Urethelium carcinoma detection reagent, detection kit and application thereof

By detecting the methylation status of the CpG island region of urothelial carcinoma-specific genes, and employing a multiplex PCR method combining primers and probes, the problem of insufficient sensitivity in the early diagnosis of urothelial carcinoma has been solved, achieving efficient and non-invasive detection of urothelial carcinoma.

CN122038583APending Publication Date: 2026-05-15SHANGHAI WEIXIN BIOTECHNOLOGY CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202610417122.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-01
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Existing technologies lack sufficient sensitivity in the early diagnosis of urothelial carcinoma, making it difficult to effectively identify early or minimally invasive urothelial carcinoma. Furthermore, existing multi-gene detection systems are highly complex and difficult to translate into clinical applications.

Method used

Using primer and probe combinations that specifically detect the methylation status of CpG island regions in the DMRTA2, TWIST1, and VIM genes, multiplex PCR detection was performed on urine samples, with the hg38 genome as a reference, to achieve highly sensitive and specific urothelial carcinoma risk assessment.

Benefits of technology

It achieves high sensitivity (up to 96.67%) and high specificity (up to 92%) in detecting urothelial carcinoma, is rapid (total time <4 hours) and non-invasive, reduces detection costs, and is suitable for clinical promotion.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The invention discloses a urinary tract epithelial cancer detection reagent, a detection kit and application thereof. Specifically, the invention provides application of the reagent combination in preparation of the kit, and the reagent combination comprises a reagent for detecting the methylation level or state of a CpG island region comprising the following genes in a sample to be detected: (A) the CpG island region of the DMRTA2 gene is located in a chr1: 50421000-50421550 region; and (B) a CpG island region of any one gene selected from the following groups, or a combination thereof: (B1) the CpG island region of the TWIST1 gene is located in the chr7: 19117550-19118050 region; and (B2) the CpG island region of the VIM gene is located in the chr10: 17229200-17229700 region. The reagent or the kit provided by the invention can realize rapid and high-sensitivity non-invasive detection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical detection technology, specifically relating to urothelial carcinoma detection reagents, detection kits, and their applications. Background Technology

[0002] Urothelial carcinoma is a common malignant tumor of the urinary system, and early diagnosis is crucial for improving patient prognosis. Currently, clinical diagnosis mainly relies on cystoscopic biopsy (an invasive procedure with poor patient compliance) and urine cytology (low sensitivity, only 30-40%). Although techniques such as fluorescence in situ hybridization (FISH) and protein markers (such as NMP22 and BTA) have been gradually applied, they still face challenges such as insufficient specificity (70-85%) and difficulty in detecting early lesions.

[0003] DNA methylation, as an epigenetic marker, shows abnormalities in the early stages of tumor development and exhibits tissue specificity and high stability. Methylated DNA derived from tumors in exfoliated urinary cells can be obtained non-invasively, making it an ideal detection target. However, current technologies, often based on single or limited markers, lack sufficient sensitivity to effectively identify early or minimally invasive urothelial carcinoma. Multi-gene detection reagents are also complex and difficult to translate into practical applications.

[0004] For example, existing patent literature CN114891886B, based on C1orf141 methylation detection, suffers from sensitivity highly dependent on sample processing procedures and poor stability. Furthermore, while the multi-target combination in the 32-gene model of CN109797220A improves sensitivity, its high reagent complexity hinders clinical translation.

[0005] Therefore, there is an urgent need in this field to develop a new method for the efficient and sensitive detection of urothelial carcinoma, in order to meet the requirements of high detection performance and clinical applicability. Summary of the Invention

[0006] This invention provides reagents, kits, and applications for detecting urothelial carcinoma.

[0007] In a first aspect of the invention, use is provided in the preparation of a reagent combination for the detection of urothelial carcinoma, said reagent combination comprising reagents for detecting the methylation level or state of CpG island regions comprising the following genes in a sample to be tested: (A) The CpG island region of the DMRTA2 gene is located in the chr1:50421000-50421550 region; and (B) CpG island regions selected from any of the following groups, or combinations thereof: (B1) The CpG island region of the TWIST1 gene is located in the chr7:19117550-19118050 region; (B2) The CpG island region of the VIM gene is located in the chr10:17229200-17229700 region; All of these regions use the hg38 genome as a reference genome.

[0008] In another preferred embodiment, the chr1:50421000-50421550 region refers to the entire chr1:50421000-50421550 region or any truncated region therefrom.

[0009] In another preferred embodiment, the arbitrarily selected region includes: chr1:50421001-50421223 area; chr1:50421208-50421361 area; chr1:50421326-50421464 region; chr1:50421427-50421550 region; chr1:50421022-50421208 area; chr1:50421195-50421318 area; The range is chr1:50421326-50421445; the range is chr1:50421444-50421550.

[0010] In another preferred embodiment, the chr1:50421000-50421550 region is the chr1:50421000-50421550 region; more preferably, it is the chr1:50421200-50421550 region.

[0011] In another preferred embodiment, the chr7:19117550-19118050 region refers to the entire chr7:19117550-19118050 region or any truncated region therefrom.

[0012] In another preferred embodiment, the chr10:17229200-17229700 region refers to the entire region of chr10:17229200-17229700 or any truncated region therefrom.

[0013] In another preferred embodiment, the reagent comprises primers and / or probes capable of specifically recognizing and / or binding to CpG sites in the CpG island region of the gene.

[0014] In another preferred embodiment, the reagent or the kit comprises: (a) A first primer pair and a first probe for specifically detecting the methylation status of the CpG island region of the DMRTA2 gene; and (b) Any primer-probe combination selected from the following group, or a combination thereof: (b1) A second primer pair and a second probe for specifically detecting the methylation status of the CpG island region of the TWIST1 gene; (b2) A third primer pair and a third probe for specifically detecting the methylation status of the CpG island region of the VIM gene.

[0015] In another preferred embodiment, the first primer pair and the first probe are selected from the group consisting of: (1) Primers: SEQ ID NO: 49-50, Probe: SEQ ID NO: 51; (2) Primers: SEQ ID NO: 52-53, Probe: SEQ ID NO: 54; (3) Primers: SEQ ID NO: 55-56, Probe: SEQ ID NO: 57; (4) Primers: SEQ ID NO: 58-59, probe: SEQ ID NO: 60.

[0016] In another preferred embodiment, the second primer pair and the second probe are selected from the group consisting of: (1) Primers: SEQ ID NO: 61-62, Probe: SEQ ID NO: 63; (2) Primers: SEQ ID NO: 64-65, Probe: SEQ ID NO: 66; (3) Primers: SEQ ID NO: 67-68, Probe: SEQ ID NO: 69; (4) Primers: SEQ ID NO: 70-71, probe: SEQ ID NO: 72.

[0017] In another preferred embodiment, the third primer pair and the third probe are selected from the group consisting of: (1) Primers: SEQ ID NO: 73-74, Probe: SEQ ID NO: 75; (2) Primers: SEQ ID NO: 76-77, Probe: SEQ ID NO: 78; (3) Primers: SEQ ID NO: 79-80, Probe: SEQ ID NO: 81; (4) Primers: SEQ ID NO: 82-83, probe: SEQ ID NO: 84.

[0018] In another preferred embodiment, the kit comprises: (1) First primer pair: SEQ ID NO: 49-50, first probe: SEQ ID NO: 51; second primer pair: SEQ ID NO: 61-62, second probe: SEQ ID NO: 63; and third primer pair: SEQ ID NO: 73-74, third probe: SEQ ID NO: 75; or (2) First primer pair: SEQ ID NO: 49-50, first probe: SEQ ID NO: 51; second primer pair: SEQ ID NO: 64-65, second probe: SEQ ID NO: 66; and third primer pair: SEQ ID NO: 73-74, third probe: SEQ ID NO: 75; or (3) First primer pair: SEQ ID NO: 52-53, first probe: SEQ ID NO: 54; second primer pair: SEQ ID NO: 61-62, second probe: SEQ ID NO: 63; and third primer pair: SEQ ID NO: 73-74, third probe: SEQ ID NO: 75; or (4) First primer pair: SEQ ID NO: 52-53, first probe: SEQ ID NO: 54; second primer pair: SEQ ID NO: 61-62, second probe: SEQ ID NO: 63; and third primer pair: SEQ ID NO: 76-77, third probe: SEQ ID NO: 78; or (5) First primer pair: SEQ ID NO: 52-53, first probe: SEQ ID NO: 54; second primer pair: SEQ ID NO: 67-68, second probe: SEQ ID NO: 69; and third primer pair: SEQ ID NO: 73-74, third probe: SEQ ID NO: 75.

[0019] In another preferred embodiment, the kit is used to detect the risk of urothelial carcinoma.

[0020] In another preferred embodiment, the urothelial carcinoma includes low-grade urothelial carcinoma and high-grade urothelial carcinoma.

[0021] In another preferred embodiment, the reagent is used to detect the methylation level or status of at least one CpG site in the CpG island region of the gene.

[0022] In another preferred embodiment, the sample to be tested is selected from the group consisting of urine samples, tissue samples, or combinations thereof.

[0023] In another preferred embodiment, the sample to be tested comes from patients with urothelial carcinoma, suspected patients with urothelial carcinoma, people susceptible to urothelial carcinoma, or healthy people.

[0024] In a second aspect of the invention, a reagent combination for detecting the risk of urothelial carcinoma is provided, the reagent combination comprising: (a) A first primer pair and a first probe for specifically detecting the methylation status of the CpG island region of the DMRTA2 gene; and (b) Any primer-probe combination selected from the following group, or a combination thereof: (b1) A second primer pair and a second probe for specifically detecting the methylation status of the CpG island region of the TWIST1 gene; (b2) A third primer pair and a third probe for specifically detecting the methylation status of the CpG island region of the VIM gene; Specifically, using the hg38 genome as the reference genome, the CpG island region of the DMRTA2 gene is located in the chr1:50421000-50421550 region; the CpG island region of the TWIST1 gene is located in the chr7:19117550-19118050 region; and the CpG island region of the VIM gene is located in the chr10:17229200-17229700 region.

[0025] In another preferred embodiment, the chr1:50421000-50421550 region refers to the entire chr1:50421000-50421550 region or any truncated region thereof.

[0026] In another preferred embodiment, the truncated region includes: chr1:50421001-50421223 area; chr1:50421208-50421361 area; chr1:50421326-50421464 region; chr1:50421427-50421550 region; chr1:50421022-50421208 area; chr1:50421195-50421318 area; The range is chr1:50421326-50421445; the range is chr1:50421444-50421550.

[0027] In another preferred embodiment, the chr1:50421000-50421550 region is the complete region of chr1:50421000-50421550; more preferably, it is the chr1:50421200-50421550 region.

[0028] In another preferred embodiment, the chr7:19117550-19118050 region refers to the entire chr7:19117550-19118050 region or any truncated region therefrom.

[0029] In another preferred embodiment, the chr10:17229200-17229700 region refers to the entire region of chr10:17229200-17229700 or any truncated region therefrom.

[0030] In another preferred embodiment, the first primer pair and the first probe are selected from the group consisting of: (1) Primers: SEQ ID NO: 49-50, Probe: SEQ ID NO: 51; (2) Primers: SEQ ID NO: 52-53, Probe: SEQ ID NO: 54; (3) Primers: SEQ ID NO: 55-56, Probe: SEQ ID NO: 57; (4) Primers: SEQ ID NO: 58-59, probe: SEQ ID NO: 60.

[0031] In another preferred embodiment, the second primer pair and the second probe are selected from the group consisting of: (1) Primers: SEQ ID NO: 61-62, Probe: SEQ ID NO: 63; (2) Primers: SEQ ID NO: 64-65, Probe: SEQ ID NO: 66; (3) Primers: SEQ ID NO: 67-68, Probe: SEQ ID NO: 69; (4) Primers: SEQ ID NO: 70-71, probe: SEQ ID NO: 72.

[0032] In another preferred embodiment, the third primer pair and the third probe are selected from the group consisting of: (1) Primers: SEQ ID NO: 73-74, Probe: SEQ ID NO: 75; (2) Primers: SEQ ID NO: 76-77, Probe: SEQ ID NO: 78; (3) Primers: SEQ ID NO: 79-80, Probe: SEQ ID NO: 81; (4) Primers: SEQ ID NO: 82-83, probe: SEQ ID NO: 84.

[0033] In another preferred embodiment, the kit comprises: (1) First primer pair: SEQ ID NO: 49-50, first probe: SEQ ID NO: 51; and second primer pair: SEQ ID NO: 61-62, second probe: SEQ ID NO: 63; or (2) First primer pair: SEQ ID NO: 49-50, first probe: SEQ ID NO: 51; and second primer pair: SEQ ID NO: 67-68, second probe: SEQ ID NO: 69; or (3) First primer pair: SEQ ID NO: 52-53, first probe: SEQ ID NO: 54; and second primer pair: SEQ ID NO: 64-65, second probe: SEQ ID NO: 66; or (4) First primer pair: SEQ ID NO: 52-53, first probe: SEQ ID NO: 54; and second primer pair: SEQ ID NO: 67-68, second probe: SEQ ID NO: 69; (5) First primer pair: SEQ ID NO: 49-50, first probe: SEQ ID NO: 51; and second primer pair: SEQ ID NO: 73-74, second probe: SEQ ID NO: 75; or (6) First primer pair: SEQ ID NO: 49-50, first probe: SEQ ID NO: 51; and second primer pair: SEQ ID NO: 76-77, second probe: SEQ ID NO: 78; or (7) First primer pair: SEQ ID NO: 49-50, first probe: SEQ ID NO: 51; and second primer pair: SEQ ID NO: 79-80, second probe: SEQ ID NO: 81; or (8) First primer pair: SEQ ID NO: 49-50, first probe: SEQ ID NO: 51; second primer pair: SEQ ID NO: 61-62, second probe: SEQ ID NO: 63; and third primer pair: SEQ ID NO: 73-74, third probe: SEQ ID NO: 75; or (9) First primer pair: SEQ ID NO: 52-53, first probe: SEQ ID NO: 54; second primer pair: SEQ ID NO: 61-62, second probe: SEQ ID NO: 63; and third primer pair: SEQ ID NO: 73-74, third probe: SEQ ID NO: 75; or (10) First primer pair: SEQ ID NO: 55-56, first probe: SEQ ID NO: 57; second primer pair: SEQ ID NO: 61-62, second probe: SEQ ID NO: 63; and third primer pair: SEQ ID NO: 73-74, third probe: SEQ ID NO: 75; or (11) First primer pair: SEQ ID NO: 58-59, first probe: SEQ ID NO: 60; second primer pair: SEQ ID NO: 61-62, second probe: SEQ ID NO: 63; and third primer pair: SEQ ID NO: 73-74, third probe: SEQ ID NO: 75; or (12) First primer pair: SEQ ID NO: 49-50, first probe: SEQ ID NO: 51; second primer pair: SEQ ID NO: 61-62, second probe: SEQ ID NO: 63; and third primer pair: SEQ ID NO: 76-77, third probe: SEQ ID NO: 78; or (13) First primer pair: SEQ ID NO: 52-53, first probe: SEQ ID NO: 54; second primer pair: SEQ ID NO: 61-62, second probe: SEQ ID NO: 63; and third primer pair: SEQ ID NO: 76-77, third probe: SEQ ID NO: 78; or (14) First primer pair: SEQ ID NO: 55-56, first probe: SEQ ID NO: 57; second primer pair: SEQ ID NO: 61-62, second probe: SEQ ID NO: 63; and third primer pair: SEQ ID NO: 76-77, third probe: SEQ ID NO: 78; or (15) First primer pair: SEQ ID NO: 58-59, first probe: SEQ ID NO: 60; second primer pair: SEQ ID NO: 61-62, second probe: SEQ ID NO: 63; and third primer pair: SEQ ID NO: 76-77, third probe: SEQ ID NO: 78. In a third aspect of the invention, a kit is provided comprising the reagent combination described in the second aspect of the invention.

[0034] In another preferred embodiment, the kit is used to detect the risk of urothelial carcinoma.

[0035] In another preferred embodiment, the urothelial carcinoma includes low-grade urothelial carcinoma and high-grade urothelial carcinoma.

[0036] In another preferred embodiment, the kit further includes: DNA extraction reagent, sulfite conversion reagent, PCR reaction buffer, dNTPs, and DNA polymerase.

[0037] In another preferred embodiment, the kit also includes primers and probes for detecting an internal reference.

[0038] In a fourth aspect of the invention, a combination of urothelial carcinoma risk markers is provided, including the methylation level and / or status of CpG island regions of the following genes: (A) The CpG island region of the DMRTA2 gene is located in the chr1:50421000-50421550 region; and (B) CpG island regions selected from any of the following groups, or combinations thereof: (B1) The CpG island region of the TWIST1 gene is located in the chr7:19117550-19118050 region; (B2) The CpG island region of the VIM gene is located in the chr10:17229200-17229700 region; All of these regions use the hg38 genome as a reference genome.

[0039] In a fifth aspect of the invention, a diagnostic device for urothelial carcinoma is provided, the device comprising: (a) An input module configured to input methylation levels and / or status data of CpG island regions of the following genes in the sample to be tested: (A) The CpG island region of the DMRTA2 gene is located in the chr1:50421000-50421550 region; and (B) CpG island regions selected from any of the following groups, or combinations thereof: (B1) The CpG island region of the TWIST1 gene is located in the chr7:19117550-19118050 region; (B2) The CpG island region of the VIM gene is located in the chr10:17229200-17229700 region; All of these regions use the hg38 genome as a reference genome. (b) An assessment module configured to receive the methylation level or status data and perform a risk assessment to obtain an assessment result of the risk of urothelial carcinoma in the subject; wherein the assessment includes: if the methylation level C1 of the CpG island region is significantly higher than the control reference value C0, and / or methylation occurs in the CpG island region, then the subject is determined to have a high risk of urothelial carcinoma; otherwise, the risk of urothelial carcinoma is low. (c) Output module, which is configured to input the evaluation result.

[0040] In another preferred embodiment, the device further includes (d) a control module configured to control the operation of the modules.

[0041] In another preferred embodiment, the high risk of urothelial carcinoma refers to a high probability or high risk of urothelial carcinoma.

[0042] In another preferred embodiment, the diagnosis is an auxiliary diagnosis.

[0043] In another preferred embodiment, the urothelial carcinoma includes low-grade urothelial carcinoma and high-grade urothelial carcinoma.

[0044] In another preferred embodiment, "significantly higher" means C1 / C0 ≥ 1.5; more preferably ≥ 2; even more preferably ≥ 3.

[0045] In a sixth aspect of the invention, a method for detecting whether a subject has urothelial carcinoma is provided, comprising the steps of: (1) Provide the sample to be tested; (2) Detect the methylation level and / or status of the CpG island regions of the following genes in the test sample: (A) The CpG island region of the DMRTA2 gene is located in the chr1:50421000-50421550 region; and (B) CpG island regions selected from any of the following groups, or combinations thereof: (B1) The CpG island region of the TWIST1 gene is located in the chr7:19117550-19118050 region; (B2) The CpG island region of the VIM gene is located in the chr10:17229200-17229700 region; All of these regions use the hg38 genome as a reference genome. (3) Risk assessment: If the methylation level C1 of the CpG island region is significantly higher than the control reference value C0, and / or the CpG island region is methylated, the subject is determined to have a high risk of urothelial carcinoma; otherwise, the risk of urothelial carcinoma is low.

[0046] In another preferred embodiment, the sample to be tested is selected from the group consisting of tissue samples, urine samples, or combinations thereof.

[0047] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Detailed Implementation

[0048] Through extensive and in-depth research and screening, the inventors discovered that detecting the methylation level or status of the CpG island region of the DMRTA2 gene (located in chr1: 50421000-50421550, with the hg38 genome as a reference genome); the CpG island region of the TWIST1 gene (located in chr7: 19117550-19118050, with the hg38 genome as a reference genome); and / or the CpG island region of the VIM gene (located in chr10: 17229200-17229700, with the hg38 genome as a reference genome) can effectively detect the risk of urothelial carcinoma. Based on this, the present invention was completed.

[0049] Specifically, the inventors also used a first-generation sequencing method to amplify different positions of the CpG islands in each of the aforementioned genes, and discovered that methylation detection at different positions or combinations of different positions also showed different detection efficiencies for urothelial carcinoma. When methylation detection was performed simultaneously using any CpG-containing site region from the CpG island regions of two or three of the aforementioned genes, better detection results could be achieved.

[0050] Furthermore, the inventors designed primers and probes for specific detection of different CpG island regions of different genes, including a first primer pair and a first probe for detecting the CpG island region of the DMRTA2 gene, a second primer pair and a second probe for detecting the CpG island region of the TWIST1 gene, and a third primer pair and a third probe for detecting the CpG island region of the VIM gene. It was found that using these three primer pairs and probes together resulted in the best detection performance, with a maximum sensitivity of 96.67% and a specificity of 92%.

[0051] the term To facilitate a clearer understanding of this disclosure, certain terms are first defined. As used herein, unless otherwise expressly specified herein, each of the following terms shall have the meaning given below. Other definitions are set forth throughout the application.

[0052] The term “about” can refer to a value or composition within an acceptable margin of error for a particular value or composition as determined by a person skilled in the art, depending in part on how the value or composition is measured or determined. For example, as used herein, the expression “about 100” includes all values ​​between 99 and 101.

[0053] As used herein, the terms “containing” or “including (comprise)” can be open-ended, semi-closed, or closed. In other words, the terms also include “consistently made of” or “composed of”.

[0054] As used herein, unless otherwise stated, any concentration range, percentage range, proportion range, or integer range shall be understood to include any integer value within the range and, where appropriate, its fractional value (e.g., one-tenth and one-hundredth of an integer).

[0055] As used herein, the term “and / or” refers to and covers any and all possible combinations of one or more of the related listed items.

[0056] As used in this article, the term "sample" or "sample" refers to material specifically associated with a subject from which specific information relating to the subject can be determined, calculated, or inferred. A sample may consist wholly or partially of biological material from the subject.

[0057] As used herein, the term "reference value" or "control reference value" refers to a value that is statistically relevant to a particular outcome when compared with the results of an analysis. In a preferred embodiment, the reference value is determined based on a statistical analysis of the mRNA expression and / or protein expression of a comparative pancreatic cancer risk marker. Some such studies are shown in the Examples section of this document. However, studies from the literature and user experience with the methods disclosed herein can also be used to produce or adjust reference values. Reference values ​​can also be determined by considering circumstances and outcomes that are particularly relevant to the patient's ethnicity, medical history, genetics, age, and other factors.

[0058] As used herein, the terms "urothelial carcinoma risk marker of the present invention," "marker of the present invention," and "risk marker of the present invention" are used interchangeably and refer to the methylation level or state of the CpG island regions of the following genes: (A) The CpG island region of the DMRTA2 gene is located in the chr1:50421000-50421550 region; and (B) CpG island regions selected from any of the following groups, or combinations thereof: (B1) The CpG island region of the TWIST1 gene is located in the chr7:19117550-19118050 region; (B2) The CpG island region of the VIM gene is located in the chr10:17229200-17229700 region; All of these regions use the hg38 genome as a reference genome.

[0059] Urothelial carcinoma Urothelial carcinoma is a malignant tumor originating from the urothelial lining. It most commonly occurs in the bladder (approximately 90%), but can also occur in the lining of the renal pelvis, ureter, urethra, and other parts of the urinary tract. It originates from the urothelial cells (also known as transitional epithelial cells) lining the inner surface of the urinary tract. These cells possess unique stretching and deformability to adapt to bladder filling and emptying.

[0060] Urothelial carcinoma includes low-grade urothelial carcinoma and high-grade urothelial carcinoma. Low-grade urothelial carcinoma is a well-differentiated, less malignant tumor of the urinary system, commonly found in the bladder, ureter, or renal pelvis. It is relatively easy to treat, responds well to treatment, and has a low recurrence rate after surgical resection. High-grade urothelial carcinoma, on the other hand, is a poorly differentiated, more malignant tumor of the urinary system, commonly found in the bladder, renal pelvis, ureter, and other parts of the urinary tract. High-grade urothelial carcinoma is more difficult to treat, has a poorer prognosis, and requires a combination of treatment methods.

[0061] DMRTA2 gene, TWIST1 gene, and VIM gene In bladder cancer tissue, specific regions (promoter regions, etc.) of the DMRTA2, TWIST1, and VIM genes exhibit abnormally high methylation.

[0062] VIM protein is a key molecule mediating epithelial-mesenchymal transition (EMT). EMT is a process by which epithelial cells acquire mesenchymal cell characteristics, thereby enhancing their motility and invasiveness. Studies have shown that artificially upregulating VIM protein expression in bladder cancer cells can significantly enhance their ability to cross the matrix (mimicking invasion of the extracellular matrix). One of the underlying mechanisms is that VIM protein can upregulate the expression and secretion of matrix metalloproteinase 9 (MMP-9). MMP-9 can degrade type IV collagen (a major component of the extracellular matrix and basement membrane), effectively opening a channel for cancer cell "invasion."

[0063] TWIST1, an important transcription factor, plays a crucial role in initiating epithelial-mesenchymal transition (EMT). Simply put, this process allows tightly connected, relatively fixed bladder epithelial cells to acquire mesenchymal cell-like characteristics, becoming looser in shape and more motile, thus facilitating invasion of surrounding tissues or metastasis. Studies have shown that artificially upregulating TWIST1 expression in bladder cancer cells significantly alters the expression of a series of EMT-related genes. For example, it leads to a decrease in the expression of the epithelial cell marker E-cadherin, while increasing the expression of mesenchymal cell markers such as fibronectin, ultimately promoting the EMT process.

[0064] Test kit This invention provides a detection kit for detecting the risk markers of urothelial carcinoma of this invention. The kit comprises a reagent combination for detecting the risk of urothelial carcinoma, the reagent combination including: (a) A first primer pair and a first probe for specifically detecting the methylation status of the CpG island region of the DMRTA2 gene; and (b) Any primer-probe combination selected from the following group, or a combination thereof: (b1) A second primer pair and a second probe for specifically detecting the methylation status of the CpG island region of the TWIST1 gene; (b2) A third primer pair and a third probe for specifically detecting the methylation status of the CpG island region of the VIM gene; Specifically, using the hg38 genome as the reference genome, the CpG island region of the DMRTA2 gene is located in the chr1:50421000-50421550 region; the CpG island region of the TWIST1 gene is located in the chr7:19117550-19118050 region; and the CpG island region of the VIM gene is located in the chr10:17229200-17229700 region.

[0065] In another preferred embodiment, the detection is performed on an ex vivo sample.

[0066] In another preferred embodiment, the ex vivo sample includes: tissue sample, cell sample, blood sample, and serum sample.

[0067] In another preferred embodiment, the detection reagent is coupled with or carries a detectable marker.

[0068] In another preferred embodiment, the detectable marker is selected from the group consisting of chromophores, chemiluminescent groups, fluorophores, isotopes, or enzymes.

[0069] In another preferred embodiment, the kit further includes a label or instructions indicating that the kit is used to diagnose urothelial carcinoma or to assess the risk of developing urothelial carcinoma.

[0070] In another preferred embodiment, the reagents include primers, probes, gRNA, or combinations thereof, more preferably primer pairs or probes for PCR, qPCR, or RT-PCR.

[0071] The main advantages of this invention include: (a) The biomarkers or diagnostic reagents of this invention have high sensitivity and specificity, and can effectively detect early-stage, low-grade urothelial carcinoma. In particular, the combination of multiple genes (two or three) can achieve a clinical sensitivity of 92.4% and a specificity of 92% (based on urine sample validation).

[0072] (b) Rapid detection can be achieved using the markers or detection reagents of the present invention: the entire process takes less than 4 hours, which is 50% shorter than traditional methods.

[0073] (c) The method of the present invention can achieve cost control: single-tube multiplex detection saves reagents and consumables, is compatible with domestic qPCR instruments, and is easy to promote in clinical practice.

[0074] (d) The method of the present invention can be non-invasive: based on urine samples, it avoids invasive procedures and improves patient compliance.

[0075] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0076] Example 1: Determination of the methylation detection region of the DMRTA2 gene The methylation status and level of the DMRTA2 gene promoter region, first exon region, and second exon region were detected by first-generation sequencing using urine samples from 30 patients with urothelial carcinoma and 30 patients with benign disease.

[0077] The results suggest that the second exon region (i.e., the second exon region with significantly enhanced methylation status and / or level) has the best distinguishing effect between urothelial carcinoma and benign samples.

[0078] The sequence of the second exon (Exon2) region is shown below, corresponding to the position chr1:50421000-50421572 in the hg38 genome: TCCGCCTCCGGTCCCCGCGGGCGCTCCCGCTCCAGGTCCCCCGCCGTCGGCGGCGCACACTGAACCGAAGACCTCGTAGGCGGGCCTCGGGGGGATGATGCCGTTGGCGGCGGCCAGCGCCAGCCCCTCGGCAGTGCCGTAGA GCAGCTGCAGCTCGCGCGCCTCGTTCTCCTCCTGCGCCTGCTGCCTGCGCAGCGCCACCTGCGCCGCCATGACACGCTGGCGCTCCGCGATGAGCGTGCACTTGGCGCACAGGCAGTCCTTCCAGCGACAGTAGCGTTTGTGG CCCTTGAGGGCCGACACCACGCCATGGTTGCGACAGCGCGCGCACTTGGGGGTCCGCGGGTACTTCTCGGCTGCCCGCAGCAACAGTGGCGGCCCCCGCAGCAAGCCGCCTGCCACGCTCACCGGTAGCGATGCAGCGGCCGC CGCGGCTGCCGCCACCGACGCCACCGACGCCACAGGCGGCCCCGTCGCTGTTGCCGCCGCCGCCGTCGCCGCGCCGGGCACGCTGGGCAGCTCCGAGCGCAGCTCCATGACAGGACCTGACGGGAAAGAAGGTGGGAGAGGGGA (SEQ ID NO: 85).

[0079] Example 2: Bisulfite sequencing method for assessing the methylation level of the target gene 2.1 Sample Collection and Processing Tissue samples: 35 cases of low-grade urothelial carcinoma, 30 cases of high-grade urothelial carcinoma, and 50 cases of adjacent tissue (formalin fixed and paraffin embedded) were collected by pathological biopsy.

[0080] Urine samples: 50 urine samples from low-grade urothelial carcinoma, 90 urine samples from high-grade urothelial carcinoma, and 100 urine samples from benign patients were collected.

[0081] 2.2 DNA Extraction Tissue samples: DNA was extracted using the QIAamp DNA FFPE Tissue Kit (catalog number 56404) following the instructions.

[0082] Urine sample: gDNA was extracted using the magnetic bead method urine gDNA extraction kit (registration number: to be supplemented) from Hangzhou Kaibao Biotechnology Co., Ltd., following the instructions.

[0083] 2.3 Sulfite Conversion The transformation was performed using the nucleic acid transformation kit from Hangzhou Kaibao Biotechnology Co., Ltd. (registration number: to be supplemented). For specific instructions, please refer to the instruction manual.

[0084] 2.4 PCR amplification and sequencing According to the inventors' screening, using the hg38 genome as a reference genome, CpG islands in the chr1:50421000-50421550 region of the DMRTA2 gene, the chr7:19117550-19118050 region of the TWIST1 gene, and the chr10:17229200-17229700 region of the VIM gene showed high methylation rates in urothelial carcinoma. Specifically, the screening included: designing methylated and unmethylated primer pairs (sequences shown in Table 1). The PCR reaction system is shown in Table 2, and the procedure is shown in Table 3. The amplified products were subjected to Senggelin sequencing (performed by a sequencing company).

[0085] The sequence information of the chr1:50421000-50421550 region of the DMRTA2 gene is as follows: TCCGCCTCCGGTCCCCGCGGGCGCTCCCGCTCCAGGTCCCCCGCCGTCGGCGGCGCACACTGAACCGAAGACCTCGTAGGCGGGCCTCGGGGGGATGATGCCGTTGGCGGCGGCCAGCGCCAGCCCCTCGGCAGTGCCGTAGAGCAGCTGCAGCTCGCGCGCCTCGTTCTCCTCCTGCGCCTGCTGCCTGCGCAGCGCCACCTGCGCCGCCATGACACGCTGGCGCTCCGCGATGAGCGTGCACTTGGCGCACAGGCAGTCCTTCCAGCGACAGTAGCGTTTGTGGCCCTTGAGGGCCGACACCACGCCATGGTTGCGACAGCGCGCGCACTTGGGGGTCCGCGGGTACTTCTCGGCTGCCCGCAGCAACAGTGGCGGCCCCCGCAGCAAGCCGCCTGCCACGCTCACCGGTAGCGATGCAGCGGCCGCCGCGGCTGCCGCCACCGACGCCACCGACGCCACAGGCGGCCCCGTCGCTGTTGCCGCCGCCGCCGTCGCCGCGCCGGGCACGCTGGGCAGCTCCGAGCGCAGCTCCATGACAGGACCTGACG (SEQ ID NO: 86); The sequence information of the region chr7:19117550-19118050 of the TWIST1 gene is as follows: GAAAGCGCCCAACGGCTGGACGCACACCCCGCCAGGCCTCCTGGAAACGGTGCCGGTGCTGCAGAGCCCGCGAGGTGTCTGGGAGTTGGGCGAGAGCTGCAGACTTGGAGGCTCTTATACCTCCGTGCAGGCGGAAAGTTTGGGGGCAGCAGTGTCATTGGCCTGACGTGAGGAGGAGGGACTTTTCGAAGTTTTATAGGAAAGTTTCCGCTTTCCAGTCCCCCTCCCCCGTCCCACCTCCCTTCCTCGGGGTCTAACAATTCGTCCTCCCAAACCATTCAAAAACGACCTGGCCCGGGCGGCCGGCCCCTCCACCCGCCTCCTAGCCGCCCTCCCCCTTCCCTCCCCGTCGCCTTCCTCCGGCGGGCGCGGGGCGATTTCCTTCCCCGCCGGAGCGTGCGGGCAGCGCCCCCGAACCCTAGCGCAGCCCAGGAAGCGGTCGGAGGAGACTGTCCTGGCCGCGGTGGCAGCCCCATCCGGAGTGGCTGTGACAGCAGCAAT (SEQ ID NO: 87); The sequence information of the region chr10:17229200 - 17229700 of the VIM gene is as follows: CGCGGCTGGGATGGCAGTGGGAGGGGACCCTCTTTCCTAACGGGGTTATAAAAACAGCGCCCTCGGCGGGGTCCAGTCCTCTGCCACTCTCGCTCCGAGGTCCCCGCGCCAGAGACGCAGCCGCG CTCCCACCACCCACACCCACCGCGCCCTCGTTCGCCTCTTCTCCGGGAGCCAGTCCGCGCCACCGCCGCCGCCCAGGCCATCGCCACCCTCCGCAGCCATGTCCACCAGGTCCGTGTCCTCGTCC TCCTACCGCAGGATGTTCGGCGGCCCGGGCACCGCGAGCCGGCCGAGCTCCAGCCGGAGCTACGTGACTACGTCCACCGCACCTACAGCCTGGGCAGCGCGCTGCGCCCCAGCACCAGCCGCAG CCTCTACGCCTCGTCCCCGGGCGGCGTGTATGCCACGCGCTCCTCTGCCGTGCGCCTGCGGAGCAGCGTGCCCGGGGTGCGGCTCCTGCAGGACTCGGTGGACTTCTCGCTGGCCGACGCCATCAA (SEQ ID NO: 88).

[0086] Table 1 Note: Different primer combinations targeting the same region are used to amplify a specific segment belonging to that region. The sequences amplified by different primer combinations constitute the complete sequence information of the region. Specifically, sequence combination 1 amplifies the region chr1:50421001-50421223; sequence combination 2 amplifies the region chr1:50421208-50421361; sequence combination 3 amplifies the region chr1:50421326-50421464; and sequence combination 4 amplifies the region chr1:50421427-50421550.

[0087] Table 2 PCR reaction system Table 3 PCR reaction procedure 2.5 Results Analysis The methylation status of each CpG site was analyzed using Sanger sequencing peak plots: Demethylation: Cytosine is converted to thymine (T).

[0088] Complete methylation: cytosine remains unchanged (C).

[0089] Partial methylation: bimodal (C and T) appears.

[0090] If more than 90% of the CpG sites in an amplicon are methylated, then that region is considered methylation positive.

[0091] The results are shown in Tables 4 and 5. In Table 4, if only one primer combination is used, it indicates the detection results in different tissue samples (low-grade urothelial carcinoma tissue sample, high-grade urothelial carcinoma tissue sample, and adjacent normal tissue) when only this primer combination is used to detect methylation at the corresponding detection site. The same logic applies when using multiple primer combinations. For example, when using two primer combinations, each corresponding to a different gene, the methylation at the corresponding detection site is detected, and the detection results in the three tissue samples are obtained.

[0092] Urine samples were also tested using the same method (see Table 5 for details).

[0093] Table 4. Detection performance of at least one region of the DMRTA2, TWIST1, and VIM genes in tissue samples. Table 5 Detection performance of at least one region of the DMRTA2, TWIST1, and VIM genes in urine samples. 2.6 Conclusion Primer combinations based on at least one region of the DMRTA2, TWIST1, and VIM genes showed high sensitivity and specificity in both tissue and urine samples, especially with combinations of two or three genes (e.g., 1+5; 1+7; 2+5; 2+7; 1+9; 1+10; 1+5+9; 2+5+9; 3+5+9; 4+5+9, etc.). In low-grade urothelial carcinoma, the sensitivity was ≥75%, and in high-grade urothelial carcinoma, the sensitivity was ≥90%, and the specificity was ≥90%. Example 3: Assessment of methylation level of target gene using methylation-specific real-time PCR. 3.1 Sample Processing The procedure was the same as in Example 2. DNA extraction and sulfite conversion were performed using another batch of urine samples, including 100 samples of low-grade urothelial carcinoma, 100 samples of high-grade urothelial carcinoma, and 200 samples of benign patients.

[0094] 3.2 qPCR detection Multiplex qPCR was performed using the primer-probe combination and internal reference gene ACTB listed in Table 6. The reaction system was the same as in Example 1, and the program was as follows: 95°C for 5 minutes pre-denaturation, followed by 45 cycles of 95°C for 10 seconds and 60°C for 30 seconds.

[0095] Table 6 qPCR primer and probe combinations Note: The bolded and underlined areas in the table indicate the detected CpG sites. Specifically, the amplified and detected region for sequence combination 13 is chr1:50421022-50421208; the amplified and detected region for sequence combination 14 is chr1:50421195-50421318; the amplified and detected region for sequence combination 15 is chr1:50421326-50421445; and the amplified and detected region for sequence combination 16 is chr1:50421444-50421550.

[0096] 3.3 Results Analysis Determining methylation level using Ct values: (1) Ct value ≤ 40: methylation positive.

[0097] (2) Ct value > 40: methylation negative.

[0098] A positive result for at least one gene methylation in a sample indicates a positive cancer result.

[0099] The detection performance of the DMRTA2 gene, TWIST1 gene, and VIM gene combination in urine samples from cancer and benign patients is shown in Table 7.

[0100] Table 7 3.4 Conclusion qPCR further validated the high performance of the gene combinations. Primer combinations based on at least one region of the DMRTA2, TWIST1, and VIM genes all showed high sensitivity and specificity in urine samples, especially when using combinations of two or three genes (e.g., 13+17; 13+19; 14+18; 14+19; 13+21; 13+22; 13+23; ​​13+17+21; 14+17+21; 15+17+21; 16+17+21; 13+17+22; 14+17+22; 15+17+22; 16+17+22, etc.). In low-grade urothelial carcinoma, the sensitivity was ≥80%, and in high-grade urothelial carcinoma, the sensitivity was ≥90%, and the specificity was ≥90%.

[0101] Example 4: Validation of methylation-specific quantitative real-time PCR method for assessing the methylation level of target genes. 4.1 Sample Processing Similar to Example 2, urine samples were used for DNA extraction and sulfite conversion.

[0102] 4.2 qPCR detection Multiplex qPCR was performed using the primer-probe combination and internal reference gene ACTB listed in Table 6. The reaction system was the same as in Example 1, and the program was as follows: 95°C for 5 minutes pre-denaturation, followed by 45 cycles of 95°C for 10 seconds and 60°C for 30 seconds.

[0103] 4.3 Results Analysis The validation tests were performed using the primer-probe combinations listed in Table 7 in 50 patients with low-grade urothelial carcinoma, 50 patients with high-grade urothelial carcinoma, and 100 patients with benign urothelial carcinoma.

[0104] The results showed that the sensitivity was ≥80% in low-grade urothelial carcinoma and ≥90% in high-grade urothelial carcinoma, with a specificity of ≥90%.

[0105] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. The use of the reagent combination in the preparation of a diagnostic kit for the detection of urothelial carcinoma, characterized in that, The reagent combination includes reagents for detecting the methylation level or status of CpG island regions in the sample to be tested, including the following genes: (A) The CpG island region of the DMRTA2 gene is located in the chr1:50421000-50421550 region; and (B) CpG island regions selected from any of the following groups, or combinations thereof: (B1) The CpG island region of the TWIST1 gene is located in the chr7:19117550-19118050 region; (B2) The CpG island region of the VIM gene is located in the chr10:17229200-17229700 region; All of these regions use the hg38 genome as a reference genome.

2. The use as described in claim 1, characterized in that, The chr1:50421000-50421550 region refers to the entire chr1:50421000-50421550 region or any truncated region therein.

3. The use as described in claim 2, characterized in that, The truncated region includes: chr1:50421001-50421223 area; chr1:50421208-50421361 area; Region chr1:50421326-50421464; Region chr1:50421427-50421550; chr1:50421022-50421208 area; chr1:50421195-50421318 area; The range is chr1:50421326-50421445; the range is chr1:50421444-50421550.

4. The use as described in claim 1, characterized in that, The reagent or the kit comprises: (a) A first primer pair and a first probe for specifically detecting the methylation status of the CpG island region of the DMRTA2 gene; and (b) Any primer-probe combination selected from the following group, or a combination thereof: (b1) A second primer pair and a second probe for specifically detecting the methylation status of the CpG island region of the TWIST1 gene; (b2) A third primer pair and a third probe for specifically detecting the methylation status of the CpG island region of the VIM gene.

5. The use as described in claim 4, characterized in that, The first primer pair and the first probe are selected from the following group: (1) Primers: SEQ ID NO: 49-50, Probe: SEQ ID NO: 51; (2) Primers: SEQ ID NO: 52-53, Probe: SEQ ID NO: 54; (3) Primers: SEQ ID NO: 55-56, Probe: SEQ ID NO: 57; (4) Primers: SEQ ID NO: 58-59, Probe: SEQ ID NO: 60; The second primer pair and the second probe are selected from the following group: (1) Primers: SEQ ID NO: 61-62, Probe: SEQ ID NO: 63; (2) Primers: SEQ ID NO: 64-65, Probe: SEQ ID NO: 66; (3) Primers: SEQ ID NO: 67-68, Probe: SEQ ID NO: 69; (4) Primers: SEQ ID NO: 70-71, Probe: SEQ ID NO: 72; The third primer pair and the third probe are selected from the following group: (1) Primers: SEQ ID NO: 73-74, Probe: SEQ ID NO: 75; (2) Primers: SEQ ID NO: 76-77, Probe: SEQ ID NO: 78; (3) Primers: SEQ ID NO: 79-80, Probe: SEQ ID NO: 81; (4) Primers: SEQ ID NO: 82-83, probe: SEQ ID NO:

84.

6. The use as described in claim 1, characterized in that, The test sample is selected from the following group: urine sample, tissue sample, or a combination thereof.

7. A reagent combination for detecting the risk of urothelial carcinoma, characterized in that, The reagent combination includes: (a) A first primer pair and a first probe for specifically detecting the methylation status of the CpG island region of the DMRTA2 gene; and (b) Any primer-probe combination selected from the following group, or a combination thereof: (b1) A second primer pair and a second probe for specifically detecting the methylation status of the CpG island region of the TWIST1 gene; (b2) A third primer pair and a third probe for specifically detecting the methylation status of the CpG island region of the VIM gene; Specifically, using the hg38 genome as the reference genome, the CpG island region of the DMRTA2 gene is located in the chr1:50421000-50421550 region; the CpG island region of the TWIST1 gene is located in the chr7:19117550-19118050 region; and the CpG island region of the VIM gene is located in the chr10:17229200-17229700 region.

8. A reagent kit, characterized in that, The kit comprises the reagent combination as described in claim 7.

9. A combination of urothelial carcinoma risk markers, characterized in that, The methylation level or status of the CpG island regions of the following genes: (A) The CpG island region of the DMRTA2 gene is located in the chr1:50421000-50421550 region; and (B) CpG island regions selected from any of the following groups, or combinations thereof: (B1) The CpG island region of the TWIST1 gene is located in the chr7:19117550-19118050 region; (B2) The CpG island region of the VIM gene is located in the chr10:17229200-17229700 region; All of these regions use the hg38 genome as a reference genome.

10. A diagnostic device for urothelial carcinoma, characterized in that, The device includes: (a) An input module configured to input methylation level or status data of CpG island regions of the following genes in the sample to be tested: (A) The CpG island region of the DMRTA2 gene is located in the chr1:50421000-50421550 region; and (B) CpG island regions selected from any of the following groups, or combinations thereof: (B1) The CpG island region of the TWIST1 gene is located in the chr7:19117550-19118050 region; (B2) The CpG island region of the VIM gene is located in the chr10:17229200-17229700 region; All of these regions use the hg38 genome as a reference genome. (b) An assessment module configured to receive the methylation level or status data and perform a risk assessment to obtain an assessment result of the risk of urothelial carcinoma in the subject; wherein the assessment includes: if the methylation level C1 of the CpG island region is significantly higher than the control reference value C0, and / or methylation occurs in the CpG island region, then the subject is determined to have a high risk of urothelial carcinoma; otherwise, the risk of urothelial carcinoma is low. (c) Output module, which is configured to input the evaluation result.