some optional embodiments, the enzyme mixture further includes a polynucleotide 5'-hydroxykinase. Preferably, the polynucleotide 5'-hydroxykinase is T4 polynucleotide kinase (T4 PNK).

[0219] In some embodiments, the DNA single-strand replacement kit further includes: magnesium ions and / or manganese ions; calcium ions.

[0220] In some preferred embodiments, magnesium ions are provided in the form of MgCl2 or MgSO4; manganese ions are provided in the form of MnCl2. In some preferred embodiments, calcium ions are provided in the form of CaCl2.

[0221] In some embodiments, the DNA single-strand replacement kit further includes a buffer solution. In some preferred embodiments, the buffer solution includes citrate buffer, MES buffer solution, phosphate buffer, Bis-tris buffer, and Tris hydrochloride buffer.

[0222] In some optional embodiments, the buffer solution contains potassium ions and / or ammonium ions. Preferably, potassium ions are provided in the form of KCl; ammonium ions are provided in the form of (NH4)2SO4.

[0223] In some embodiments, the nucleic acid ligase comprises a DNA ligase. In some more preferred embodiments, the DNA ligase comprises at least one of an ATP-dependent DNA ligase and an NAD+-dependent DNA ligase. In some more preferred embodiments, the DNA ligase comprises at least one of T4 DNA ligase, Taq DNA ligase, DNA ligase I, DNA ligase III, and DNA ligase IV.

[0224] In some preferred embodiments, the connector kit further includes a connection buffer. In some preferred embodiments, the connection buffer includes citrate buffer, MES buffer, phosphate buffer, Bis-tris buffer, and Tris hydrochloride buffer.

[0225] In some preferred embodiments, the adapter ligation kit further includes a coenzyme factor. In some specific embodiments, when the DNA ligase includes T4 DNA ligase, the coenzyme factor includes ATP and magnesium ions (Mg²⁺). 2+ In some specific embodiments, when the Taq DNA ligase includes T4 DNA ligase, the coenzyme factor includes NAD+. + .

[0226] According to some embodiments of this application, the dual-link head is a synthetic dual-link head in which at least one single strand contains methylated cytosine (i.e., a "linker-replacement single strand"), which is used to ligate to the 5' end of a DNA double-stranded fragment. However, the cytosine in the other single strand of the dual-link head, besides the linker-replacement single strand, may be entirely methylated cytosine or may not have methylation modification.

[0227] According to some embodiments of this application, the 3' end of the adapter replacing the single strand of the double-linked connector has a protruding end. In some embodiments, the 3' end of the adapter replacing the single strand of the double-linked connector, which connects to the 5' end of the DNA double-stranded fragment, has a protruding end. In some specific embodiments, when the 3' protruding end of the DNA double-stranded fragment is one or more A bases, the 3' protruding end of the single strand of the double-linked connector is correspondingly designed to be a corresponding number of T bases. For example, when the 3' protruding end of the DNA double-stranded fragment is one A base, the 3' protruding end of the single strand of the double-linked connector is correspondingly designed to be one T base.

[0228] In some preferred embodiments, only one single strand of the dual-link head contains methylated cytosine, meaning only one linker replaces a single strand. In some more preferred embodiments, only one linker replaces a single strand of the dual-link head, and at least the other single strand of the dual-link head has a phosphate group at its 5' end. The strand with the phosphate group at its 5' end in the dual-link head is used to connect to the 3' end (i.e., the nascent strand) of the DNA double-stranded product.

[0229] According to some embodiments of this application, the sequences of the two single strands of the dual-link head can be partially or completely complementary. In some embodiments, the sequences of the two single strands of the dual-link head can be partially complementary at either end or both ends. In some embodiments, the two single strand sequences at one end of the dual-link head that is connected to the DNA double-stranded fragment are complementary. In some embodiments, the two single strand sequences in the middle portion of the dual-link head are not complementary. The dual-link head according to some embodiments of this application has... Figure 1 The bubble-like structure is shown. In some embodiments, the two single strands of the dual-link head may have the same number of bases, or the two single strands of the dual-link head may have different numbers of bases. In some embodiments, the two single strands of the dual-link head may each have 20-50 nt of bases. More preferably, the two single strands of the dual-link head may each have 25-40 nt of bases.

[0230] In some embodiments, the length of the non-complementary portion between the two single chains of the dual-link header can be 10-30 nt. More preferably, the length of the non-complementary portion between the two single chains of the dual-link header can be 15-25 nt. In some embodiments, the total length of the complementary portion between the two single chains of the dual-link header can be 10-30 bp. More preferably, the total length of the complementary portions at both ends of the two single chains of the dual-link header can be 15-25 bp. Those skilled in the art can adjust the length of the non-complementary portion in the middle and the length of the complementary portions at both ends according to the specific sequence of the two single chains of the designed dual-link header, thereby forming a stable dual-link header.

[0231] The unmodified nucleotide conversion kit can be a bisulfite conversion kit or an enzymatic conversion kit. In some preferred embodiments, the bisulfite conversion kit can be, but is not limited to, the Premium Bisulfite kit from Diagenode, the EpiTect Bisulfite kit from Qiagenode, the MethylEdge Bisulfite Conversion System from Promega, the BisulFlash DNA Modification kit from Epigentek, etc.

[0232] In some preferred embodiments, the enzymatic conversion kit may include oxidases (Ten-Eleven Translocase, TET enzyme), T4-glucosyltransferase (T4-BGT), and cytosine deaminase (APOBEC enzyme). In some more preferred embodiments, the enzymatic conversion kit may employ, but is not limited to, the NEBNext Enzymatic Methyl-seq Kit (EM-seq) from NEB Corporation. TM ).

[0233] PCR amplification using a PCR amplification kit can specifically obtain PCR amplification products of single-stranded DNA templates with adapter-replaced single strands at the 5' end and nascent strands at the 3' end. According to some embodiments of this application, forward universal primers are designed for adapter-replaced single strands with double-linked heads. In some embodiments, forward universal primers are designed for partial sequences of the adapter-replaced single strand. According to some embodiments of this application, forward universal primers can be designed as partial sequences of adapter-replaced single strands with double-linked heads, or forward universal primers can be designed as partial complementary sequences of adapter-replaced single strands with double-linked heads. According to some embodiments of this application, reverse specific primers are designed for nascent strands. In some embodiments, reverse specific primers are designed for the 3' end sequence of the target double-stranded DNA region in the nascent strand.

[0234] In some preferred embodiments, the PCR amplification kit may include two or more pairs of reverse specific primers and a forward universal primer to amplify two or more target regions in a DNA double strand, or to perform one or more subsequent PCRs targeting the product of a previous PCR amplification round. In some preferred embodiments, the PCR amplification kit may include a second forward universal primer and at least one second forward universal primer. According to some embodiments of this application, the second (subsequent) forward universal primer is designed for adapter replacement of single strands in double-stranded DNA. For example, the second (subsequent) forward universal primer may be identical to the previous round's forward universal primer, or may have partially identical or partially complementary sequences. The second (subsequent) forward universal primer may bind within the binding site of the first (previous round) forward universal primer on the product of the previous PCR amplification round. In some preferred embodiments, the second (subsequent) reverse specific primer is designed for nascent strands. In some preferred embodiments, the second (subsequent) reverse specific primer binds within the binding site of the first (previous round) reverse specific primer on the product of the previous PCR amplification round. In some preferred embodiments, the second (subsequent) reverse specific primer may be completely different from the first (previous) reverse specific primer, or may have partially identical or partially complementary sequences.

[0235] In some preferred embodiments, the second (subsequent) forward universal primer and the first (previous) forward universal primer, or the second (subsequent) reverse specific primer and the first (previous) reverse specific primer, have at least 6 nt of identical continuous sequence; more preferably, they have at least 10 nt of identical continuous sequence. Preferably, the second (subsequent) forward universal primer and the first (previous) forward universal primer, or the second (subsequent) reverse specific primer and the first (previous) reverse specific primer, have 6-18 nt of identical continuous sequence; more preferably, they have 10-18 nt of identical continuous sequence.

[0236] In some preferred embodiments, to facilitate subsequent sequencing, at least the primers used to perform the final round of PCR amplification have sequencing tag sequences. Preferably, the primers with sequencing tag sequences can be forward primers or reverse primers, or both the forward and reverse primers used to perform the final round of PCR amplification have sequencing tag sequences. In some more preferred embodiments, the sequencing tag sequences include, but are not limited to, unique molecular tag (UMI) sequences and sample tag sequences. In some more preferred embodiments, the sequencing tag sequences include, but are not limited to, barcode sequences or index sequences. In some alternative embodiments, primers with sequencing tag sequences may be additionally added, at least during the final round of PCR amplification. Preferably, the additional primers with sequencing tag sequences can be forward primers, reverse primers, or both. Preferably, the forward primers and the general forward primers, and the reverse primers and the specific reverse primers, among the additional primers with sequencing tag sequences, have at least partially identical or partially complementary sequences.

[0237] In some preferred embodiments, the PCR amplification kit further includes: PCR buffer; magnesium ions. Preferably, the magnesium ions are provided in the form of MgCl2 or MgSO4; more preferably, the magnesium ions are provided in the form of MgCl2. Preferably, the concentration of the magnesium ions is 0.1-200 mmol / L; more preferably, the concentration of the magnesium ions is 0.5-100 mmol / L; even more preferably, the concentration of the magnesium ions is 1-50 mmol / L.

[0238] According to another embodiment of this application, a DNA modification detection kit for detecting methylated cytosine is also provided, comprising: a DNA single-strand substitution kit; a adapter ligation kit; an unmodified nucleotide conversion kit; a PCR amplification kit; and a sequencing kit. The sequencing kit is used for sequencing a DNA library.

[0239] In some embodiments, the sequencing kit includes sequencing reagents or sequencing aids. In some preferred embodiments, the sequencing reagents or sequencing aids include, but are not limited to, nucleic acid extraction kits, nucleic acid purification kits, sequencing chips, or sequencers.

[0240] Those skilled in the art can reasonably provide sequencing kits based on existing known sequencing technologies or other suitable sequencing technologies. In some preferred embodiments, the sequencing kit includes, but is not limited to, sequencing kits based on DNBseq sequencing technology from MGI (Mega-Tech International). According to some embodiments of this application, sequencing techniques that repeatedly sequence the same template can correct read sequences, thereby improving sequencing accuracy.

[0241] According to another embodiment of this application, the application of the DNA library construction method, DNA modification detection method, DNA library construction kit, and DNA modification detection kit of the above-described embodiments is provided.

[0242] In some embodiments, the application of the above-described aspects includes analyzing DNA methylation information. In some embodiments, the application of analyzing DNA methylation information is for non-therapeutic or diagnostic purposes, such as for scientific research purposes. DNA methylation analysis for scientific research purposes is well known to those skilled in the art.

[0243] In some embodiments, analyzing DNA methylation information includes qualitative and / or quantitative analysis of DNA methylation levels. In some embodiments, analyzing DNA methylation information includes analyzing the methylation levels of both single strands of a DNA double strand. In some embodiments, analyzing DNA methylation information includes transient or long-term analysis of an individual or population of humans or animals. In some embodiments, the application includes analyzing the association between DNA methylation levels and organismal development. In some embodiments, the application includes analyzing the association between DNA methylation levels and disease occurrence. In some embodiments, the application includes analyzing the association between DNA methylation levels and tumor development. In some embodiments, the application includes analyzing the association between DNA methylation levels and drug resistance.

[0244] According to some specific embodiments of this application, a method for detecting DNA modification by detecting methylated cytosine is provided, see [link to relevant documentation]. Figure 2 The flowchart includes the following steps:

[0245] 1. Enzymatic fragmentation and single-strand substitution: DNA double-strands are broken using DNase I to generate DNA double-stranded fragments. Using a combination of enzymes including Klenow fragment, T4 DNA polymerase, Taq DNA polymerase, and T4 PNK, in the presence of dNTPs (containing dATP, dTTP, dGTP, and 5m-dCTP), a new strand is formed at the 3' end of the DNA double-stranded fragment that is complementary to the 5' end sequence and contains methylated cytosine. This results in a DNA double-stranded product with a phosphate group at the 5' end and an A-base overhang at the 3' end.

[0246] 2. Adapter ligation: The above double-stranded DNA product is enzymatically ligated to a double-linker. The structure of the double-linker is as follows: Figure 1As shown, in this double-linker head, all cytosine in one single strand is methylated (i.e., "linker replacement single strand"), while the other single strand is not methylated. The 3' end of the replacement single strand of the double-linker head has a T-protrusion, and the 5' end of the other single strand has a phosphate group. Under the action of ligase, the replacement single strand of the double-linker head is ligated to the 5' end of the DNA double-strand fragment, and the other single strand of the double-linker head is ligated to the 3' end of the DNA double-strand fragment, yielding the ligation product.

[0247] 3. Conversion of unmethylated cytosine: The above ligation product is treated with sulfite (BS) or enzymatic method (EM) to convert the unmethylated cytosine in the ligation product into uracil, and a DNA double-stranded conversion product is obtained. The newly formed strand with methylated cytosine introduced at the 3' end retains the sequence unchanged, and the adapter ligated at the 5' end replaces the single strand and retains the sequence unchanged.

[0248] 4. First round of PCR amplification: Design a first forward universal primer for the partial sequence of the double-stranded DNA head replacing the single strand, and design multiple first reverse specific primers for the 3' end sequence near the target region of the DNA double strand in the nascent strand. Use the DNA double-stranded transformation product as a template to perform the first round of multiplex PCR reaction to obtain a PCR product with the universal primer sequence at one end.

[0249] 5. Second round of PCR amplification: A second reverse specific primer is designed targeting the 3' end sequence of the DNA double-stranded target region in the nascent strand. The second forward universal sequence, which has a partially identical sequence to the first forward universal primer and also carries a sequencing tag sequence, is used. An additional reverse universal primer, which has a partially identical sequence to the second reverse specific primer and also carries a sequencing tag sequence, is added. The purified first round PCR product is used as a template to perform the second round of nested PCR reaction.

[0250] 6. Sequencing: After purifying the nested PCR products and confirming that they are qualified by quality control, they are sequenced using a sequencer.

[0251] The technical solution according to the embodiments of this application ingeniously introduces methylated C information at the 3' end of DNA, thereby preserving the 3' end genomic information of the DNA sample during subsequent transformation processing. After adding methylated adapters to both ends of the DNA sample, the target region can be specifically enriched using universal primers and 3' end-specific primers, greatly reducing the difficulty of primer design for constructing methylated DNA libraries. In the case of nested PCR, the formation of chimeric fragments may further improve the accuracy of DNA methylation alignment.

[0252] Example: NA12878-48-fold amplicon sequencing based on methyltransferase transformation

[0253] I. Experimental Materials and Objectives

[0254] Using NA12878 commercial standard DNA as the sample, 200 ng of NA12878 DNA was used to prepare a 48-fold amplicon library. The prepared library was sequenced using a DNBSEQ-G99 sequencer (PE150 sequencing type), with a sequencing data volume of 100M. Data analysis was performed to obtain performance results including data utilization, alignment rate, and repetition rate.

[0255] II. Experimental Procedure

[0256] 1. Take 200 ng of NA12878 and prepare the reaction system for enzyme digestion, end repair and extension on an ice box according to Table 1 below.

[0257] Self-prepared 1X buffer: 500 mmol / L Tris-HCl (pH = 7.0), 100 mmol / L MgCl2, 20 mmol / L CaCl2, 10 mmol / L dATP, 2 mmol / L dGTP / dTTP / 5 m-dCTP;

[0258] Self-prepared enzyme mixture: DNase I, T4 DNA polymer, Klenow fragment, recombinant Taq DNA polymer, and T4 PNK. DNase I was purchased from NEB (catalog number M0303S, pre-diluted 200-fold before use); Klenow fragment was purchased from BGI (catalog number 01E013MS); T4 DNA polymer was purchased from BGI (catalog number 01E007MM); recombinant Taq DNA polymer was purchased from BGI (catalog number 01E012MM); and T4 PNK was purchased from BGI (catalog number 01E016MM).

[0259] Table 1

[0260] Components Added amount NA12878 200ng 10X Self-Provided Buffer 5μL Enzyme Mix 3.9μL Enzyme-free water Add 50μL

[0261] 2. Place the prepared reaction system on the PCR instrument and perform the reaction according to the procedure in Table 2 below.

[0262] Table 2

[0263] program temperature time Hot cap 70℃ 3min Enzyme digestion 37℃ 15min polymerization 65℃ 15min termination 4℃ --

[0264] 3. After the reaction is complete, remove the PCR tube from the PCR instrument and briefly centrifuge to collect the reaction solution at the bottom of the PCR tube. Purify the solution using 1.0X magnetic beads. The ssDNA Assay Kit is a real-time fluorescence reagent kit. The purified product is quantified according to the instructions of the kit.

[0265] 4. Prepare the whole genome methylation library preparation kit (16RXN) (purchased from MGI, catalog number 1000005251) and prepare the adapter.

[0266] The dual-link head used in this embodiment has Figure 3 The specific structure shown.

[0267] In this embodiment, all cytosine in one single chain of the dual-link head is methylated, which is called a linker-substituted single chain. Figure 3 The upper single chain in the middle, the other single chain does not require methylation modification. Figure 3 (The lower single strand in the middle). The 3' end of the single strand of the double-linked head has a T-base protruding sticky end, and the 5' end of the other single strand has a phosphate group.

[0268] Synthesize the following sequences:

[0269] Methylation substitution single-strand (Adapter-Top) sequence (5'→3' direction):

[0270] (SEQ ID NO:1, where C are all methylated cytosine, the underlined sequence is the same as the first forward universal primer sequence, and the bold T is a prominent sticky end);

[0271] The sequence of the other single chain (Adapter-Bottom) of the connector (5'→3' direction):

[0272] 5 / phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAATCAG (SEQ ID NO: 2).

[0273] Preparation of the dual-link head in this embodiment: The 200 μmol / L Adapter-Top sequence and the 200 μmol / L Adapter-Bottom sequence were annealed to form a 10 μmol / L Adapter.

[0274] Prepare the connection reaction system according to Table 3 below.

[0275] Table 3

[0276] Components Added amount DNA fragments 50ng Adapter 5μL T4 DNA ligase 600U (5μL) 10× Connect Buffer 5μL Enzyme-free water Add 50μL

[0277] The ligation reaction system was placed on a PCR instrument and incubated at 25°C for 30 minutes to add the double-linked head to both ends of the DNA fragment. After the ligation reaction was completed, the ligation product was purified using 1X magnetic beads.

[0278] 5. Using NEB's NEBNext Enzymatic Methyl-seq Kit (EM-seq)TM Following the instructions of the kit, the purified ligation product was subjected to enzymatic conversion.

[0279] 6. 48-fold PCR amplification

[0280] A 48-fold reverse-specific primer USP for the first PCR was designed for the target region of the genome (see Table 6 below); Lib-F was used as the first forward universal primer; and the product after the above enzymatic transformation was used as a template.

[0281] Lib-F sequence (5'→3' direction): GAACGACATGGCTACGATCCGACTT (SEQ ID NO:3).

[0282] Using Lib-F and multiplex USP, the first round of PCR reaction system was prepared according to Table 4 below, and the first round of multiplex PCR reaction was performed according to the procedure in Table 5 below to obtain PCR products with universal primer sequences at the 5' end.

[0283] Table 4

[0284]

[0285] Table 5

[0286]

[0287]

[0288] Forty-eight reverse specific primers (DSP) were designed for the target genomic region (see Table 6 below); a forward universal primer (PCR Dual Barcode Primer F) with sequencing tag sequence was used, and a reverse universal primer (PCR Dual Barcode Primer R) with sequencing tag sequence was added. The purified first-round PCR product was used as a template, and the second-round PCR reaction system was prepared according to Table 7 below. The second-round nested PCR reaction was carried out according to the procedure in Table 8 below.

[0289] PCR Dual Barcode Primer F(5'→3'):

[0290]

[0291] (SEQ ID NO:4, the bolded sequence is the barcode sequence, and the underlined sequence is the same as the forward universal primer Lib-F sequence);

[0292] PCR Dual Barcode Primer R(5'→3'):

[0293]

[0294] (SEQ ID NO:5, the bolded sequence is the barcode sequence, and the underlined sequence is the same as the 5' end universal sequence of the reverse specific primer DSP).

[0295] Table 6: 48-fold USP / DSP primer sequences

[0296]

[0297]

[0298] Note: For example, PC01-USP location: chr1:110052507-110052528; PC01-DSP location: chr1:110052495-110052518.

[0299] Table 7

[0300]

[0301] Table 8

[0302]

[0303]

[0304] 7. Take 2 μL of PCR product for electrophoresis detection. Use a 1.5% agarose gel pre-laced with SYBR Safe DNA gel dye (Thermo Fisher Scientific, catalog number S33102) and run at 150V for 45 min. Then take pictures using a Bio-Rad Gel Doc XR+ gel imaging system.

[0305] 8. Prepare the MGIDNBSEQ-G99 high-throughput sequencing reagent kit (PE150 sequencer) and perform sequencing operations according to the sequencer's instruction manual.

[0306] III. Experimental Results

[0307] 1. 200 ng of NA12878 DNA was subjected to semi-conservative-enzymatic fragmentation, end repair, and extension. After purification using 1.0X magnetic beads, Q-Seq analysis revealed that the generated fragments were mainly 400-600 bp bands (see...). Figure 4 (Left), the enzymatic fragment recovery efficiency is over 60% (see left). Figure 4 right).

[0308] 2. Using the product transformed by the semi-conservative methyltransferase method as a template, the gel electrophoresis images of the products obtained after two rounds of PCR amplification are shown below. Figure 5 As shown in the electrophoresis image, the first-round PCR 48-fold amplification products obtained using lib-F and 48-fold USP primers clustered at 200bp to 300bp, exhibiting high specificity and almost no primer dimers, as expected. After the second round of PCR amplification, the products became even more clustered.

[0309] 3. Sequencing data statistics

[0310] This embodiment follows the instructions for the whole-genome methylation library preparation kit (purchased from MGI, catalog number 1000005251) for library construction, the instructions for pre-sequencing DNB preparation for the MGIDNBSEQ-G99 high-throughput sequencing kit for DNB preparation, and the instructions for the PE150 sequencer for sequencing. Bases were read from the 5' to 3' end of one strand of the DNA sample, showing an increase in C and a decrease in T. Bases were read from the 3' to 5' end of the other strand, showing a decrease in G and an increase in A. Read1 represents the 5' end of the enzymatically transformed DNA fragment, while Read2 represents the 3' end. Due to the substitution of methylated cytosine (5mC), C remains unchanged, consistent with the base distribution of a semi-conservative library after BS or EM methylation treatment (results are shown in Figure 1). Figure 6 (As shown).

[0311] In this embodiment, the method uses BWA software to align sequencing reads of the replaced single-stranded DNA sample (a single strand of DNA double-stranded DNA with methylated cytosine introduced at the 3' end) with genomic reads to obtain the accurate location of the sequencing reads. Based on the genomic alignment location, the original template strand (enzymatically transformed strand) information is then obtained to obtain accurate methylation alignment information. Simultaneously, conventional multiplex PCR-based targeted methylation sequencing (MBPS) technology is used. 200 ng of NA12878 commercial standard DNA is used as a sample for 48-fold amplicon library preparation. The DNA library prepared using the conventional MBPS method is aligned using BS-MAP software. The results are shown in Table 9 below.

[0312] Table 9

[0313]

[0314]

[0315] The analysis results show that, compared with the conventional MRBS method, the sequencing data obtained by the method in this embodiment can significantly improve the methylation alignment rate, data utilization, and accuracy of methylation detection.

[0316] The subject matter of this application has been fully described through the above embodiments. Those skilled in the art will understand that the implementation of this application is not limited to the above embodiments, and the same solution can be implemented within a broad equivalent scope without affecting the scope of the subject matter or specific aspects described herein. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of this application shall be considered equivalent substitutions and are included within the protection scope of this application.

Claims

1. A method for constructing a DNA library with modified nucleotides, characterized in that, Includes the following steps: Provide DNA double-stranded fragments, A new strand complementary to the 5' end sequence is formed at the 3' end of the DNA double-stranded fragment to obtain a DNA double-stranded product, wherein the nucleotides in the new strand that have the same base as the target modified nucleotide are all modified nucleotides. The DNA double-stranded product is ligated to a double-linker to obtain a ligation product; wherein at least one single strand of the double-linker is a linker-substituted single strand, and the nucleotides in the linker-substituted single strand that have the same base as the target modified nucleotide are all modified nucleotides. The ligation product is converted to obtain a DNA double-stranded conversion product; The DNA double-stranded transformation product is subjected to at least one round of PCR amplification using at least one forward universal primer and at least one reverse specific primer to obtain the DNA library; wherein the forward universal primer is designed for the adapter replacement single strand, and the reverse specific primer is designed for the newly formed strand.

2. The construction method according to claim 1, characterized in that: The modification of the target modified nucleotide includes methylation modification; and / or, the target modified nucleotide includes at least one of a modified pyrimidine nucleotide and a modified purine nucleotide; Preferably, the modified nucleotide includes at least one of methylated cytosine and methylated adenine; More preferably, the methylated cytosine includes at least one of 5-methylcytosine and 5-hydroxymethylcytosine; and / or, the methylated adenine includes N6-methyladenine.

3. The construction method according to claim 1, characterized in that: DNA double-stranded fragments are provided by breaking the DNA double strand through ultrasonic or enzymatic methods. Preferably, the DNA double-stranded fragment has a 5' end single-stranded sticky end; and / or, the single strand of the DNA double-stranded fragment has a notch; Preferably, a new strand complementary to the 5' end sequence is formed at the 3' end of the DNA double-stranded fragment using a nucleic acid polymerase; Preferably, in the reaction system for forming the new chain, all dNTPs having the same base as the target modified nucleotide are modified dNTPs; Preferably, the 3' end of the DNA double-stranded product has a protruding end.

4. The construction method according to any one of claims 1-3, characterized in that: The DNA double-stranded product is ligated to the double-stranded linker using a nucleic acid ligase. Preferably, the 3' end of the connector of the double-link head has a protruding end; Preferably, the two single chains of the dual-link head are partially complementary at either end or both ends; Preferably, the two single-stranded sequences in the middle part of the dual-link header are not complementary; Preferably, the two single strands of the dual-link head have the same or different number of bases.

5. The construction method according to any one of claims 1-3, characterized in that: The target modified nucleotide includes methylated cytosine, and the ligation product is converted by at least one of bisulfite conversion or enzymatic conversion; and / or The target modified nucleotide includes methylated adenine, and the ligation product is converted by at least one of nitrite conversion or enzymatic conversion.

6. The construction method according to any one of claims 1-3, characterized in that: The PCR amplification includes at least two rounds of PCR amplification; Preferably, the first round of PCR amplification uses a first forward universal primer and at least one first reverse specific primer, wherein the first forward universal primer is designed for the adapter replacement single strand; and the first reverse specific primer is designed for the newly formed strand. Preferably, the second round of PCR amplification uses a second forward universal primer and at least one second reverse specific primer, wherein the second forward universal primer is designed for the adapter replacement single strand; the second reverse specific primer is designed for the newly formed strand, and the second reverse specific primer binds to the binding site of the first reverse specific primer on the product of the previous round of PCR amplification. Preferably, at least the primers used to perform the final round of PCR amplification have sequencing tag sequences.

7. A method for detecting DNA modification, characterized in that, Includes the following steps: Construct a DNA library using the method described in any one of claims 1-6; The DNA library was sequenced; The data obtained from sequencing are analyzed to obtain DNA modification information.

8. A kit for constructing a DNA library with modified nucleotides, characterized in that, include: DNA single-strand replacement kit; Connector ligation kit; Unmodified nucleotide conversion kit; PCR amplification kit; Preferably, the DNA single-strand replacement kit includes: a nuclease for breaking the DNA double strand to provide a DNA double-stranded fragment; a nuclease for forming a new strand complementary to the 5' end sequence at the 3' end of the DNA double-stranded fragment; and dNTPs, wherein all dNTPs having the same bases as the target modified nucleotide are modified dNTPs. Preferably, the connector kit includes: a dual-link connector, wherein at least one single strand of the dual-link connector is a connector replacement single strand, and the nucleotides in the connector replacement single strand that have the same base as the target modified nucleotide are all modified nucleotides; and a nuclease; Preferably, the PCR amplification kit includes: at least one forward universal primer and at least one reverse specific primer; DNA polymerase; dNTPs, including dATP, dGTP, dTTP, and dCTP.

9. A kit for detecting DNA modification, characterized in that, include: DNA single-strand replacement kit; Connector ligation kit; Unmodified nucleotide conversion kit; PCR amplification kit; sequencing kit; Preferably, the sequencing kit includes sequencing reagents or sequencing aids.

10. The application of the method for constructing a DNA library with modified nucleotides according to any one of claims 1-6, the method for detecting DNA modification according to claim 7, the kit for constructing a DNA library with modified nucleotides according to claim 8, and the kit for detecting DNA modification according to claim 9 in analyzing DNA methylation information.

Images