Applications of SFMBT2 gene and bromocriptine in repairing damaged cartilage and preventing osteoarthritis

By using an SMBT2 overexpression vector and ligands targeting SMBT2, such as bromocriptine, the problem of cartilage structure damage in osteoarthritis was addressed, thereby activating chondrocyte activity and repairing damage, and delaying disease progression.

CN122075697APending Publication Date: 2026-05-26XI AN JIAOTONG UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202610201085.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-11
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively prevent and treat osteoarthritis, especially osteoarthritis progression caused by cartilage structure damage and matrix loss, and there is a lack of targeted drugs and molecular therapies targeting the SFBBT2 gene.

Method used

Using an SMBT2 overexpression vector and a ligand targeting SMBT2, such as bromocriptine, chondrocyte activity can be activated, osteophyte formation can be inhibited, PI3K/AKT signaling activity can be regulated, the expression of the pro-inflammatory gene ATF3 can be suppressed, and cartilage damage repair can be promoted through local injection into the joint or oral administration.

Benefits of technology

It significantly activates chondrocyte activity, improves articular cartilage damage, slows the progression of osteoarthritis, promotes cartilage matrix synthesis and inhibits degradation, and provides an effective drug reference for the prevention and treatment of osteoarthritis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention discloses SFMBT2 The application of genes and bromocriptine in repairing damaged cartilage and preventing osteoarthritis. Experiments have found that the gene expressed in chondrocytes... SFMBT2 The gene helps maintain the normal phenotype of chondrocytes and can mediate the axial regulation of downstream ATF3-PI3K / AKT signaling. Cartilage tissue-specific knockout mice of this gene exhibit a significant spontaneous osteoarthritis phenotype and exacerbate the progression of DMM surgery-induced PTOA. Gene complementation targeting SMBT2 can significantly activate chondrocyte activity. Among various small molecule drugs targeting SMBT2 protein predicted using docking models, bromocriptine can significantly promote the repair of damaged cartilage by activating the biological function of chondrocytes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of cartilage protection-related gene mining and medical technology, and relates to... SFMBT2 Application of gene therapy drugs targeting SMBT2 and small molecule drugs targeting SMBT2 in the prevention and treatment of osteoarthritis. Background Technology

[0002] Osteoarthritis (OA), a common degenerative disease, is a major form of joint disease in the elderly, including traumatic osteoarthritis (PTOA). The progression of OA imposes a significant and ever-increasing health burden on the affected joints. Given the long-term and widespread nature of OA and its severe impact on daily activities and quality of life, the development of more effective clinical drugs is urgently needed.

[0003] Existing research indicates that cartilage structure damage and matrix loss are the most fundamental causes of knee osteoarthritis (OA). The key to its pathogenesis lies in the dysregulation of normal chondrocyte biological behavior, leading to a disruption of the dynamic balance of the extracellular matrix (ECM). By exploring the pathogenesis of OA, we can attempt to prevent the disease by addressing key pathogenic genes or their encoded proteins, or to halt disease progression by alleviating and repairing pathological damage to cartilage tissue. For example, CN118634331A identifies FSCN1 protein as a therapeutic target for osteoarthritis and validates the role of FSCN1 inhibitors in improving osteoarthritis.

[0004] As an important member of the polycomb group (PcG) protein complex, Scm-like protein 2 (SFMBT2), containing four MBT domains, has an extremely conserved domain composition, suggesting its potentially important biological functions. However, previous studies have mostly reported on... SFMBT2 Of the ncRNAs encoded by the gene (including Sfmbt2-miRNA cluster, circRNA-SFMBT2 and lncRNA-SFMBT2), only a few have focused on the function of the SFBTT2 protein itself, and even those have mostly been limited to observational phenomena.

[0005] Bromocriptine can be used to treat Parkinson's disease (PD). Although PD may be accompanied by rheumatism and osteoarthritis, the development of related drugs is still mainly aimed at treating the motor symptoms of PD. Summary of the Invention

[0006] The purpose of this invention is to provideSFMBT2 The application of genes and bromocriptine in repairing damaged cartilage and preventing osteoarthritis.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: Firstly, it provides the use of the SMBT2 overexpression vector in the preparation of drugs for the prevention and / or treatment of osteoarthritis.

[0008] Preferably, the osteoarthritis is any one of spontaneous osteoarthritis, traumatic osteoarthritis, etc.

[0009] Preferably, the drug is administered via local injection into the joint (i.e., the drug can be in the form of an injection).

[0010] Preferably, the drug can activate chondrocyte activity and improve articular cartilage damage (such as cartilage structure damage in an inflammatory state), thereby delaying the progression of osteoarthritis.

[0011] Preferably, the drug can also inhibit osteophyte formation.

[0012] Secondly, it provides the application of the SFMBT2 overexpression vector in the preparation of drugs for promoting cartilage damage repair.

[0013] Thirdly, it provides an SFMBT2 overexpression vector for the preparation of a gene to inhibit pro-inflammatory genes in chondrocytes. ATF3 Application of expression levels in drugs.

[0014] Fourthly, the application of the SFMBT2 overexpression vector in the preparation of drugs for regulating PI3K / AKT signaling activity in chondrocytes is provided.

[0015] Fifthly, it provides the use of ligands targeting SMBT2 in the preparation of drugs for the prevention and / or treatment of osteoarthritis.

[0016] Preferably, the osteoarthritis is any one of spontaneous osteoarthritis, traumatic osteoarthritis, etc.

[0017] Preferably, the ligand is any one of bromocriptine, hydrocortisone cyclovalerate, dihydroergonovine, carmatinib, and digitoxin.

[0018] Preferably, the bromocriptine alleviates the inflammatory state of chondrocytes.

[0019] Preferably, the bromocriptine exerts its therapeutic effect on osteoarthritis in a SMBT2-dependent manner (e.g., in combination with an SMBT2 overexpression vector administered locally to the joint).

[0020] Preferably, the oral dose of bromocriptine is ≥48.4 mg / kg (calculated based on the body surface area of ​​a 60 kg human based on a mouse weight of ≥10 μg / g).

[0021] Sixthly, the use of SMBT2 agonists in the preparation of medicaments for the prevention and / or treatment of osteoarthritis is provided.

[0022] Preferably, the agonist is bromocriptine.

[0023] Seventhly, a method for constructing an animal model of osteoarthritis is provided, comprising the following steps: For laboratory animals (e.g., mice) Sfmbt2 The gene was knocked out in a tissue-specific manner, and the tissue in question was cartilage.

[0024] Preferably, the knockout is induced by a drug (e.g., Tamoxifen).

[0025] Preferably, the osteoarthritis is spontaneous osteoarthritis.

[0026] The beneficial effects of this invention are reflected in: This invention is based on the discovery SFMBT2 The protective effects of genes on cartilage include: SFMBT2 expression in chondrocytes helps maintain the normal phenotype of chondrocytes; gene complementation targeting SFMBT2 can significantly activate chondrocyte activity, promoting cartilage matrix synthesis while inhibiting catabolism; [further details needed]. SFMBT2 The specific applications of genes in the prevention and treatment of osteoarthritis provide an important reference for the development of gene-based drugs for the prevention and treatment of osteoarthritis, and have good application potential and value.

[0027] This invention expands the understanding of downstream ATF3-PI3K / AKT signaling by exploring the axial regulation mediated by SFMBT2 (and discovering that the aforementioned biological effects of SFMBT2 depend on its regulation of downstream ATF3-PI3K / AKT signaling). SFMBT2 Genes suppressing pro-inflammatory genes ATF3 It is used in drugs related to anti-inflammatory effects (especially in alleviating chondrocyte inflammation), such as expression level and regulation of PI3K / AKT signaling in chondrocytes.

[0028] Based on the two ligand binding pockets in the protein structure of SMBT2, this invention, combined with molecular docking models and cell experiments, screened and obtained small molecule ligand drugs that can target SMBT2 and activate the biological functions of chondrocytes (among which bromocriptine has a significant effect on promoting matrix synthesis and inhibiting matrix degradation in chondrocytes, and can significantly promote the repair of damaged cartilage).

[0029] This invention is based on the mouse cartilage tissue-specific knockout discovered in experiments. Sfmbt2 The fact that the gene causes a distinct spontaneous osteoarthritis phenotype and exacerbates the progression of DMM surgery-induced traumatic osteoarthritis suggests a method for stably obtaining animal models of osteoarthritis. Attached Figure Description

[0030] Figure 1-1 for SFMBT2 Effects of gene knockdown on expression levels of genes related to chondrocyte matrix metabolism (left side: Western blotting image; right side: normalized statistical plot; one asterisk represents...) P <0.05, each scatter point represents a biological replicate.

[0031] Figure 1-2 for SFMBT2 The effect of high gene expression on the expression levels of genes related to chondrocyte matrix metabolism (left side: Western blotting image; right side: normalized statistical plot; one asterisk represents...) P <0.05, each scatter point represents a biological replicate.

[0032] Figure 2-1 for SFMBT2 Effects of gene knockdown on chondrocyte matrix metabolism and cartilage development-related signaling pathways.

[0033] Figure 2-2 for SFMBT2 Effects of high gene expression on chondrocyte matrix metabolism and cartilage development-related signaling pathways.

[0034] Figure 3-1 Spontaneous OA characteristics appearing in CKO mice after tamoxifen-induced gene knockout (one asterisk represents...) P <0.05, two asterisks represent P <0.01, where ns represents no statistically significant difference.

[0035] Figure 3-2 The exacerbation of OA phenotype in Tamoxifen-induced cartilage-specific knockout CKO mice after establishing a DMM model (one asterisk indicates...) P <0.05, two asterisks represent P <0.01, P A value ≥ 0.05 indicates that there is no statistically significant difference.

[0036] Figure 4-1 The therapeutic effect of SMBT2 reinjection in the knee joint of DMM mice (one asterisk represents...) P<0.05, two asterisks represent P <0.01, P A value ≥ 0.05 indicates that there is no statistically significant difference.

[0037] Figure 4-2 The therapeutic effect of reintroducing SMBT2 after IL-1β treatment of human cartilage explants (one asterisk represents...) P <0.05, two asterisks represent P <0.01, three asterisks represent P <0.001).

[0038] Figure 5 For chondrocytes SFMBT2 Genes on downstream ATF3 The regulatory role of genes in protein expression levels (one asterisk represents...) P <0.05, three asterisks represent P <0.001 (unmarked indicates no statistically significant difference).

[0039] Figure 6 for SFMBT2 The regulatory role of genes on the ATF3-PI3K / AKT signaling axis (one asterisk represents...) P <0.05, two asterisks represent P <0.01, three asterisks represent P <0.001 (unmarked indicates no statistically significant difference).

[0040] Figure 7-1 This is a schematic diagram of the ligand binding pocket of SFMBT2.

[0041] Figure 7-2 Preliminary screening results for potential OA treatments that interact with the SFMBT2 ligand binding pocket (one asterisk indicates...) P <0.05, two asterisks represent P <0.01, three asterisks represent P <0.001 (unmarked indicates no statistically significant difference).

[0042] Figure 8-1 This is a molecular docking model for SFMBT2 and bromocriptine.

[0043] Figure 8-2 The intervention effect of bromocriptine on a chondrocyte inflammation model (one asterisk represents...) P <0.05, two asterisks represent P <0.01, three asterisks represent P <0.001, not marked or PA value ≥ 0.05 indicates that there is no statistically significant difference.

[0044] Figure 9-1 This serves as a molecular docking model for SFMBT2 with hydrocortisone cyclopentanoate, dihydroergonovine, carmatinib, or digitoxin.

[0045] Figure 9-2 The effects of hydrocortisone cyclopentarate, dihydroergonovine, carmatinib, or digitoxin on a chondrocyte inflammation model (one asterisk represents...). P <0.05, two asterisks represent P <0.01, where ns represents no statistically significant difference.

[0046] Figure 10 The therapeutic effect of bromocriptine on DMM mice (one asterisk represents...) P <0.05, two asterisks represent P <0.01, not marked or P A value ≥ 0.05 indicates that there is no statistically significant difference. Detailed Implementation

[0047] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. The embodiments are explanations of the present invention and not limitations on the scope of protection of the present invention.

[0048] Given that altered chondrocyte biological function and metabolic homeostasis imbalance of the cartilage ECM are the primary causes and manifestations of OA progression, previous analyses and targeted interventions targeting key pathogenic molecules in early and mid-stage OA yielded relatively effective and significant results. For example, studies showed that compared to normal human cartilage tissue, SFMBT2 expression was reduced in the cartilage of OA patients (negatively correlated with OA progression), and high levels of SFMBT2 contribute to chondrocyte proliferation phenotype. Therefore, subsequent in-depth research focused on inhibiting cartilage ECM degradation and promoting matrix synthesis during OA progression, exploring... SFMBT2 The high expression of the gene plays an important role in reversing the dysregulated molecular pathways in the progression of OA, promoting the maintenance of normal biological function of chondrocytes, and exerting corresponding transcriptional repression function in chondrocytes. At the same time, candidate drugs that target the SFMBT2 protein and are expected to be used in the clinical treatment of OA are also explored, as detailed below.

[0049] SPSS 22.0 software was used to perform statistical analysis on the data, and GraphPad 6.0 software was used to create the corresponding statistical charts.

[0050] 1. In vitro intervention SFMBT2 Effects of genes on chondrocyte matrix metabolism characterization 1.1 Isolation and inoculation of human primary chondrocytes 3-5g of smooth femoral condyle cartilage tissue was harvested from patients with osteoarthritis (OA) after joint replacement surgery (the sampling process was approved by the hospital's ethics committee). The tissue specimen was rinsed three times with pre-cooled sterile 1×PBS in a biosafety cabinet after 30 minutes of pre-ultraviolet irradiation. Then, using sterile surgical instruments, the synovium, osteophytes, hyperplastic connective tissue, fat, and other attached tissues around the specimen were removed. The tissue specimen was rinsed once more with pre-cooled sterile 1×PBS.

[0051] Cut the isolated smooth cartilage tissue into uniformly sized pieces, transfer to a new sterile culture dish, and aspirate the liquid. Rinse the chopped tissue pieces again with pre-cooled sterile 1×PBS, aspirate the liquid, and add freshly prepared high-concentration collagenase II digestion solution (25 mg / mL, dissolved in sterile DMEM / F12 basal medium) at 37°C until the tissue pieces are submerged. Incubate the culture dish in a 37°C cell culture incubator (5% CO2) for 30 min, aspirate the liquid, and repeat this digestion step once.

[0052] Add preheated (37°C) low-concentration collagenase II digestion solution (5 mg / mL, dissolved in sterile DMEM / F12 basal medium) to the culture dish until the tissue block is submerged. Incubate the culture dish in a 37°C cell culture incubator (5% CO2) for 6–12 h. Filter all digestion products through a 100 μm cell filter into sterile 50 mL centrifuge tubes. Rinse the culture dish with sterile 1×PBS and sieve again. (During low-concentration collagenase digestion, vacuolated chondrocytes can be observed under a light microscope as they gradually become free from the cartilage tissue block. This step can be repeated multiple times to reduce damage to chondrocytes due to prolonged digestion time. Replace with fresh low-concentration collagenase II digestion solution to improve the yield of primary chondrocytes.)

[0053] Centrifuge all collected filtrates at 1000 rpm for 5 min at room temperature and discard the supernatant. Resuspend the pellet in 10 mL of freshly prepared sterile DMEM / F12 complete medium (to ensure primary cell viability, the serum content in the medium used in this step can be increased to 15%) and transfer to sterile 10 cm cell culture dishes. Incubate the dishes in a cell culture incubator at 37°C (5% CO2). Observe under a microscope until the cells are fully adhered, then change the medium (approximately 1.5–2 days). Continue culturing, changing the medium every 2 days. When the cells are almost confluent, subsequent treatments can be performed.

[0054] 1.2 siRNA transfection and adenovirus infection Knockdown was achieved by transfecting human primary chondrocytes with small interfering RNA (siRNA) in vitro. SFMBT2 The siRNA used for gene transfection was synthesized by Shanghai Sangon Biotech Co., Ltd. (for knockdown). SFMBT2 The gene's siRNA is denoted as si-SFMBT2; target transcript: NM_001018039.1; sense: AUAUAUAAUCCAACAUUUGCC, anti-sense: CAAAUGUUGGAUUAUAUAUCA), and the transfection reagent used is Lipofectamine 2000. The specific transfection steps are as follows: [Instructions for transfection are missing from the original text]. 4 Primary chondrocytes were seeded into 6-well plates, and complete culture medium was added to a final volume of 2 mL. The plates were then incubated in a cell culture incubator until cell adhesion was achieved. siRNA was dissolved in 1 OD / 125 μL ddH2O. Transfection reagent and siRNA working solutions were prepared separately using culture medium at a 1:1 ratio, with a final siRNA volume of 6 μL per well. After loading samples into all wells, the cell culture plates were gently shaken using a horizontal cross-rotation method and incubated at 37°C (5% CO2) for 6 h. The original culture medium was then discarded and replaced with complete culture medium for further incubation. A control group was also included, transfected with negative control siRNA (denoted as si-NC). Timing was initiated at the start of transfection. Total RNA was collected 24 h after transfection, and total protein was collected 48 h after transfection to complete subsequent experiments.

[0055] Using a recombinant adenovirus vector and infecting human primary chondrocytes for treatment SFMBT2 Transient high expression of genes, infection with high-expressing human cells SFMBT2 The recombinant adenovirus vector (denoted as ad-SFMBT2) of the gene (transcript: NM_001018039.1) was constructed by Shanghai Hanheng Biotechnology Co., Ltd. The specific infection steps are as follows: at 10 × 10⁻⁶... 4Primary chondrocytes were seeded into 6-well plates, and complete culture medium was added to a final volume of 2 mL. The plates were then incubated in a cell culture incubator. After cell plating and adhesion, the original culture medium was discarded, and the plates were gently washed with sterile 1×PBS to remove any residual medium. 1 mL of DMEM / F12 basal medium was added. The actual volume of adenovirus solution used was calculated based on the adenovirus titer and the number of cells to be infected. The corresponding volume of adenovirus solution was added to each well. After all wells had been loaded, the cell culture plate was gently shaken using a horizontal cross-rotation method and incubated at 37°C (5% CO2) for 6 h. The original culture medium was then discarded, and the plate was replaced with complete culture medium for further incubation. A control group infected with an empty vector virus (denoted as ad-GFP) was also included. Starting from the time of adenovirus addition, total RNA was collected 24 h after the addition of adenovirus, and total protein was collected 48 h after the addition of adenovirus to complete subsequent experiments.

[0056] 1.3 Total protein extraction, BCA quantification, and Western blotting After completing the appropriate cell treatment procedures (specifically, 48 hours after transfection or infection), discard the culture medium and gently rinse the cell culture plate twice with sterile 1× PBS. After discarding the residual PBS, add an appropriate amount of pre-chilled fresh RIPA protein lysis working solution (containing 1% PMSF and 1% protease / phosphatase inhibitors). On ice, gently and repeatedly scrape the bottom of the culture vessel with a cell scraper to ensure complete cell detachment. Then, transfer all liquid to pre-chilled sterile 1.5 mL centrifuge tubes and centrifuge at 4°C and 12000 rpm for 15 min. Transfer the supernatant to a new 1.5 mL centrifuge tube.

[0057] The concentration of the extracted protein samples was quantitatively analyzed using the BCA Protein Quantification Kit (Solepro PC0020). The specific steps are as follows: Add 20 μL of standard protein samples of different concentrations provided in the kit to a clean 96-well plate, and then pipette 5–20 μL (adjust according to the abundance of the protein sample to be tested, ensuring a final volume of 20 μL) of the supernatant of the protein to be tested into the same 96-well plate. Prepare the chromogenic working solution according to the kit instructions. Add 200 μL of the freshly prepared chromogenic working solution to the protein standards and the protein samples to be tested in the 96-well plate, mix well, and incubate at 37°C for 30 min. After the 96-well plate returns to room temperature, use a microplate reader to detect the absorbance of the standard protein samples at a wavelength of 562 nm and plot a standard curve. Then, detect the absorbance of the protein samples to be tested, and calculate the protein concentration of the corresponding samples based on the standard curve.

[0058] The expression and content of target proteins were detected by Western blotting. The experimental procedure included SDS-PAGE gel preparation, loading of total cell protein, electrophoresis, transfer, blocking, antibody incubation, and ECL development. 12.5% ​​gel was used for the separation of 10–50 kDa proteins, and 10% gel was used for the separation of 30–120 kDa proteins. The following antibodies were used for incubation: primary antibody for COL2A1 detection (Immunoway YT1022), primary antibody for ACAN detection (Abcamab3778), primary antibody for COL10A1 detection (Proteintech 26984-1-AP), primary antibody for MMP3 detection (Immunoway YT4465), primary antibody for MMP13 detection (Immunoway YT2796), primary antibody for ADAMTS4 detection (Proteintech 11865-1-AP), and primary antibody for ADAMTS5 detection (Abcamab3778). The primary antibody for detecting GAPDH (ab41037) was Proteintech 60004-1-IG, and the secondary antibody (Immunoway RS0011) was used. Exposure detection and image acquisition were then performed using a chemiluminescence imaging system. The gray values ​​of the corresponding bands in the exposed images were calculated using ImageJ software. After normalizing the gray values ​​of protein expression in the control group, the relative expression level of the target protein was calculated using GAPDH as an internal reference. The obtained data were used for subsequent statistical analysis.

[0059] 1.4 Explanation of the results The results are as follows Figure 1-1 , Figure 1-2 As shown in the results, transfection into human primary chondrocytes for knockdown is effective. SFMBT2 Following siRNA administration of the gene, the expression of cartilage matrix synthesis-related proteins such as COL2A1 and ACAN significantly decreased, while the expression of catabolic enzymes such as MMP13 and ADAMTS5 significantly increased, indicating that cartilage matrix synthesis was significantly inhibited while cartilage matrix degradation was significantly promoted. When human primary chondrocytes were infected with this gene, the expression of high-expression proteins was significantly increased. SFMBT2 Following adenovirus administration of the gene, cartilage matrix synthesis was significantly promoted, while cartilage matrix degradation was effectively inhibited.

[0060] 2. In vitro intervention SFMBT2 Influence of genes on chondrocyte matrix metabolism and cartilage development-related signaling pathways 2.1 Isolation, Culture, and Processing of Primary Human Chondrocytes For details on the isolation, inoculation, siRNA transfection, and adenovirus infection of human primary chondrocytes, please refer to sections 1.1 and 1.2 above.

[0061] 2.2 Total RNA extraction, transcriptome sequencing, differentially expressed gene screening and enrichment analysis After completing the cell treatment (specifically, 24 hours after transfection or infection), add 1 mL of TRIGene lysis buffer (GenStar) to each well of a 6-well plate, incubate on ice for approximately 10 min to ensure complete lysis, and then transfer to a 1.5 mL centrifuge tube. Subsequent RNA extraction and purification were performed according to the instructions for the StarPure RNA Extraction Kit (GenStar). After elution, the purified RNA solution was obtained, and its purity and concentration were determined.

[0062] After obtaining total RNA, Shanghai Sangon Biotech Co., Ltd. was commissioned to perform RNA sequencing analysis using a NovaSeq 6000 sequencer (Illumina). The reference genome was human GRCh38 / hg38. The screening threshold for differentially expressed genes (DEGs) was as follows: adj.P <0.05 and |log2FC|>0.58. Gene ontology (GO) and Kyoto encyclopedia of genes and genomes (KEGG, https: / / www.genome.jp / kegg) enrichment analyses of DEGs were performed using the database for annotation visualization and integrated discovery (DAVID, https: / / david.ncifcrf.gov).

[0063] 2.3 Explanation of Results The results are as follows Figure 2-1 , Figure 2-2 As shown, for intervention SFMBT2 GO and KEGG enrichment analyses of differentially expressed genes (DEGs) following gene expression showed that SFMBT2 Gene knockdown downregulates multiple biological processes, including extracellular matrix organization, cartilage development, skeletal morphogenesis, extracellular matrix-receptor interactions, and the PI3K / AKT signaling pathway; conversely, SFMBT2 Gene overexpression upregulated these pathways. These results demonstrate SFMBT2 Gene expression plays a crucial role in maintaining the normal phenotype of chondrocytes.

[0064] 3. Cartilage tissue-specific knockout Sfmbt2The relationship between genes and cartilage damage and their impact on the degree of cartilage damage 3.1 Construction of Tamoxifen-induced cartilage tissue-specific conditional knockout mice and DMM model The strategy for constructing the cartilage tissue-specific conditional knockout mouse adopted Cre / loxp The first step of this strategy is to construct separately. Sfmbt2 loxp / - mice and Col2a1-CreERT2 Mice (these two transgenic mice were developed by Shanghai Southern Model Biotechnology Co., Ltd.) were hybridized and their offspring were screened for genotypes of "". Sfmbt2 loxp / loxp ; Col2a1- CreERT2 + The knockout of mice was achieved. Among them... Sfmbt2 loxp / - Mice were housed together at 8 weeks of age, and after multiple rounds of hybridization and selection, two homologous chromosomes were obtained that were inserted into the mice. loxp The S sequence is stable and can be inherited. fmbt2 loxp / loxp Genotype mice, and compared with Col2a1-CreERT2 Mouse hybrids were then subjected to multiple rounds of selection to ultimately obtain a genotype of "". Sfmbt2 loxp / loxp ; Col2a1-CreERT2 + The target mice (hereinafter referred to as CKO mice) have the genotype " Sfmbt2 loxp / loxp ; Col2a1- CreERT2 - The littermates of the mice (hereinafter referred to as WT mice) were used as control experiments. The following steps were used for cartilage-specific knockout in adult CKO mice: 8-week-old male CKO mice with good growth and uniform weight were taken and injected intraperitoneally with Tamoxifen solution (75 μg / g mouse body weight, dissolved in sterile corn oil) for 5 consecutive days. After 2 days, if no abnormalities were observed, subsequent treatment could be carried out.

[0065] The specific steps for constructing the DMM model are as follows (using the WT mice mentioned above as an example, the procedure is the same for CKO mice after induced gene knockout): Ten-week-old male mice were randomly divided into a sham-operated group (Sham) and a model group (DMM). Anesthesia was achieved by intraperitoneal injection of sodium pentobarbital solution (60 μg / g mouse body weight, dissolved in sterile saline). After preparing the skin of the right knee joint using sterile instruments, the mice were fixed in a supine position with the knee slightly flexed. Under a stereomicroscope, a sterile No. 11 scalpel blade was used to incise the skin tissue from the medial side of the patellar ligament. The medial meniscus and its associated ligaments were then visible after slightly separating the patellar ligament with the blade tip. The ligaments connecting the meniscus were cut by gently rotating the blade tip, and the wound was surgically sutured. The wound was disinfected by wiping with povidone-iodine. Surgical procedures in the Sham group mice were stopped immediately after incising the skin tissue on the medial side of the patellar ligament. All surgical procedures were performed in a clean bench that had been pre-irradiated with ultraviolet light for 30 minutes. After the surgery, the mice were returned to their original cages. One hour later, the mice were observed to see if they had woken up and their activity level was normal. Once the mice were fully awake and their behavior was normal, they were kept in their original cages to ensure a stable environment. The mice were observed regularly.

[0066] Eight weeks after surgical modeling, all mice were euthanized by cervical dislocation. The skin of the mouse legs was incised in a laminar flow hood pre-irradiated with ultraviolet light for 30 min, and the femur / tibia and fibula were shortened 0.5 cm above and below the knee joint. The tissue specimens were rinsed three times with pre-cooled sterile 1×PBS, and then excess muscle and connective tissue around the knee joint were removed, avoiding contact with the joint cavity. The tissue specimens were rinsed once more with pre-cooled sterile 1×PBS, and the mouse knee joint tissue containing the intact joint cavity was immersed in tissue fixation solution and fixed at room temperature for 48 h.

[0067] 3.2 Micro-CT scan and three-dimensional reconstruction of mouse knee joint tissue The above-mentioned fixed mouse knee joint tissue samples were subjected to micro-CT scanning using a SkyScan 1276 system (Bruker). The scanning parameters were: scanning precision 6 μm, voltage 60 kV, and current 200 μA. After scanning, the corresponding data were read and three-dimensional reconstruction was performed using DataViewer software (v.1.5.6 Bruker). The three-dimensional reconstructed knee joint was visualized using CTVox software (v.3.3.0 Bruker), and the subchondral bone microstructure was analyzed using CTAn software (v.1.17.7 Bruker), and an osteophyte size score was calculated. The obtained data were used for subsequent statistical analysis.

[0068] 3.3 Decalcification, paraffin embedding, sectioning, histological staining, and immunohistochemical (IHC) development of mouse knee joint tissue The fixed mouse knee joint tissue samples were immersed in 12.5% ​​EDTA decalcification solution and placed in a 37°C constant temperature horizontal shaker for decalcification. The decalcification solution was changed every 2 days, and the degree of tissue decalcification was assessed using a needle prick test. After decalcification, the specimens were dehydrated with graded alcohols, then treated with soft and hard wax before embedding to obtain long-term preserved paraffin blocks. The edges of the paraffin blocks were trimmed, and the tissue was sectioned into 5 μm thick sections (coronal sections) using a paraffin microtome.

[0069] Histological staining of paraffin sections was performed using a modified Safranin O-Fixed Green staining kit (Solepro). All staining procedures were performed in a fume hood, and the specific steps were followed according to the kit's instruction manual. After staining, the paraffin sections were allowed to air dry before being observed under an optical microscope and photographed for preservation. Pathological scoring of the paraffin sections was performed according to the standards set by the International Osteoarthritis Association. Osteoarthritis and Cartilage The OARSI scoring criteria published in the journal were used, and the data obtained were used for subsequent statistical analysis.

[0070] IHC staining was performed using the SABC method, with some reagents being commercially available ready-to-use SABC immunohistochemistry kits (Boster SA1050). Paraffin sections underwent dewaxing and hydration, section pretreatment, blocking, antibody incubation, DAB staining, and mounting. The dried sections were observed and photographed under an optical microscope. Image ProPlus 6.0 software was then used to obtain the cumulative optical density (IOD; representing the sum of the intensities of all selected objects in the entire field of view) of five randomly selected images at 20x magnification from sections of the same sample. The average value was recorded as the tissue expression level of the target protein in that sample, and the data were used for subsequent statistical analysis.

[0071] 3.4 Explanation of Results See Figure 3-1 Compared to WT mice, CKO mice showed lighter Safranin O staining in the knee cartilage after Tamoxifen-induced gene knockout, with varying degrees of damage to the cartilage surface. OARSI scores indicated increased knee joint damage and a rising trend in osteophyte scores after gene knockout. Simultaneously, while SMBT2 expression significantly decreased due to gene knockout, COL2A1 expression significantly decreased and MMP13 expression significantly increased, but micro-CT scans and 3D reconstructions did not show significant osteophyte formation. These results demonstrate that cartilage tissue-specific knockout... Sfmbt2 Genetic damage can lead to articular cartilage injury and spontaneous osteoarthritis (OA).

[0072] See Figure 3-2 Compared with WT mice treated with DMM surgery alone and CKO mice with cartilage-specific knockout alone (the latter undergoing sham surgery), the combined treatment of cartilage-specific knockout and DMM surgery resulted in more severe cartilage pathological damage, paler Safranin O staining, thinner cartilage layer, and further elevated OARSI scores in CKO mice, accompanied by more severe osteophyte scores. Simultaneously, the combined treatment of cartilage-specific knockout and DMM surgery led to lower COL2A1 and higher MMP13 expression levels. Furthermore, in CKO mice, despite both WT mice and WT mice treated with DMM surgery alone exhibiting significant OA-like lesions, the combined treatment resulted in more new osteophytes compared to the latter. These results demonstrate that cartilage-specific knockout... Sfmbt2 Genetic factors exacerbate articular cartilage damage induced by DMM surgery and worsen OA.

[0073] 4. Therapeutic effects of gene complementation targeting SFMBT2 4.1 Construction of mouse DMM model For details of this procedure, please refer to section 3.1 above. Ten-week-old male wild-type C57BL / 6J mice were selected for the experiment.

[0074] 4.2 Gene complementation targeting SFMBT2 in a mouse DMM model Two weeks after surgical modeling, recombinant adeno-associated virus (AAV) vector was injected intra-articularly into the cartilage of the mouse knee joint to achieve the effect of […]. Sfmbt2 The specific steps for gene restoration are as follows: using mice from the NCBI Gene database... Sfmbt2 Using the gene transcript (NM_177386.5) as the target gene, Shanghai Hanheng Biotechnology Co., Ltd. was commissioned to construct mice that highly express this gene. Sfmbt2 Recombinant AAV vector of genes (denoted as AAV-) Sfmbt2 After anesthetizing the infected mice with sodium pentobarbital solution (60 μg / g mouse body weight, dissolved in sterile saline), the surgically prepared knee joint area was prepared, and the patellar ligament was located by slightly bending the knee joint (the white strip parallel to the long axis of the lower limb visible under the skin is the patellar ligament). Then, 10 μL of AAV solution (AAV viral titer of 1.3 × 10⁻⁶) was drawn using a clean 0.3 mL insulin syringe. 12The syringe (containing 1 × PBS) was inserted perpendicularly to the patellar ligament into the knee joint space, and the virus solution was slowly injected. After standing for 3-5 seconds, the syringe needle was removed, and the injection site was wiped clean with an alcohol swab. After all injection procedures were completed, the mice were returned to their original cages, and their condition was monitored and recorded in real time after they recovered. For mice that underwent surgical modeling and sham surgery, a control group transfected with empty vector virus (denoted as AAV-Control) was set up. Eight weeks after injection, all mice were sacrificed, and their knee joints were collected for subsequent experiments.

[0075] 4.3 Micro-CT scanning and three-dimensional reconstruction of mouse knee joint, tissue decalcification, paraffin embedding, sectioning, histological staining, and immunohistochemical staining. For details of this procedure, please refer to sections 3.2 and 3.3 above. In addition to obtaining osteophyte scores, bone mineral density (BMD) and trabecular thickness were also measured.

[0076] 4.4 Isolation and Culture of Human Cartilage Explants Following the procedure outlined in 1.1 above, smooth femoral condyle tissue was obtained from OA patients. Multiple tissue blocks, extending from the cartilage surface to the subchondral bone, were continuously longitudinally excised from areas with uniform cartilage matrix thickness and relatively smooth cartilage surfaces using sterile instruments along the central portion. After trimming any burrs or uneven areas at the edges of the tissue blocks, they were rinsed once with sterile 2 × PBS. Two tissue blocks were placed in each well of a 24-well cell culture plate, and 2 mL of DMEM / F12 complete medium was added to each well to ensure complete immersion. The cell culture plate was placed in a 37°C cell culture incubator (5% CO2) for 2 days of acclimatization. The medium was then replaced with DMEM / F12 complete medium containing IL-1β (10 ng / mL) and cultured continuously for 14 days, with the medium changed every 2 days. A control group was also established, using IL-1β-free medium throughout. After the culture was completed, the old culture medium was discarded, and the tissue blocks were rinsed once with sterile 1 × PBS. The tissue blocks were then transferred to tissue fixative for 48 h for fixation.

[0077] 4.5 Gene complementation targeting SFMBT2 in human cartilage explants Gene replacement was performed on human cartilage explants using a recombinant adenovirus vector. The source of the recombinant adenovirus vector is detailed in section 1.2 above. The specific steps are as follows: After culturing human cartilage explants (tissue blocks) that had undergone 2 days of adaptation culture in DMEM / F12 complete medium containing IL-1β (10 ng / mL) for 24 h, the medium was replaced with DMEM / F12 basal medium, and ad-SFMBT2 adenovirus solution (adenovirus titer: 1 × 10⁻⁶) was added to the culture system.10 PFU / mL, dosage: 50 μL / tissue block, solvent: 1× PBS); after gentle pipetting and mixing, the cell culture plate was placed in a 37℃ cell culture incubator (5% CO2) for 6 h; then the medium was replaced with DMEM / F12 complete medium containing IL-1β and cultured for another 12 days, with the medium being changed every 2 days. After all treatments were completed, the tissue blocks were removed and fixed at room temperature for 48 h.

[0078] 4.6 Tissue decalcification, paraffin embedding, sectioning, histological staining, and immunohistochemical staining of human cartilage explants. After tissue fixation, the remaining procedures were completed in accordance with the relevant procedures for mouse knee joint tissue.

[0079] 4.7 Explanation of Results See Figure 4-1 Safranin O-Fast Green staining results showed that AAV- Sfmbt2 high expression of group Sfmbt2 Gene complementation treatment improved DMM-induced knee joint damage in mice, decreased OARSI score, increased cartilage layer thickness, reduced cartilage loss and tear area, and increased cartilage surface smoothness; IHC staining results showed that AAV- Sfmbt2 high expression of group Sfmbt2 Gene complementation significantly upregulated the expression of COL2A1, which was suppressed by DMM surgery, and significantly downregulated the expression of MMP13, which was significantly promoted by DMM surgery; Micro-CT scan results showed that AAV- Sfmbt2 high expression of group Sfmbt2 Gene reinjection suppressed osteophyte formation induced by DMM surgery, resulting in a decrease in osteophyte score and a significant inhibition of trabecular bone thickness increase. These results demonstrate that SMBT2 reinjection improves DMM-induced articular cartilage damage and significantly activates chondrocyte activity, promoting cartilage matrix synthesis while inhibiting catabolism. This suggests that SMBT2 reinjection through the joint can have a therapeutic effect on OA (such as PTOA occurring in joints like the knee).

[0080] See Figure 4-2Compared with the control group, human cartilage explants treated with IL-1β for 12 days showed a significant decrease in SMBT2 expression, lighter and unevenly distributed Safranin O-Fix Green staining, and a significantly elevated OARSI score reflecting severe cartilage structural damage (e.g., obvious OA-like phenotypes such as obvious damage and fissures on the cartilage surface observed in the inflammatory state). At the same time, COL2A1 expression was significantly decreased while MMP13 expression was significantly increased. Replenishment with ad-SFMBT2 adenovirus solution effectively promoted SMBT2 expression in human cartilage explants, and the significantly reduced OARSI score suggested that SMBT2 replenishment had a significant repair effect on cartilage structural damage in the inflammatory state (the OA-like phenotype induced by IL-1β treatment was reversed).

[0081] 5. The regulatory role of SFMBT2 on ATF3 in chondrocytes 5.1 Isolation, Culture, and Processing of Primary Human Chondrocytes Regarding the isolation, inoculation, and targeting of human primary chondrocytes SFMBT2 For details on the procedures related to gene siRNA transfection and adenovirus infection, please refer to sections 1.1 and 1.2 above.

[0082] The concentration of IL-1β used to treat cells was 10 ng / mL. The specific treatment procedure was as follows: When the primary chondrocytes reached 80% confluence, the culture medium was replaced with DMEM / F12 complete medium containing IL-1β (10 ng / mL) to induce an inflammatory state in the primary chondrocytes in vitro. Total cell protein samples were collected at 0, 3, 6, 12, 24, and 48 h after treatment for Western blotting to detect the protein content. SFMBT2 , ATF3 and the expression levels of marker genes related to extracellular matrix metabolism in chondrocytes.

[0083] Knockdown was achieved by transfecting human primary chondrocytes with small interfering RNA (siRNA) in vitro. ATF3The siRNA used for transfection was synthesized by Shanghai Sangon Biotech Co., Ltd. (To avoid off-target effects, two pairs of interfering sequences were designed, denoted as si-ATF3-#1 and si-ATF3-#2, respectively; target transcript: NM_001674.4; si-ATF3-#1-Sense: AUAAAAAUGAGGAUUCAAUGAG; si-ATF3-#1-Anti-sense: CAUUGAAUCCUCAUUUUAUAC; si-ATF3-#2-Sense: UUGUGUUAAGGCCUAAAUCCUG; si-ATF3-#2-Anti-sense: GGAUUUAGGCCUUAACACACU). Lipofectamine 2000 was used as the transfection reagent. Specific transfection steps and subsequent experiments are described in section 1.2 above.

[0084] 5.2 Total RNA extraction, transcriptome sequencing, and screening of differentially expressed genes For details on total RNA extraction, transcriptome sequencing, and differentially expressed gene screening, please refer to section 2.2 above.

[0085] 5.3 ChIP-Seq and western blotting ChIP experiments were performed on normally cultured human primary chondrocytes using an anti-SFMBT2 antibody and a Protein A / G magnetic bead ChIP kit (Beyotime P2080S). The ChIP experiment mainly included cell lysis, antibody pre-binding to magnetic beads, immunoprecipitation, and elution. Specific procedures were followed according to the kit instructions. It was crucial that all reactions be performed on ice or at 4°C, and that lysis buffers be prepared fresh for each use, with the addition of protease inhibitors to prevent protein degradation. The final eluted DNA products were sequenced and analyzed by Shanghai Sangon Biotech Co., Ltd.

[0086] For details on the procedures for the Western blotting experiment, please refer to section 1.3 above. The antibodies used for incubation include: primary antibody for detecting SMBT2 (Immunoway YT6640) and primary antibody for detecting ATF3 (Immunoway YT0387).

[0087] 5.4 Protein Structure Prediction and Molecular Docking Simulation The human SFMBT2 protein sequence (specifically NP_001018049.1) was obtained from the NCBI database. ATF3The DNA sequence of the gene promoter region (selected from -2000 to +1 nucleotides before the gene transcription start site) was analyzed using AlphaFold 3 (Google Deep Mind; https: / / alphafoldserver.com) for the SFMBT2 protein and... ATF3 The spatial structure of the DNA in the gene promoter region was analyzed, and then molecular docking simulations were performed. The docking results were visualized using Pymol (v.2.4.0 Schrödinger).

[0088] 5.5 Explanation of Results The results are as follows Figure 5 As shown, in primary chondrocytes SFMBT2 Genes whose expression patterns are reversed after gene intervention (i.e., those in knockdown) SFMBT2 Gene upregulation and high expression SFMBT2 There are 598 downregulated genes (similar to "si-up & ad-down"). The intersection of the "si-up & ad-down" gene list obtained from RNA-Seq and the "Gene-Pro" gene list obtained from ChIP-Seq (note: ChIP-Seq experiments using a specific antibody against SMBT2 detected 1590 DNA fragments located in gene promoter regions) yields a total of 18 genes (defined as the "SFMBT2-Target" gene set). Among the 18 genes in the "SFMBT2-Target" gene set, only... ATF3 It encodes transcription factors; and Western blotting results showed that ATF3 expression was knocked down. SFMBT2 Significantly increased after gene expression, at high expression SFMBT2 Genetic inhibition significantly decreased ATF3 expression. The upregulation of ATF3 by IL-1β treatment was inhibited by the SMBT2 complementation effect induced by ad-SFMBT2 adenovirus solution treatment. Knockdown treatment using si-ATF3 significantly downregulated ATF3 expression but did not affect SMBT2 expression. Furthermore, molecular docking results showed that the GLU597, ARG610, ALA611, VAL612, and LYS673 sites of the SMBT2 protein were associated with… ATF3 Multiple nucleotides in the gene promoter region are bound by hydrogen bonds, and the corresponding amino acid residues at these sites are all located in the SLED domain of the SMBT2 protein.

[0089] 6. The regulatory role of SMBT2 on the ATF3-PI3K / AKT signaling axis in chondrocytes. 6.1 Isolation, culture, processing, and Western blotting of human primary chondrocytes Regarding the isolation, inoculation, and targeting of human primary chondrocytes SFMBT2 For details on the procedures for gene siRNA transfection and adenovirus infection, please refer to sections 1.1, 1.2, and 5.1 above; for details on the procedures for Western blotting experiments, please refer to section 1.3 above.

[0090] In human primary chondrocytes overexpressing SMBT2, the activated PI3K / AKT signaling pathway was targeted and inhibited by adding the AKT phosphorylation inhibitor Capivasertib (MCE HY-15431, final concentration 1 μM).

[0091] 6.2 Explanation of Results The results are as follows Figure 6 As shown, in human primary chondrocytes SFMBT2 Genes were significantly altered after intervention (in areas of high expression) SFMBT2 Promote in time, in knockdown SFMBT2 Phosphorylation modification of AKT (P-AKT) is inhibited, while PI3K phosphorylation level (P-PI3K) is only observed in highly expressed AKT. SFMBT2 The level increased after gene knockout. SFMBT2 No significant changes were observed after gene therapy, and the expression of total AKT and PI3K proteins (T-AKT / T-PI3K) did not change significantly after intervention. Treatment of human primary chondrocytes with the AKT phosphorylation inhibitor Capivasertib significantly reduced AKT phosphorylation modification activated by increased SMBT2 expression (i.e., combined treatment with ad-SFMBT2), inhibited COL2A1, and upregulated MMP13 protein expression. Knockdown in human primary chondrocytes... SFMBT2 Gene knockdown was performed using si-ATF3. ATF3 Treatment revealed that with ATF3 expression silencing, AKT phosphorylation level significantly increased, COL2A1 expression significantly increased, and MMP13 expression significantly decreased.

[0092] 7. Screening of ligand drugs targeting SFMBT2 protein 7.1 Ligand pocket structure analysis of SFMBT2 protein and screening of potential ligand drugs The ligand-binding pocket of mouse SMBT2 protein (NP_796360.2) was analyzed using P2RANK software. The mouse SMBT2 protein was converted to PDBQT format using the `prepare_receptor4.py` script in Autodock-TOOLS, with the receptor protein set to rigid. Small molecule drugs approved for clinical use by the U.S. Food and Drug Administration (FDA) were obtained from the DrugBank FDA Approved database (https: / / go.drugbank.com). Based on the compound structure of these drugs, inorganic molecules and excessively large molecules (molecules containing more than 60 heavy atoms) were removed. The remaining 2286 small molecule drugs were converted to PDBQT format using the `mk_prepare_ligand.py` script in the Meeko toolkit, and molecular docking between the mouse SMBT2 protein and the small molecule drugs was performed using Autodock Vina. The spatial conformation of the SMBT2 protein, the range of the ligand-binding pocket, and the spatial conformation of the complex formed by the SMBT2 protein and ligand were visualized using Pymol software. After performing simulated docking of 2286 small molecule drugs with each ligand binding pocket of mouse SFMBT2 protein, a list of the top 100 compounds in each ligand binding pocket was obtained according to the docking score from high to low. The intersection of the top 100 compounds in docking scores of different ligand binding pockets was then used to screen and obtain the small molecule drugs to be validated.

[0093] 7.2 Screening of potential OA therapeutics targeting the SFMBT2 protein Small molecule drugs selected through 7.1 screening were added to normally cultured human primary chondrocytes and cultured for another 24 h. Total RNA was extracted after treatment, and real-time quantitative PCR was performed on the RNA samples. , Thus obtain COL2A1 Gene expression was assessed; a blank control group (no drug solution added, only solvent added) was also set up. The experimental procedures for total RNA extraction are detailed in section 2.2 above. In the real-time quantitative PCR experiment, 5 μg of RNA sample was used for reverse transcription. The resulting cDNA stock solution was diluted 10-fold with ddH2O and used as a template for RT-qPCR. The reaction system was prepared along with RT-qPCR primers designed using the PrimerBLAST tool and other reagents. After the reaction, the... GAPDH For internal reference, and use The relative expression levels of the target gene were analyzed by CT method to examine the effects of different small molecule drugs on the synthetic metabolic phenotype of cartilage matrix. The RT-qPCR primers were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0094] Primary chondrocytes from CKO mice were isolated and induced in vitro by adding 4-OH Tamoxifen (1 μM). Sfmbt2 Gene knockout was followed by treatment for 24 h, then the addition of a small molecule drug that had been preliminarily identified as affecting the anabolic phenotype of cartilage matrix in the target drug. Total RNA was extracted after 24 h of treatment and analyzed by real-time quantitative PCR. Col2a1 Gene expression status was studied; an uninduced group and a blank control group (without drugs) were also set up.

[0095] After inducing inflammation in human primary chondrocytes using IL-1β (10 ng / mL), a small molecule drug to be validated was added. Total RNA was extracted after 24 h of treatment and analyzed by real-time quantitative PCR. COL2A1 Genes and MMP13 Gene expression status; a blank control group (without IL-1β and drugs) was also set up.

[0096] The primer sequences used in the above RT-qPCR experiments are as follows: hSFMBT2 -F: TCTGCGCTACTGCGGTTAC; hSFMBT2 -R:ACCAGTCAAGTCACGTATGAGAA; hCOL2A1 -F: TGGACGATCAGGCGAAACC; hCOL2A1 -R:GCTGCGGATGCTCTCAATCT; hMMP13 -F:TCCTGATGTGGGTGAATACAATG; hMMP13 -R:GCCATCGTGAAGTCTGGTAAAAT; hGAPDH -F:ACAACTTTGGTATCGTGGAAGG; hGAPDH -R:GCCATCACGCCACAGTTTC; mCol2a1 -F: CAGGATGCCCGAAAATTAGGG; mCol2a1-R:ACCACGATCACCTCTGGGT; mGapdh -F: AGGTCGGTGTGAACGGATTTG; mGapdh -R:TGTAGACCATGTAGTTGAGGTCA; In the above in vitro experiments at the cellular level, all small molecule drugs were purchased from MCE and the final concentration was 100 nM.

[0097] 7.3 Explanation of Results See Figure 7-1 The SMBT2 protein has two ligand-binding pockets (Pocket 1 and Pocket 2). Pocket 1 consists of 38 amino acid residues from R63 to D458, with a predicted probability of 74.4%; Pocket 2 consists of 18 amino acid residues from Q194 to F329, with a predicted probability of 32.9%.

[0098] See Figure 7-2 Utilizing the two ligand-binding pockets of the SFMBT2 protein, 27 drugs capable of binding to both ligand-binding pockets were screened for potential validation. Among these, nine compounds—Bromocriptine, Midostaurin, Lumacaftor, Avapritinib, Hydrocortisone cypionate, Dihydroergocristine, Lurasidone, Capmatinib, and Digitoxin—significantly promoted the growth of human primary chondrocytes. COL2A1 The mRNA expression of the gene was affected, while the other 18 compounds had no significant effect on the anabolic phenotype of cartilage matrix (based on the fact that these 18 compounds had no effect on the expression of the gene's mRNA). COL2A1 (The gene's mRNA expression was not significantly promoted); mouse primary chondrocytes were induced using 4-OH Tamoxifen. Sfmbt2 In the case of gene knockout, bromocriptine, hydrocortisone cyclovalerate, dihydroergonovine, carmatinib, and digitoxin... Sfmbt2 After knocking out Col2a1 The promoting effect of the drug on mRNA expression was significantly reduced, while the other four drugs had a significantly reduced effect on the expression of the drug. Col2a1 The promoting effect on mRNA expression was not affected. Sfmbt2The effects of gene deletion; and by treating human primary chondrocytes stimulated with IL-1β for 24 h with five compounds—bromocriptine, hydrocortisone cyclopentanoate, dihydroergonovine, carmatinib, and digoxin—only bromocriptine significantly promoted inflammation reduction under IL-1β-induced inflammation. COL2A1 While inhibiting the expression of mRNA, it also inhibits the activation of IL-1β. MMP13 The expression of mRNA was reduced by the other four compounds, which did not promote the expression of the mRNA. COL2A1 At the same time, it showed its support for MMP13 These results indicate that bromocriptine significantly promotes chondrocyte ECM anabolism and inhibits catabolism, and this effect, representing the activation of chondrocyte activity, is dependent on SMBBT2.

[0099] 8. The effect of bromocriptine in alleviating chondrocyte inflammation. 8.1 Treatment of human primary chondrocytes in an in vitro inflammation model with bromocriptine For procedures related to the in vitro inflammation model of human primary chondrocytes, please refer to section 7.2 above; for procedures related to the Western blotting experiment, please refer to section 1.3 above.

[0100] 8.2 Explanation of Results The results are as follows Figure 8-2 As shown, administration of bromocriptine to human primary chondrocytes treated with IL-1β for 24 h significantly increased AKT phosphorylation and COL2A1 expression, which were downregulated by IL-1β treatment, while decreasing ATF3 protein expression and substantially inhibiting elevated MMP13 expression. These results indicate that bromocriptine can suppress the inflammatory state of chondrocytes induced by IL-1β treatment and help promote the synthesis and metabolism of extracellular matrix in chondrocytes.

[0101] Furthermore, molecular docking simulations of bromocriptine's binding pocket with the SMBT2 protein revealed that bromocriptine can directly insert into the tunnel-like cavities formed between amino acid residues in Pocket 1, binding with residues such as I310, H349, S352, L353, V452, and D458 via numerous hydrogen bonds. In the docking model with Pocket 2, bromocriptine binds to small "indentations" on the outer side of the SMBT2 protein, forming a small number of hydrogen bonds with amino acid residues such as W244 and K328. Based on this, it is speculated that Pocket 1 may be the ligand-binding pocket that plays the primary binding role. Figure 8-1 ).

[0102] 9. The effects of hydrocortisone cyclovalerate, dihydroergonovine, carmatinib, and digitoxin in alleviating chondrocyte inflammation. 9.1 Treatment of human primary chondrocytes in an in vitro inflammatory model by hydrocortisone cyclovalerate, dihydroergonovine, carmatinib, and digitoxin For procedures related to the in vitro inflammation model of human primary chondrocytes, please refer to section 7.2 above; for procedures related to the Western blotting experiment, please refer to section 1.3 above.

[0103] 9.2 Explanation of Results The results are as follows Figure 9-2 As shown, in human primary chondrocytes treated with IL-1β for 24 h, administration of hydrocortisone cyclovalerate, dihydroergonovine, carmatinib, and digitoxin revealed that hydrocortisone cyclovalerate, dihydroergonovine, and carmatinib could inhibit the increased ATF3 after IL-1β treatment and promote COL2A1 expression, but failed to effectively regulate PI3K / AKT signaling or significantly inhibit MMP13. Digitoxin promoted SFMBT2 expression after IL-1β treatment but failed to inhibit the increase of ATF3 and MMP13. These results indicate that these four small molecule drugs failed to exhibit good regulatory effects on extracellular matrix metabolism in chondrocytes dependent on the SFMBT2-ATF3-PI3K signaling axis, while bromocriptine showed better efficacy in comparison.

[0104] Furthermore, molecular docking simulations of hydrocortisone cyclovaline, dihydroergonovine, carmatinib, and digitoxin with the SFMBT2 protein ligand-binding pocket revealed that, compared to the docking model of bromocriptine, the docking models of these four small molecule drugs with the SFMBT2 protein ligand-binding pocket produced fewer hydrogen bonds and fewer amino acid residues involved in forming hydrogen bonds. In particular, the docking model of hydrocortisone cyclovaline with Pocket 1 failed to form hydrogen bonds at all. Figure 9-1 These differences indirectly confirm the potential of bromocriptine to target SFMBT2.

[0105] 10. The role of SFMBT2-dependent bromocriptine in alleviating disease progression in a DMM mouse model. 10.1 Mouse cartilage-specific induction knockout, DMM surgery, intra-articular injection of AAV, and gavage administration of bromocriptine. Eight-week-old male CKO mice with good growth and uniform weight were intraperitoneally injected with Tamoxifen solution (75 μg / g mouse body weight, dissolved in sterile corn oil) for 5 consecutive days. After 2 days, if no abnormalities were observed, further treatment could proceed. Eight-week-old male WT mice were not subjected to knockout induction. The relevant experimental procedures for DMM surgery in these two mouse types are detailed in section 3.1 above. The surgically induced and induced CKO mice were divided into two groups. One group underwent SFMBT2 complementation and AAV- Sfmbt2For details on the construction and replenishment operations, please refer to section 4.2 above.

[0106] Bromocriptine administration (once daily) was initiated after the DMM procedure and continued until AAV injection was performed. Sfmbt2 All mice were sacrificed in the eighth week after administration; a control group was also given the drug solvent. Bromocriptine was administered by gavage (10 μg / g mouse body weight, bromocriptine dissolved in physiological saline and prepared fresh each time).

[0107] 10.2 Collection of mouse knee joints, micro-CT scan, histological staining, and IHC staining. For details on the experimental procedures of specimen collection and fixation, micro-CT, histological staining and IHC development of mouse knee joint tissue, please refer to sections 3.1, 3.2 and 3.3 above.

[0108] 10.3 Explanation of Results See Figure 10 IHC staining results showed that bromocriptine treatment did not affect SFMBT2 expression, but it inhibited ATF3 expression in WT mice to some extent; knockout Sfmbt2 Subsequently, ATF3 expression increased significantly, at which point bromocriptine treatment did not show an inhibitory effect; Sfmbt2 Gene complementation significantly inhibited ATF3 expression, and bromocriptine treatment further suppressed ATF3 expression. Safranin O-Fixed Green staining and micro-CT results showed that bromocriptine treatment alleviated cartilage structural damage and osteophyte formation in WT mice induced by DMM surgery to some extent, and the OARSI score was reduced. Sfmbt2 Gene knockout leads to a more severe OA phenotype, in which case bromocriptine treatment fails to show any positive effect; Sfmbt2 After gene restoration, cartilage pathological damage was reduced compared to induced damage. Sfmbt2 Both gene knockout groups showed significant declines, and bromocriptine treatment at this point resulted in better cartilage repair outcomes, with OARSI scores significantly higher than those of the gene knockout group alone. Sfmbt2 Gene complementation was significantly reduced.

[0109] like Figure 10 As shown, the IHC staining results also revealed that in WT mice, bromocriptine treatment exhibited opposite regulatory effects on COL2A1 and MMP13 (specifically, significantly increased COL2A1 expression and significantly downregulated MMP13 expression), consistent with in vitro experimental results; induction Sfmbt2 Knockout significantly inhibited COL2A1 expression, while MMP13 expression was promoted to some extent; bromocriptine showed no significant effect at this point. Sfmbt2After gene therapy, COL2A1 expression was significantly upregulated and MMP13 expression was significantly suppressed. At this time, bromocriptine treatment could enhance the promoting effect on COL2A1 expression, and MMP13 expression also showed a decreasing trend.

[0110] Furthermore, micro-CT results also suggest that bromocriptine treatment, in addition to reducing osteophyte formation to some extent, also enhances... Sfmbt2 The inhibitory effect of gene complementation on osteoarthritis (OA) bone remodeling.

[0111] In summary, high expression of SFMBT2 significantly promotes matrix synthesis mediated by COL2A1 and other factors in human primary chondrocytes, and inhibits matrix degradation mediated by MMP13 and other factors; it also induces chondrocyte degradation in adult mice. Sfmbt2 Knockout exacerbates the OA phenotype induced by DMM surgery; SFMBT2 reinjection significantly reverses OA-like changes induced by IL-1β treatment and DMM surgery; SFMBT2 regulates multiple cartilage matrix synthesis-related genes and pathways, targets and inhibits the ATF3 promoter, significantly upregulates COL2A1 and inhibits MMP13 expression by promoting AKT phosphorylation modification; bromocriptine shows a positive effect on cartilage matrix synthesis and damage repair, and effectively enhances the SFMBT2 reinjection effect. Therefore, SFMBT2 can serve as a target molecule for OA treatment. SFMBT2 Genetic interventions can be applied to the clinical prevention and treatment of OA. In addition, small molecule drugs that target the SMBT2 ligand binding pocket, such as bromocriptine, can also be explored for the treatment of OA.

Claims

1. Use of a SFMBT2 overexpression vector in the preparation of a drug for preventing and / or treating osteoarthritis.

2. Use according to claim 1, characterized in that: The drug is administered by local injection into the joint.

3. Use according to claim 1, characterized in that: The drug improves joint cartilage damage and inhibits bone hyperplasia.

4. Use of a SFMBT2 overexpression vector in the preparation of a drug for promoting cartilage damage repair.

5. Use of an SFMBT2 overexpression vector in the manufacture of a medicament for inhibiting proinflammatory gene expression in chondrocytes ATF3 at a level sufficient to inhibit expression of a proinflammatory gene in chondrocytes.

6. Use of a SFMBT2 overexpression vector in the preparation of a drug for regulating PI3K / AKT signal activity in chondrocytes.

7. Use of a ligand targeting SFMBT2 in the preparation of a drug for preventing and / or treating osteoarthritis.

8. Use according to claim 7, characterized in that: The ligand is any one of bromocriptine, hydrocortisone cyclopentylate, dihydroergotoxine, carmatin, and digitalin.

9. Use of a SFMBT2 agonist in the preparation of a drug for preventing and / or treating osteoarthritis.

10. A method of constructing an animal model of osteoarthritis, characterized by: Comprising the following steps: Organizing a tissue-specific knockout of a gene in an experimental animal, the tissue being cartilage. Sfmbt2 Organizing a tissue-specific knockout of a gene in an experimental animal, the tissue being cartilage.

Citation Information

Patent Citations

  • Application of FSCN1 inhibitor in preparation of medicine for treating osteoarthritis

    CN118634331A