Molecular markers for detecting the PVR4 gene of potato virus Y resistance and its application

Abstract

This invention provides a molecular marker for detecting the PVR4 gene, a resistance gene against Potato Virus Y, and its application, belonging to the field of genetic engineering technology. The molecular marker is the TC base at 4714-4715 bp of the CM334 pepper variety (NCBI accession number KT359375.1). This invention also provides primers and a kit based on the molecular marker. PCR amplification and electrophoresis detection enable rapid and accurate screening of pepper varieties carrying the PVR4 gene against Potato Virus Y. The molecular marker described in this invention plays an important role in detecting the PVR4 gene against Potato Virus Y in peppers or in breeding disease-resistant pepper varieties.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a molecular marker for detecting the potato virus Y resistance PVR4 gene and its application. Background Technology

[0002] chili( Capsicum Peppers (spp.) are widely distributed and susceptible to a variety of pathogens, with over 20 viruses identified that can severely restrict yield and quality. When peppers are infected with viruses, they often exhibit a range of symptoms, including leaf spots, mottling, yellowing, curling, and wrinkling; stunted growth and slowed development; and deformed, unevenly colored, and low-yield fruits. Because viruses can spread through mechanical contact, insect vectors, seed transmission, and soil transmission, they are difficult to eradicate once infected, and their damage is particularly pronounced under continuous cropping conditions. Common pepper viruses include Tobacco Mosaic Virus (TMV), Pepper Mild Mottle Virus (PMMoV), Peppersevere Mosaic Virus (PseSMV), Potato Virus Y (PVY), and Ecuadorian Rocoto Virus (ERV). Currently, there are no effective chemical control methods to control viral damage. Therefore, utilizing the genetic resistance of plants themselves has become the only sustainable strategy to protect crops from viral attacks.

[0003] In chili peppers, several recessive or dominant resistance genes against viruses have been identified and applied to breeding (Provvidenti & Hampton, 1992; Kyle & Palloix, 1997). Among them, the dominant gene derived from the material "Criollo deMorelos 334" (CM334) is... Pvr4Since the 1990s, this gene has been widely introduced into sweet pepper hybrids due to its effective resistance to a variety of viruses, including all known strains of Potato Virus Y (PVY), Pepper Severe Mosaic Virus (PepSMV), Pepper Yellow Mosaic Virus (PepYMV), Pepper Mottle Virus (PepMoV), Peruvian Tomato Mosaic Virus (PTV), Ecuadorian Rocto Virus (ERV), and Tobacco Etch Virus (TEV) (Dogimont et al., 1996; Janzac et al., 2008). This gene is located on chromosome 10 of the pepper and is closely linked to multiple dominant genes or quantitative trait loci (QTLs) for resistance to viruses and other pathogens, making this genomic region a known cluster of resistance genes (Grube et al., 2000; Djian-Caporalino et al., 2006). Although several virus resistance genes in chili peppers have become ineffective due to the emergence of highly virulent new strains (Hobbs et al., 1994; Palloix et al., 1994; Genda et al., 2007; Hamada et al., 2007), but Pvr4 No failure of the mediated resistance has been reported to date, suggesting that its resistance may be more durable.

[0004] Given Pvr4 The importance of genes has led to the development of several molecular markers linked to them. Caranta et al. (1999) [the following text is incomplete and requires further context: "to determine the importance of genes, several molecular markers linked to them have been developed ... Pvr4 The gene was located in a linkage group containing eight AFLP markers, and one of them (E41 / M49-645) was converted to the CAPS marker. Arnedo-Andrés et al. (2002) used segregating populations obtained from crossing the resistant parent CM334 with the susceptible parent "Yolo Wonder" to develop a gene that was related to the AFLP marker. Pvr4 The locus-linked RAPD marker UBC191432 and its transformed SCAR marker SCUBC191432. Devran et al. (2015) used the F2 population generated by crossing the susceptible material “SR-231” and the resistant material “CM334” to identify locus-linked RAPD marker UBC191432 and its transformed SCAR marker SCUBC191432. Pvr4 The co-separated marker is MY1421. However, all currently reported markers are related to... Pvr4Linked markers, which may segregate from the target gene due to genetic recombination, lead to reduced or even invalid selection efficiency in different genetic backgrounds. Although Venkatesh et al. (2018) have successfully cloned... Pvr4 Genes, and discovered their relationship with PVR7 Although they are the same gene, no reports have yet been published on developing functional molecular markers directly from the gene sequence that determines its resistance phenotype. Summary of the Invention

[0005] This invention provides a molecular marker for detecting the resistance PVR4 gene of potato virus Y in peppers and its application. This molecular marker can be used to detect the resistance PVR4 gene of potato virus Y in peppers and plays an important role in the breeding of disease-resistant pepper varieties.

[0006] The present invention adopts the following technical solution:

[0007] In a first aspect, the present invention provides a primer pair for detecting a molecular marker of the potato virus Y resistance gene PVR4, wherein the molecular marker is the 4714-4715 bp TC base of CM334 pepper with NCBI accession number KT359375.1; the primer pair includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2.

[0008] In a second aspect, the present invention provides a kit for detecting the PVR4 gene, a resistance gene of potato virus Y, wherein the kit includes the primer pair described in the first aspect.

[0009] Thirdly, the present invention provides the application of the above primer pairs and kits in detecting the PVR4 gene of potato virus Y resistance in peppers or in breeding disease-resistant pepper varieties.

[0010] Fourthly, the present invention provides a method for detecting the PVR4 gene, a resistance gene of potato virus Y, comprising the following steps:

[0011] S1. Extract genomic DNA from the peppers to be tested;

[0012] S2. Use the primer pairs or kits described above to perform PCR amplification of pepper genomic DNA;

[0013] S3. Electrophoretic analysis of PCR amplification products: If the target band is amplified, it is determined that the pepper to be tested carries the potato virus Y resistance PVR4 gene.

[0014] Fifthly, the present invention provides a method for breeding pepper varieties resistant to Potato Virus Y, comprising the following steps:

[0015] 1) Extract genomic DNA from the pepper plants to be selected;

[0016] 2) Use the primer pairs or kits described above to perform PCR amplification and detection of pepper genomic DNA;

[0017] 3) Select pepper plants that amplify the target band as pepper varieties resistant to Potato Virus Y.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] This invention utilizes the molecular marker TC (4714-4715 bp) of the CM334 pepper gene (NCBI accession number KT359375.1) as a base to develop primer pairs and a kit. The presence of the pepper-potato virus Y resistance gene PVR4 in pepper varieties can be detected simply by performing PCR using the primer pairs or kit. This invention offers reliable detection results, low cost, and high throughput, significantly improving breeding efficiency. Attached Figure Description

[0020] Figure 1 This image shows the alignment results of partial sequences of the PVR4 gene, a resistance gene to Potato Virus Y, in the semi-wild CM334 pepper, as well as the alleles in the annual peppers CA59, Zhangshugang pepper, and Zunla 1 pepper. Among them, PVR4-CM334 represents the semi-wild CM334, PVR4-ZSG represents the Zhangshugang pepper, PVR4-Zhunla 1 represents the Zunla 1 pepper, and PVR4-CA59 represents the annual pepper CA59. The red boxes indicate the bases that differ.

[0021] Figure 2 The image shows the results of a comparison of highly homologous sequences of the PVR4 gene, a resistance gene to Potato Virus Y, in the semi-wild CM334 chili pepper and the genome of the Zhangshugang chili pepper. The red boxes indicate the bases that are different.

[0022] Figure 3 The image shown is an electrophoresis diagram of the detection results in an embodiment of the present invention, wherein channels 1-11 represent the negative control, semi-wild CM334 chili pepper, Zhangshugang chili pepper, Zunla No. 1 chili pepper, annual chili pepper CA59, yellow lantern chili pepper Cc518, yellow lantern chili pepper Cc506, shrub-like chili pepper CF1, shrub-like chili pepper CF5, and berry chili pepper CB1 and berry chili pepper CB2, respectively. Detailed Implementation

[0023] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments are commercially available unless otherwise specified. Example 1

[0024] Molecular markers for detecting the PVR4 gene of resistance to potato virus Y and primer pairs applied to the molecular markers.

[0025] This invention compares the semi-wild CM334 chili pepper... Pvr4 The gene sequence (NCBI: KT359375.1) was compared with the homologous sequences of the annual cultivated varieties Zhangshugang pepper (NCBI: PRJNA800056; CM061608.1:207079145-207078840), Zunla No. 1 pepper (NCBI: PRJNA193077; Chr10:203844248-203843896), and CA59 pepper (NCBI:PRJNA788020; Ca_59Chr10:243963901-243963549). The alignment results are as follows: Figure 1 As shown, it was found in the semi-wild CM334 chili pepper. Pvr4 There is a five-base mismatch in the 4714-4718 bp region of the gene, which is related to the semi-wild CM334 pepper. Pvr4 The gene sequence is TCGGA, while the homologous sequence of other chili varieties is AACAG.

[0026] Further homology alignment was performed between the 4700-5060 bp region of the semi-wild CM334 pepper sequence (NCBI accession number KT359375.1) and the Zhangshugang genome, identifying 29 highly similar sequences. The alignment results are as follows: Figure 2 As shown, the analysis indicates that the semi-wild CM334 chili pepper... Pvr4 The two bases at positions 4714-4715 bp in the gene sequence are TC, which is specific, while the corresponding bases in Zhangshugang pepper are AA, GA, GG, or CA. Based on the difference between these two bases, this invention designs a method for specifically detecting potato virus Y resistance in peppers. Pvr4 The primer pair for the gene. The upstream primer Pvr4-SNP-1F has the sequence shown in SEQ ID NO.1; the downstream primer Pvr4-SNP-1R has the sequence shown in SEQ ID NO.2.

[0027] SEQ ID NO.1:TTCTTGTCCCAACCTGGAAAAGCTATATATCTATTC;

[0028] SEQ ID NO. 2: ATATCTTCATTTCAGGGCATTTACGAATCACCACTAATT. Example 2

[0029] This invention utilizes the primer pairs Pvr4-SNP-1F and Pvr4-SNP-1R described in Example 1 to detect the PVR4 gene, a resistance gene to potato virus Y, in chili peppers.

[0030] Genomic DNA of the peppers to be tested was extracted using the CTAB method. The extracted genomic DNA was then amplified by PCR using the primer pairs described above. The PCR reaction conditions are shown in Table 1, and the amounts of each substance used in the PCR reaction are shown in Table 2.

[0031] Table 1 PCR reaction conditions

[0032]

[0033] Table 2 Amounts of each substance used in the PCR reaction

[0034]

[0035] The PCR products were validated by agarose gel electrophoresis, and the results are as follows: Figure 3 As shown. Electrophoresis channels 1-11 represent the negative control, the semi-wild CM334 pepper, the annual pepper Zhangshugang pepper, Zunla No. 1 pepper, the annual pepper CA59, the yellow lantern pepper Cc518, the yellow lantern pepper Cc506, the shrub-like pepper CF1, the shrub-like pepper CF5, and the berry peppers CB1 and CB2, respectively. Among them, the semi-wild CM334 pepper is a semi-wild species containing the PVR4 gene, while the other pepper varieties do not contain the resistant PVR4 gene. The pepper varieties Zhangshugang, Zunla No. 1, and CA59 are germplasm resources with published genome sequencing; the yellow lantern peppers Cc518, Cc506, shrub-like peppers CF1, CF5, and berry peppers CB1 and CB2 are field-susceptible germplasm resources.

[0036] The primer pair amplified the expected band of 392 bp in the semi-wild CM334 pepper, but no target product was amplified in pepper varieties Zhangshugang, Zunla 1, and CA59, which do not contain the PVR4 gene. Further PCR detection in pepper varieties without the PVR4 gene—Huangdenglong pepper, shrub-like pepper, and Fengling pepper—showed no amplification of the target fragment by electrophoresis, proving that the primer pair designed in this invention can specifically amplify the target fragment. Pvr4 Gene fragments were used to rapidly detect the presence of the potato virus Y resistance gene PVR4 in chili peppers. Example 3

[0037] Using the molecular markers and primer pairs described in Example 1, and employing the PCR reaction conditions and amounts of each PCR substance described in Example 2, the presence of the potato virus Y resistance gene PVR4 in chili pepper varieties was detected and analyzed. The experimental materials included 272 chili pepper germplasm resources, specifically: wild chili peppers (8 accessions), annual chili peppers (138 accessions), yellow lantern chili peppers (46 accessions), shrub-like chili peppers (71 accessions), and berry chili peppers (9 accessions). The specific results are shown in Table 3. The presence of PCR amplification products indicated the presence of the PVR4 gene in the germplasm resources; the absence of these products indicated the absence of the PVR4 gene.

[0038] No germplasm resources containing the PVR4 gene were detected in wild chili peppers, yellow lantern chili peppers, and berry chili peppers, while 32 and 3 accessions containing the PVR4 gene were detected in annual chili peppers and shrub-like chili peppers, respectively.

[0039] Table 3. Identification of PVR4 resistance gene in 272 germplasm resources

[0040]

[0041]

[0042]

[0043]

[0044] In summary, this invention provides a molecular marker for detecting the potato virus Y resistance PVR4 gene and its application, and has developed corresponding primer pairs and kits, which can be used for rapid, efficient and accurate detection of the presence of the potato virus Y resistance PVR4 gene in peppers, and can also be used for molecular marker-assisted selection breeding.

[0045] It should be noted that various improvements and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, which will be obvious to those skilled in the art. Other embodiments derived from this specification will be readily apparent to those skilled in the art. This application specification and embodiments are merely exemplary.

Claims

1. A set of primer pairs for detecting molecular markers for use in detecting the PVR4 gene for resistance to Potato virus Y in Capsicum, characterized in that, The molecular marker is the 4714-4715 bp TC base of CM334 chili pepper with NCBI accession number KT359375.1; the primer pair includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

2.

2. Use of a kit containing a pair of primers with a detection molecular marker for detecting the PVR4 gene of resistance to pepper potyvirus, characterized in that, The molecular marker is the 4714-4715 bp TC base of CM334 chili pepper with NCBI accession number KT359375.1; the primer pair includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2.

Images