Recombinant biological carrier for detecting activation potency of aromatic hydrocarbon receptor and application of recombinant biological carrier
By designing a recombinant biological vector containing five dioxin reaction elements, the problem of inaccurate assessment of aromatic receptor activation effects in existing technologies has been solved, realizing a highly sensitive and low-cost detection method suitable for health risk assessment and high-throughput screening of human cells.
Patent Information
- Application Number
- CN202610491684.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-15
- Publication Date
- 2026-05-19
AI Technical Summary
Existing chemical analysis methods cannot accurately assess the activation effect of aromatic hydrocarbon receptors (AhRs) in mixed pollutants in the environment, and bioassays suffer from high false positive rates, high costs, and low sensitivity, making it difficult to achieve high-throughput screening of mixed pollutants and assessment of human health risks.
A recombinant biological vector containing a core sequence of five dioxin reaction elements and a minimal promoter was designed to initiate the expression of green fluorescent protein MaxGFP. By tandemly connecting the DRE core sequence with the artificially designed minimal promoter, a shorter nucleotide sequence is formed, reducing non-specific binding sites and improving specificity and sensitivity, making it suitable for detection in human cells.
It achieves highly sensitive and low-cost detection of aromatic receptor activation efficacy, suitable for large-scale detection and human health risk assessment, with high specificity and low false positives, and is applicable to real-time monitoring and high-throughput screening of live cells.
Smart Images

Figure CN122060739A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of environmental protection technology, specifically relating to a recombinant biological carrier for detecting the activation efficacy of aromatic hydrocarbon receptors and its application. Background Technology
[0002] Aromatic hydrocarbon receptors (AhRs) are important transcription factors in organisms, widely distributed in various mammalian cell types. They regulate the body's response to specific chemicals, influencing gene expression and cellular function (Sondermann et al., 2023). AhRs play a crucial role in detoxification, immune regulation, and development, and are closely related to the toxicity of environmental pollutants and the occurrence of certain diseases (Schiering et al., 2017). Furthermore, AhR activation is often directly related to the toxic effects of persistent organic pollutants. AhR activation leads to a series of downstream signaling events, such as the activation of transcription factors and changes in the expression of related genes, thereby triggering health problems such as cytotoxicity, developmental abnormalities, and immune system damage. With the acceleration of industrialization, mixed pollutants in the environment have become a significant global problem. Many such pollutants, especially polycyclic aromatic hydrocarbons (PAHs), dioxins (PCDDs / Fs), and polychlorinated biphenyls (PCBs), can trigger a series of toxic reactions by binding to AhRs, leading to health problems such as carcinogenicity, endocrine disruption, and immunosuppression (Eisenreich et al., 2021; Desforges et al., 2018). Therefore, assessing the AhR activation effect in these mixed environmental pollutants is crucial for pollutant risk assessment and management. However, because these pollutants often exist in mixed forms, at low concentrations, and with high toxicity, accurately assessing and measuring their effects remains a significant challenge.
[0003] Chemical analysis is the gold standard for assessing pollutant concentrations in the environment, primarily including gas chromatography (GC), liquid chromatography (LC), and detection techniques coupled with mass spectrometry (MS). These methods provide direct chemical information by separating, identifying, and quantifying pollutants. While tandem GC-MS methods offer high sensitivity and resolution, they are also costly, involve complex procedures, require extensive pretreatment, and incur significant material and time costs. Furthermore, targeted analytical methods are limited to substances already identified with available standards, such as the 16 common polycyclic aromatic hydrocarbons (PAHs) and 17 dioxins, and cannot detect emerging substances. Non-targeted analytical methods, while capable of detecting and identifying emerging substances, lack accurate quantification capabilities. Most importantly, chemical analysis methods cannot translate detected concentration data into directly observable toxic effects, and they cannot reflect the synergistic and antagonistic interactions between substances in complex mixtures (Wang et al., 2024). Therefore, chemical analysis is not suitable for predicting the toxic effects of a specific target in a mixture.
[0004] Bioassays offer a new approach to addressing this drawback, enabling not only direct determination of the toxicity of a specific target in a mixture but also high-throughput screening (Han et al., 2004). The general principle of bioanalytical methods is to indirectly deduce the effect of pollutants by detecting their activation of AhRs in organisms or cells. Cell reporter gene systems are based on the principle of AhR-regulated gene expression, utilizing AhR-responsive elements to drive the expression of reporter genes (such as luciferase or β-galactosidase). When a pollutant binds to an AhR and activates the receptor, the fluorescence or enzyme activity changes produced by the reporter gene can be used to quantify the pollutant concentration. However, the application of current bioassay methods remains limited, and with the diversification and complexity of environmental pollutants, false positives in bioanalytical methods are gradually increasing, which is closely related to the length of the response element. Therefore, there is an urgent need to continue developing simple, rapid, low-cost, and highly specific and sensitive bioassay methods. Summary of the Invention
[0005] This invention provides a recombinant biological vector for detecting the activation efficacy of aromatic hydrocarbon receptors and its application. The recombinant biological vector has higher specificity, species relevance, low cost and convenience of detection, and lower false positives, making it suitable for large-scale detection and human health risk assessment.
[0006] This invention provides a promoter for initiating reporter gene expression, comprising a core sequence of five dioxin response elements and a minimal promoter; The minimum promoter is derived from a eukaryotic promoter and retains only the TATA frame and the initiator. The nucleotide sequence of the minimum promoter is shown in SEQ ID No. 2.
[0007] In one specific embodiment of the present invention, the nucleotide sequence of the core sequence is shown in SEQ ID No. 1.
[0008] In one specific embodiment of the present invention, the nucleotide sequence of the promoter is shown in SEQ ID No. 3.
[0009] The present invention also provides an expression cassette for green fluorescent protein MaxGFP, which utilizes the above-mentioned promoter to initiate the expression of green fluorescent protein MaxGFP; The nucleotide sequence of the green fluorescent protein MaxGFP is shown in SEQ ID No. 9.
[0010] In one specific embodiment of the present invention, the green fluorescent protein MaxGFP in the expression frame is obtained by amplification, and the primer pair for amplification includes an upstream primer with nucleotide sequences as shown in SEQ ID No. 4 and a downstream primer as shown in SEQ ID No. 5.
[0011] The present invention also provides a recombinant biological vector comprising the above-described expression cassette.
[0012] The present invention also provides a recombinant cell comprising the above-described recombinant biological vector.
[0013] The present invention also provides the application of the above-mentioned recombinant biological vector or the above-mentioned recombinant cells in detecting the activation efficacy of aryl hydrocarbon receptors.
[0014] Beneficial Effects: This invention provides a promoter for initiating reporter gene expression, comprising a core sequence of five dioxin response elements (DREs) and a minimal promoter. This invention uses a modified green fluorescent protein (MaxGFP) reporter gene promoter, tandemly linking the core sequence of the five DREs with an artificially designed minimal promoter, to detect the activation efficacy of the aromatic hydrocarbon receptor (AhR). Taking 2,3,7,8-tetrachlorodibenzo-p-dioxin (2,3,7,8-TCDD), the strongest AhR agonist, as an example, the detection limit can reach the pM level.
[0015] This invention utilizes the aforementioned promoter to initiate MaxGFP expression. The selected response elements consist only of the DRE core sequence and adjacent sequences, with each individual response element being only 15 bp in length. Several elements are tandemly linked to form a shorter sequence, significantly reducing non-specific binding sites. Simultaneously, an artificially modified minimum promoter (minP) of 31 bp is selected, retaining only the TATA frame and the initiator, exhibiting extremely low transcriptional activity. This results in a recombinant vector with extremely low background transcription levels, a high signal-to-noise ratio, and high specificity.
[0016] This invention selects human cells as the chassis cells, which possess a complete CYP1A1 metabolic system and exhibit high background expression of AhR and ARNT (aromatic hydrocarbon receptor nuclear transporter), making human-derived health risk assessments physiologically most relevant. The MaxGFP described in this invention possesses higher autofluorescence intensity, faster maturation speed, and superior photostability, allowing direct detection under a fluorescence microscope, making it ideal for high-throughput screening scenarios that do not require precise quantification. Furthermore, it enables real-time monitoring in live cells, offering significant advantages for large-scale detection. This detection method is simple to operate, has low cost per test, and is suitable for large-scale detection and human health risk assessment. Attached Figure Description
[0017] Figure 1 A spectrum of recombinant biological vectors; Figure 2 The exposure time-fluorescence intensity curve is shown in Example 2; Figure 3 This is the exposure concentration-fluorescence intensity standard curve from Example 3; Figure 4 Images showing the exposure concentration-fluorescence intensity observation in Example 3; Figure 5 Error graph of results measured between independent experiments; Figure 6 A graph showing the results of a specificity test for the reporter gene system; Figure 7 The graph shows the test results of the reporter gene system's ability to induce the activity of a single component. Figure 8 Graph showing the response results of different numbers of DREs to 2,3,7,8-TCDD; Figure 9 The figure shows the stability test results of the three recombinant vectors in four independent experiments; Figure 10 The figure shows the detection specificity results of the three recombinant vectors for PFAS. Detailed Implementation
[0018] This invention provides a promoter for initiating reporter gene expression, comprising a core sequence of five dioxin response elements and a minimal promoter; the minimal promoter is derived from a eukaryotic promoter and retains only the TATA frame and the initiator.
[0019] In one embodiment of the present invention, the core sequences of five DREs are tandemly linked. The dioxin response elements are derived from the upstream of the human CYP1A1 promoter. The core sequence 5'-TNGCGTG-3' and adjacent bases (total 15 bp) of the component with the strongest transcriptional activity are selected and tandemly copied five times as the response elements of the recombinant plasmid. In one embodiment of the present invention, the nucleotide sequence of the DREs is shown in SEQ ID No. 1: TTCTTGCGTGACAAT.
[0020] The minimal promoter (minP) described in this invention is derived from a eukaryotic promoter and has been artificially simplified to retain only the TATA frame and the initiator, i.e., only the most basic and core eukaryotic promoter sequence. It can only maintain a very low transcriptional level, and its transcriptional activity is almost entirely regulated by upstream response elements. In one embodiment of this invention, the nucleotide sequence of the minP is shown in SEQ ID No. 2: AGAGGGTATATAATGGAAGCTCGACTTCCAG.
[0021] The promoter described in this invention can be directly synthesized by chemical synthesis. In one embodiment, the nucleotide sequence of the chemically synthesized promoter (DREs-minP) is shown in SEQ ID No. 3: TTCTTGCGTGACAATTTCTTGCGTGACAATTTCTTGCGTGACAATTTCTTGCGTGACAATTTCTTGCGTGACAATCCTCGAGGAGAGGGTATATAATGGAAGCTCGACTTCCAG.
[0022] The present invention also provides an expression cassette for green fluorescent protein MaxGFP, which utilizes the above-mentioned promoter to initiate the expression of green fluorescent protein MaxGFP.
[0023] The MaxGFP described in this invention is a green fluorescent protein with rapid maturation characteristics. In one embodiment, the MaxGFP sequence is first obtained through chemical synthesis, and its nucleotide sequence is shown in SEQ ID No. 9. During amplification, this sequence is used as a template, and primer pairs are designed for amplification. The amplification primer pairs described in this invention include an upstream primer with nucleotide sequences shown in SEQ ID No. 4 and a downstream primer with SEQ ID No. 5.
[0024] Upstream primer (SEQ ID No. 4): 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTGCCACCATGCCCGCCATGAAGATCGAG-3'; Downstream primer (SEQ ID No. 5): 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTCATCGAGCTCGAGATCTGGC-3'.
[0025] The present invention also provides a recombinant biological vector comprising the above-described expression cassette.
[0026]
[0027] The present invention also provides a method for constructing the recombinant biological vector, specifically comprising using an LR reaction to recombine an intermediate vector containing MaxGFP, an intermediate vector containing DREs-minP, and a backbone vector, thereby constructing the recombinant biological vector.
[0028] In one embodiment of the present invention, the amplified MaxGFP DNA fragment is ligated to the intermediate vector backbone pDown via a Gateway BP reaction (Gateway® BP Clonase™ II Enzyme Mix, Invitrogen) using a PCR method (refer to https: / / www.thermofisher.cn / cn / zh / home / life-science / cloning / gateway-cloning / protocols.html) to obtain the pDown-{MaxGFP} intermediate vector. The chemically synthesized DREs-minP fragment is then ligated to the pUp vector backbone via a Gateway BP reaction to obtain the pUp-{DREs}-minP intermediate vector. Then, pDown-{MaxGFP}, pUp-{DREs}-minP, and the vector backbone pRP[Exp]-Backbone were recombined via an LR reaction (Gateway® LR Clonase™ II Plus Enzyme Mix, Invitrogen). Finally, restriction endonuclease digestion and agarose gel electrophoresis were used to confirm the correctness of the vector, yielding the final vector pRP[En]-{DREs}:minP>MaxGFP.
[0029] This invention also provides a method for amplifying the recombinant biological vector, comprising transforming the recombinant biological vector into *Escherichia coli* DH5α. For example, in one embodiment, 100 ng of the recombinant biological vector is added to every 100 μL of competent DH5α cells, incubated on ice for 30 min, heat-shocked at 42°C for 90 s, quickly placed on ice for 2 min, screened with ampicillin, and single colonies are selected for amplification. After transformation, the colonies are inoculated into LB medium at 0.1% of the bacterial culture volume, cultured overnight, centrifuged to obtain colonies, and plasmids are extracted. The obtained plasmids are filtered, and their concentration and purity are determined.
[0030] The present invention also provides a recombinant cell comprising the above-described recombinant biological vector.
[0031] The recombinant cells described in this invention are obtained by transfection using human cells as the substrate cells and the aforementioned recombinant biological vector. The host cell in this invention is a human liver cancer cell (HepG2). HepG2 cells adherently, are easy to culture and transfect, naturally express high levels of AhR and ARNT, and also express downstream metabolic enzymes such as CYP1A1, possessing a complete AhR pathway system. Furthermore, as a human liver-derived cell, it has strong physiological relevance. One day before transfection, HepG2 cells were evenly seeded into 24-well plates, controlling the cell number to achieve a cell density of 70-90% at transfection. Four to six hours before transfection, the complete cell culture medium was replaced with 5% serum-depleted medium (Opti-MEM) to starve the cells and improve transfection efficiency. The vector and transfection reagent (lipo2000) were diluted with Opti-MEM. The following figures refer to the volume per well: 2 μg of vector was diluted with 50 μL of Opti-MEM (vector working solution), and 3 μL of lipo2000 was diluted with 50 μL of Opti-MEM (transfection reagent working solution). After standing for 5 min, the vector working solution was added to the transfection reagent working solution, gently mixed, and then stood for 20 min to produce the vector-transfection reagent mixture. 100 μL of the vector-transfection reagent mixture was added to each well plate and incubated for 4–6 h. The medium was then replaced with complete culture medium (MEM containing NEAA + 10% FBS + 1% P / S), and incubated for another 18 h to verify the effectiveness of transfection.
[0032] The present invention also provides the application of the above-mentioned recombinant biological vector or the above-mentioned recombinant cells in detecting the activation efficacy of aryl hydrocarbon receptors.
[0033] In this invention, aromatic substances, such as dioxins or polycyclic aromatic hydrocarbons, can be placed in the solvent dimethyl sulfoxide (DMSO) to prepare a solution containing 1.55 × 10⁻⁶ ppm. -5 The aromatic solvent mother solution is diluted to obtain the aromatic solvent working solution. In this invention, the aromatic solvent working solution is added to cells at a volume ratio of 0.1% for exposure. After exposure, the fluorescence intensity is measured by flow cytometry or an enzyme-linked immunosorbent assay (ELISA) reader to obtain the relationship between different exposed substances and fluorescence intensity. The activation effect of the exposed substance on the aromatic receptor is determined based on the fluorescence intensity, thus realizing the detection of the activation efficacy of the aromatic receptor.
[0034] To further illustrate the present invention, the following detailed description, in conjunction with embodiments, of a recombinant biological vector for detecting the activation efficacy of aromatic hydrocarbon receptors and its applications, should not be construed as limiting the scope of protection of the present invention.
[0035] Example 1 1. Construction of the pRP[En]-{DREs}:minP>MaxGFP vector.
[0036] First, the MaxGFP DNA fragment was amplified by PCR using the sequence shown in SEQ ID No. 9 as a template and the primer pair composed of SEQ ID No. 4 and SEQ ID No. 5.
[0037] PCR system: Pre-denaturation: 98℃ for 3 min; Cycling: 98℃ for 10 s, 60℃ for 10 s, 72℃ for 60 s, 30 cycles; Complete extension: 72℃ for 5 min.
[0038] PCR program: 2×Rapid Taq Master Mix 12.5μL; upstream primer (10μM) 1μL; downstream primer (10μM) 1μL; template DNA (100ng) 1μL; ddH2O 9.5μL.
[0039] The DNA fragment was then ligated into the intermediate vector backbone pDown using a Gateway BP reaction (Gateway® BP Clonase™ II Enzyme Mix, Invitrogen). Sanger sequencing confirmed the vector was correct, yielding the intermediate vector pDown-{MaxGFP}.
[0040] The DREs-minP fragment shown in SEQ ID No. 3 was directly chemically synthesized according to the standard sequence, and then the DREs-minP was integrated into the pUp vector backbone by a method similar to that used to construct the pDown vector.
[0041] Then, pDown-{MaxGFP}, pUp-{DREs}-minP, and the vector backbone pRP[Exp]-Backbone were recombined via an LR reaction (Gateway® LR Clonase™ II Plus Enzyme Mix, Invitrogen). Finally, restriction endonuclease digestion and agarose gel electrophoresis were used to confirm the correctness of the vector, resulting in the final vector pRP[En]-{DREs}:minP>MaxGFP, which is abbreviated as pRP1.1 below.
[0042] 2. Construction of the pRP[En]-minP>MaxGFP vector The pDown-{MaxGFP} vector was constructed in the same manner as described in section 1. The minP fragment shown in SEQ ID No. 2 was directly chemically synthesized based on the standard sequence, and then the minP was integrated into the pUp vector backbone using a method similar to that used to construct the pDown vector. This vector served as a blank control for the vector of this invention, used to detect the background activity of the promoter minP.
[0043] Then, pDown-{MaxGFP}, pUp-minP, and the vector backbone pRP[Exp]-Backbone were recombined via an LR reaction (Gateway® LR Clonase™ II Plus Enzyme Mix, Invitrogen). Finally, restriction endonuclease digestion and agarose gel electrophoresis were used to confirm the correctness of the vector, resulting in the final vector pRP[En]-minP>MaxGFP, which will be abbreviated as pRP0.1 below.
[0044] 3. pRP[En]-{DREs 2}-minP>MaxGFP and pRP[En]-{DREs Construction of the 8}-minP>MaxGFP vector The construction method of pDown-{MaxGFP} is the same as in 1, and {DREs} are directly chemically synthesized based on the standard sequence. 2}-minP and {DREs 8}-minP, and then integrate minP into the pUp vector backbone using a method similar to constructing the pDown vector. {DREs 2}-minP and {DREs The sequences of 8}-minP are shown in SEQ ID No. 7 and SEQ ID No. 8, respectively. This group of vectors serves as a control for the vectors of the present invention, used to compare the effect of the number of DREs on the overall performance of the vectors.
[0045] SEQ ID No.7: TTCTTGCGTGACAATTTCTTGCGTGACAATCCTCGAGGAGAGGGTATATAATGGAAGCTCGACTTCCAG; SEQ ID No. 8: TTCTTGCGTGACAATTTCTTGCGTGACAATTTCTTGCGTGACAATTTCTTGCGTGACAATTTCTTGCGTGACAATTTCTTGCGTGACAATTTCTTGCGTGACAATTTCTTGCGTGACAATCCTCGAGGAGAGGGTATATAATGGAAGCTCGACTTCCAG.
[0046] Then pDown-{MaxGFP}, pUp-{DREs} 2}-minP, vector backbone pRP[Exp]-Backbone and pDown-{MaxGFP}, pUp-{DREs 8}-minP and the vector backbone pRP[Exp]-Backbone were recombined via the LR reaction (Gateway® LR Clonase™ II Plus Enzyme Mix, Invitrogen). Finally, restriction endonuclease digestion and agarose gel electrophoresis confirmed the correct vector, yielding pRP[En]-{DREs} 2}-minP>MaxGFP and pRP[En]-{DREs The final vectors for 8}-minP>MaxGFP are abbreviated as pRP2.1 and pRP3.1, respectively.
[0047] Example 2 HepG2 cells were transiently transfected with pRP 0.1 or pRP 1.1: One day before transfection, HepG2 cells were evenly seeded into 24-well plates, controlling the cell number to achieve a cell density of 70-90% at transfection. 4-6 hours before transfection, the complete culture medium was replaced with serum-depleted medium (Opti-MEM) to starve the cells and improve transfection efficiency. The vector and transfection reagent (lipo2000) were diluted with Opti-MEM. The following figures are per well: 2 μg of vector was diluted with 50 μL of Opti-MEM (vector working solution), and 3 μL of lipo2000 was diluted with 50 μL of Opti-MEM (transfection reagent working solution). After standing for 5 min, the vector working solution was added to the transfection reagent working solution, gently mixed, and then stood for 20 min to produce the vector-transfection reagent mixture. Add 100 μL of the vector-transfection reagent mixture to the well plate, place it in an incubator and continue culturing. After 4-6 hours, replace it with complete culture medium and continue culturing for 18 hours.
[0048] After transfection, cells were treated with 10 nM 2,3,7,8-TCDD at nine time points between 0 and 72 hours (0, 4, 8, 12, 16, 24, 36, 48, and 72 hours). The start time of treatment was controlled to ensure all nine groups finished treatment at the same time. After treatment, the culture medium was discarded, cells were washed with PBS, digested with trypsin, centrifuged, washed, resuspended in PBS, and the fluorescence intensity of MaxGFP was detected by flow cytometry to reflect the induction activity of the chemical on the reporter gene system.
[0049] The results are as follows Figure 2 As shown, the fluorescence intensity of the reporter gene system changed under different treatment times. Before 48 hours, the fluorescence intensity gradually increased with the increase of treatment time, and basically reached saturation at 48 hours.
[0050] Example 3 HepG2 cells were transiently transfected with pRP 0.1 or pRP 1.1 using the same method as in Example 2. After transfection, 2,3,7,8-TCDD was selected at nine concentrations ranging from 1.55 to 10000 pM, diluted three times, and the cells were treated for 48 h. The average fluorescence intensity of the cells was measured after treatment. Additionally, cells were transfected in confocal dishes with benzo[a]pyrene (BaP) at seven concentrations (0–1 μM, ten-fold dilution). The cells were then treated and observed using a fluorescence microscope after treatment.
[0051] like Figure 3 As shown, under the induction of gradient concentrations of 2,3,7,8-TCDD, the fluorescence intensity exhibits an S-shaped curve, reaching saturation at a concentration of approximately 1 nM. Simultaneously, the limit of detection for this plasmid can reach approximately 1 pM. Figure 4 As shown, the relationship between the induction effect and fluorescence intensity is significant, allowing for visual observation, which is highly suitable for large-scale experiments requiring preliminary high-throughput screening without the need for precise quantification. Meanwhile, the negative control results indicate that the minimum promoter minP of the plasmid has extremely low background activity, ensuring the accuracy and reliability of the results in detection at very low concentrations.
[0052] Example 4 HepG2 cells were transiently transfected with pRP0.1 or pRP1.1 using the same method as in Example 2. Cells were treated with 0.1 nM 2,3,7,8-TCDD and 12 separate experiments were performed, measuring the mean fluorescence intensity of the cells in each separate experiment. Cells were also treated with 1 nM 2,3,7,8-TCDD and 1 nM perfluorinated compound standard (PFASs-MXA), and co-treated with 1 nM 2,3,7,8-TCDD and 1 nM PFASs-MXA. 0.1% DMSO was used as a negative control. The mean fluorescence intensity of the cells was measured after each treatment.
[0053] like Figure 5 As shown, in 10 out of 12 independent experiments, the results fell within the 20% acceptable error range, demonstrating the stability of the recombinant biological vector described in this invention in transfecting cells and in exerting its function, and also indicating the comparability of the results between multiple experiments.
[0054] like Figure 6As shown, the transfected cells responded almost entirely to PFAS, with no significant difference compared to the negative control. Similarly, there were no significant differences between the 2,3,7,8-TCDD single treatment group and the co-treatment group of 2,3,7,8-TCDD and PFAS. This indicates that the vector has high specificity and excellent anti-interference properties, making the experimental results highly reliable.
[0055] Example 5 HepG2 cells were transiently transfected with pRP0.1 or pRP1.1 using the same method as in Example 2. Cells were then individually treated with 1 nM 2,3,7,8-TCDD, a mixture of 16 polycyclic aromatic hydrocarbons (PAHs-16), a mixture of organophosphate monoesters, organophosphate diesters, organophosphate triesters, and PFASs-MXA, with 0.1% DMSO as a negative control. The mean fluorescence intensity of the cells was measured after treatment.
[0056] like Figure 7 As shown, in addition to exhibiting strong responses to typical agonists 2,3,7,8-TCDD and PAHs, the reporter gene system also shows some response to three classes of organophosphates. While organophosphates are not recognized AhR agonists, they do exhibit an activating effect on the reporter gene system. Further investigation revealed that all three classes of organophosphates contain phenyl groups, and the presence of phenyl groups is the structural basis for binding with AhR. This explains why PFCAs-MXA did not show an activating effect. These results demonstrate the stability of the recombinant biological vector described in this invention, making it fully suitable for the accurate assessment of the activation efficacy of unknown compounds.
[0057] Comparative Example HepG2 cells were transiently transfected with pRP1.1, pRP2.1, or pRP3.1. The three cell types were treated individually for 48 hours with 10 nM and 1 pM of 2,3,7,8-TCDD, and the mean fluorescence intensity was measured. Four independent experiments were performed, each treating the three cell types individually with 1 nM of 2,3,7,8-TCDD for 48 hours, and the mean fluorescence intensity was measured. The three cell types were also treated for 48 hours with 1 nM of PFASs-MXA and 0.1% DMSO, and the mean fluorescence intensity was measured.
[0058] The results are as follows Figure 8 , Figure 9 , Figure 10As shown, different numbers of DREs exhibit significant differences in detection sensitivity, stability, and specificity. Under low-concentration treatment, when the number of DREs is too small, the activation effect is too weak due to the limited number of binding sites, making it difficult to generate detectable fluorescence. Conversely, when the number of DREs is too large, the number of non-specific binding sites increases, making it difficult to distinguish from the background at low concentrations. Furthermore, when the number of DREs is too small, the instability of the recombinant vector between multiple tests is greatly enhanced, possibly due to the limited number of binding sites, making it susceptible to slight fluctuations. When the number of DREs is too large, excessively long tandem repeat sequences are easily recognized by cells as "abnormal DNA," potentially silencing the reporter gene system and leading to abnormal results.
[0059] In summary, both excessive and insufficient DREs can negatively impact the sensitivity, specificity, and stability of the recombinant vector. The DREs used in this invention... 5. It features the highest sensitivity, low background, wide dynamic range, and high induction factor, making it more suitable for large-scale, high-throughput, high-specificity, and high-sensitivity testing.
[0060] Although relevant reporter gene detection methods have been reported, the technology remains immature. For AhR, there are uncertainties regarding the binding affinity between AhR and DREs, the effect of different DRE copy numbers on transcriptional activity, and the impact of promoter selection on reporter gene background noise. This application solves the above problems through a unique technical solution and experimental screening, while the prior art does not disclose or imply such technical means.
[0061] Existing reporter gene detection vectors typically directly replicate nucleic acid sequences from the human or other organisms' genomes as promoters or response elements. When used as promoters, this results in a certain background activity, potentially leading to high background noise. When used as response elements, the long nucleic acid sequences connecting the core sequences cause both excessive vector size and reduced specificity. This invention utilizes a minimal promoter, ensuring the lowest possible background activity and reducing background noise. Furthermore, the response element is a tandem arrangement of core elements, significantly reducing the nucleic acid sequence length. This improves specificity while simultaneously reducing the overall vector size, optimizing transfection efficiency and copy number, and significantly enhancing detection sensitivity.
[0062] This application has achieved reproducible and highly specific results in the detection of mixed samples through experimental verification. This technology far surpasses existing technologies, and by utilizing HepG2 as a transfection host, its effectiveness in assessing human health risks is significantly superior to other biological host cells.
[0063] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A promoter for initiating reporter gene expression, characterized in that, Includes the core sequence of five dioxin reaction elements and the smallest promoter; The minimum promoter is derived from a eukaryotic promoter and retains only the TATA frame and the initiator. The nucleotide sequence of the minimum promoter is shown in SEQ ID No.
2.
2. The promoter according to claim 1, characterized in that, The nucleotide sequence of the core sequence is shown in SEQ ID No.
1.
3. The promoter according to claim 1, characterized in that, The nucleotide sequence of the promoter is shown in SEQ ID No.
3.
4. An expression cassette for the green fluorescent protein MaxGFP, characterized in that, The expression of green fluorescent protein MaxGFP is initiated using the promoter according to any one of claims 1 to 3; The nucleotide sequence of the green fluorescent protein MaxGFP is shown in SEQ ID No.
9.
5. The expression box according to claim 4, characterized in that, The green fluorescent protein MaxGFP in the expression box is obtained by amplification, and the primer pair for amplification includes an upstream primer with nucleotide sequences as shown in SEQ ID No. 4 and a downstream primer as shown in SEQ ID No.
5.
6. A recombinant biological vector comprising the expression cassette of claim 4 or 5.
7. A recombinant cell comprising the recombinant biological vector of claim 6.
8. The use of the recombinant biological vector of claim 6 or the recombinant cell of claim 7 in detecting the activation efficacy of aryl hydrocarbon receptors.