RNAi agents for inhibiting expression of statin subunit beta E (INHBE), pharmaceutical compositions and methods of use thereof

By designing specific RNAi agents to inhibit INHBE gene expression, the problem of insufficient regulation of the inhibin subunit βE in abdominal obesity and cardiometabolic diseases was solved, resulting in significant improvement in weight and metabolism.

CN122095093APending Publication Date: 2026-05-26ARROWHEAD PHARMACEUTICALS INC
View PDF 12 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-08-29
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

In the prior art, the mechanism of action of inhibin subunit βE (INHBE) is not fully understood, its regulatory role in abdominal obesity and cardiometabolic diseases has not been effectively utilized, and existing inhibition methods are inefficient.

Method used

RNAi agents containing antisense and sense strands were developed to inhibit the expression of INHBE mRNA by specifically binding to it. These RNAi agents contain modified nucleotides and targeting ligands and are used to prepare pharmaceutical compositions for the treatment of related diseases.

Benefits of technology

It effectively inhibits INHBE gene expression, reduces abdominal obesity and cardiometabolic disease symptoms, and shows significant effects in weight loss, fat reduction and metabolic improvement.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present disclosure relates to RNAi agents, e.g., double-stranded RNAi agents, e.g., siRNAs, capable of inhibiting expression of the subunit beta E (INHBE) gene. Also disclosed are pharmaceutical compositions comprising the INHBE RNAi agents, and methods of use thereof. The INHBE RNAi agents disclosed herein can be conjugated to targeting ligands to facilitate delivery to cells, including to hepatocytes. Delivery of the INHBE RNAi agent in vivo results in inhibition of expression of the INHBE gene. RNAi agents may be used in methods of treating diseases, disorders, or conditions mediated in part by the expression of the INHBE gene, such as obesity, diabetes, liver inflammation, dyslipidemia, or metabolic diseases.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross-reference to related applications This application claims priority to U.S. Provisional Patent Application Serial No. 63 / 579,708, filed August 30, 2023; U.S. Provisional Patent Application Serial No. 63 / 618,015, filed January 5, 2024; U.S. Provisional Patent Application Serial No. 63 / 634,173, filed April 15, 2024; and U.S. Provisional Patent Application Serial No. 63 / 683,209, filed August 14, 2024, the contents of which are incorporated herein by reference in their entirety. Technical Field

[0002] This disclosure relates to RNA interference (RNAi) agents for inhibiting inhibin subunit βE (INHBE), such as double-stranded RNAi agents, such as small interfering RNA or short interfering RNA (siRNA), pharmaceutical compositions comprising INHBE RNAi agents, and methods of using the same.

[0003] sequence list This application contains a sequence list (compliant with the ST26 standard), which has been submitted in XML format and is incorporated herein by reference in its entirety. The XML sequence list file is named 30713-WO_SeqListing.xml, was created on August 26, 2024, and has a size of 3112kb. Background Technology

[0004] The inhibin subunit βE (INHBE) is primarily expressed in the liver and encodes a proprotein that is cleaved by proteolysis to release the mature β peptide. Homodimerization of the mature peptide leads to the production of activin E protein. As members of the transforming growth factor-β (TGF-β) superfamily, activin proteins regulate the transcripts of target genes via SMAD activation, and their roles in regulating growth, body composition, obesity, and energy metabolism have been documented in the literature.

[0005] In a whole-exome sequencing study, researchers identified rare variants with predicted loss of function (NM_031479.4:c.299-1 G>C, NM_0314794.4:C.298+1 G>T, p.Tyr253Ter), which were associated with reduced abdominal obesity phenotype and favorable cardiometabolic characteristics (Deaton AM et al., Rare loss of function variants in the hepatokine gene INHBE protect from abdominal obesity, NatCommun. (July 2022); 13:4319). Heterozygous carriers of these variants were associated with lower waist-to-hip ratio-regulated BMI, lower triglycerides, higher HDL cholesterol, lower alanine aminotransferase, and lower fasting blood glucose. Fewer cases of type 2 diabetes and coronary heart disease were also found in carriers of these INHBE loss-of-function variants. Furthermore, RNA expression analysis from liver biopsies showed increased INHBE expression in obese monkeys with NAFLD compared to lean monkeys. The findings of this study support previous small-scale studies that identified INHBE as a candidate target gene for metabolic regulation.

[0006] Research on INHBE is relatively limited, and its mechanism of action in relation to abdominal obesity is not fully understood. However, preclinical studies using siRNA knockdown of INHBE in diabetic mouse models have shown that moderate reduction of INHBE can lead to inhibition of weight gain, increase in lean meat composition, and reduction in fat mass volume (Sugiyama M et al., Inhibin E (INHBE) is a possible insulin resistance-associated hepatokine identified by comprehensive gene expression analysis in human liver biopsy samples, PLoSONE. (Feb 2018); 13(3):e0194798). This evidence suggests that INHBE is a potential therapeutic target, and that inhibition can lead to a favorable phenotype in terms of abdominal obesity and cardiometabolic disease. Summary of the Invention

[0007] This article discloses an RNAi agent for inhibiting INHBE gene expression, comprising an antisense strand containing at least 17 consecutive nucleotides that differ from any of the sequences in Tables 2, 3, or 5C by 0 or 1 nucleotide; and a sense strand containing a nucleotide sequence that is at least partially complementary to the antisense strand.

[0008] In some implementations, the antisense strand contains nucleotides 2-18 of any one of the sequences in Table 2, Table 3, or Table 5C.

[0009] In some embodiments, the sense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides that differ from any of the sense strand sequences in Table 2 or Table 4 by 0 or 1 nucleotide, and wherein the sense strand has a region that is at least 85% complementary to the antisense strand on the 15 consecutive nucleotides.

[0010] In some embodiments, at least one nucleotide of the RNAi agent is a modified nucleotide or includes a modified nucleoside linker.

[0011] According to some implementation schemes, all or substantially all nucleotides of the sense and / or antisense strands of the RNAi agent are modified nucleotides.

[0012] In some embodiments, the modified nucleotide is selected from: 2'-O-methyl nucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2',3'-open-ring nucleotide mimic, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, baseless nucleotide, ribitol, reverse nucleotide, reverse 2'-O-methyl nucleotide, reverse 2'-deoxynucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholinonucleotide, nucleotide containing vinylphosphonate, nucleotide containing cyclopropylphosphonate, and 3'-O-methyl nucleotide.

[0013] In some embodiments, all or substantially all of the modified nucleotides are 2'-O-methyl nucleotides, 2'-fluoronucleotides, or combinations thereof.

[0014] In some implementations, the antisense strand consists of, is substantially composed of, or contains any of the modified antisense strand sequences in Table 3.

[0015] In some implementations, the sense strand consists of, is substantially composed of, or contains any of the modified sense strand sequences in Table 4.

[0016] In some implementations, the antisense strand comprises the nucleotide sequence of any one of the modified sequences in Table 3, and the sense strand comprises the nucleotide sequence of any one of the modified sequences in Table 4.

[0017] In some embodiments, the RNAi agent is linked to a targeting ligand. In some embodiments, the targeting ligand comprises N-acetylgalactosamine. In some embodiments, the targeting ligand comprises a (NAG37) or (NAG37)s structure. In some embodiments, the targeting ligand is linked to a sense strand. In some embodiments, the targeting ligand is linked to the 5' end of the sense strand.

[0018] In some embodiments, the sense strand is 15 to 30 nucleotides long, and the antisense strand is 18 to 30 nucleotides long. In other embodiments, the sense strand and antisense strand are each 18 to 27 nucleotides long. In still other embodiments, the sense strand and antisense strand are each 18 to 24 nucleotides long. In yet another embodiment, the sense strand and antisense strand are each 21 nucleotides long.

[0019] In some implementations, the RNAi agent has two blunt ends.

[0020] In some embodiments, the sense strand includes one or two terminal caps. In other embodiments, the sense strand includes one or two reverse abase-free residues.

[0021] In some embodiments, the RNAi agent comprises a sense strand and an antisense strand that form a double-stranded sequence of any of the double-stranded structures shown in Tables 5A, 5B, or 5C.

[0022] In some implementations, the sense strand further includes an inverted baseless residue at the 3' end of the nucleotide sequence, at the 5' end of the nucleotide sequence, or at both.

[0023] In some embodiments, the sense strand of the RNAi agent is linked to a targeting ligand. In some embodiments, the targeting ligand has affinity for the desialyl glycoprotein receptor. In some embodiments, the targeting ligand comprises N-acetylgalactosamine.

[0024] In a further embodiment, the targeting ligand comprises: ,or .

[0025] This article also discloses compositions comprising the disclosed RNAi agent, wherein the composition further comprises a pharmaceutically acceptable excipient.

[0026] This article also provides a method for inhibiting the expression of the INHBE gene in cells, the method comprising introducing an effective amount of the disclosed RNAi agent or the disclosed composition into the cells.

[0027] In some implementations, the cells are inside the subject. In some implementations, the subject is a human subject.

[0028] In some embodiments, INHBE gene expression is suppressed by at least approximately 30%. In some embodiments, INHBE gene expression is suppressed by at least approximately 50% in the cytoplasm of hepatocytes.

[0029] This article further provides a method for treating INHBE-related diseases, disorders, or symptoms, the method comprising administering a therapeutically effective amount of the disclosed composition to a subject in need.

[0030] In some implementation schemes, the disease is obesity, diabetes, liver inflammation, dyslipidemia, or metabolic disease.

[0031] In some implementations, the RNAi agent is administered at a dose of approximately 0.05 mg / kg to approximately 5.0 mg / kg of human subject weight.

[0032] In other embodiments, the RNAi agent is administered in two or more doses.

[0033] This article also provides the use of the disclosed RNAi agents or the disclosed compositions for the treatment of diseases, disorders or symptoms at least partially mediated by INHBE gene expression.

[0034] In some implementation schemes, the disease is obesity, diabetes, liver inflammation, dyslipidemia, or metabolic disease.

[0035] This document further provides the use of the disclosed RNAi agents or compositions for the preparation of pharmaceutical compositions for the treatment of diseases, disorders, or symptoms at least partially mediated by INHBE gene expression.

[0036] In some implementations, the RNAi agent is administered at a dose of approximately 0.05 mg / kg to approximately 5.0 mg / kg of human subject weight. Brief description of the attached diagram Figure 1A • Percentage change in body weight of test animals after administration of INHBE RNAi (see Example 10 in this document).

[0038] Figure 1B • Percentage of body fat in test animals after administration of INHBE RNAi (see Example 10 in this document).

[0039] Figure 1C • Body fat mass of test animals after administration of INHBE RNAi (see Example 10 in this document).

[0040] Figure 1D • Percentage of lean meat in test animals after administration of INHBE RNAi (see Example 10 in this document).

[0041] Figure 1E • Lean meat mass in test animals after administration of INHBE RNAi (see Example 10 in this document).

[0042] Figure 1F Fasting blood glucose levels in experimental animals after administration of INHBE RNAi (see Example 10 in this document).

[0043] Figure 1G Fasting insulin in experimental animals after administration of INHBE RNAi (see Example 10 in this document).

[0044] Figure 1H HOMA-IR in experimental animals after administration of INHBE RNAi (see Example 10 in this document).

[0045] Figure 1I Blood glucose levels in experimental animals after glucose bolus administration of INHBE RNAi agent (see Example 10 in this document).

[0046] Figure 1J • AUC glucose tolerance test in experimental animals after administration of INHBE RNAi (see Example 10 in this document).

[0047] Figure 2A • Percentage change in body weight of test animals after administration of INHBE RNAi (see Example 11 in this document).

[0048] Figure 2B • Percentage of body fat in test animals after administration of INHBE RNAi (see Example 11 in this document).

[0049] Figure 2C • Body fat mass of test animals after administration of INHBE RNAi (see Example 11 in this document).

[0050] Figure 2D • Percentage of lean meat in test animals after administration of INHBE RNAi (see Example 11 in this document).

[0051] Figure 2E • Lean meat mass in test animals after administration of INHBE RNAi (see Example 11 in this document).

[0052] Figure 2FFasting blood glucose levels in experimental animals after administration of INHBE RNAi (see Example 11 in this document).

[0053] Figure 2G Blood glucose levels in experimental animals after glucose bolus administration of INHBE RNAi agent (see Example 11 in this document).

[0054] Figure 2H • AUC glucose tolerance test in experimental animals after administration of INHBE RNAi (see Example 11 in this document).

[0055] Figure 3 The proposed clinical protocol for Part 1 (Groups 1-4) of a Phase 1 / 2a dose escalation study to evaluate the safety, tolerability, pharmacokinetics, and pharmacodynamics of single and multiple doses of the INHBE RNAi agent shows dosing in adult volunteers with obesity (see Example 21 in this document). "ARO-INHBE" represents the INHBE RNAi agent-conjugate disclosed herein.

[0056] Figure 4 This is the proposed clinical protocol for Part 2 of a Phase 1 / 2a dose-escalation study evaluating the safety, tolerability, and pharmacodynamics of an INHBE RNAi agent in combination with a GLP-1 / GIP agonist (TZP) at multiple repeated doses, showing dosing in obese adult volunteers with and without type 2 diabetes (see Example 21 herein). "ARO-INHBE" represents the INHBE RNAi agent-conjugate as disclosed herein.

[0057] Figures 5A-5C The chemical structure of AC004285 in its free acid form is shown.

[0058] Figures 6A-6C The chemical structure of AC004285 in its sodium salt form is shown.

[0059] Figures 7A-7C The chemical structure of AC004007 in its free acid form is shown.

[0060] Figures 8A-8C The chemical structure of AC004007 in its sodium salt form is shown. Detailed Implementation

[0061] The disclosed RNAi agents, their compositions, and methods of use can be more readily understood by referring to the following detailed description, which forms part of this disclosure. It should be understood that this disclosure is not limited to what is specifically described and / or shown herein, and the terminology used herein is for the purpose of describing particular embodiments by way of example only and is not intended to be limiting.

[0062] It should be understood that, although for clarity, certain features of the disclosures included herein are described in the context of individual embodiments, they may also be provided in combination in a single embodiment. Conversely, for brevity, various features of the disclosed methods described in the context of individual embodiments may also be provided individually or in any sub-combination.

[0063] definition As used herein, an "RNAi agent" refers to a composition of RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules capable of degrading or inhibiting the translation of a messenger RNA (mRNA) transcript of a target gene in a sequence-specific manner (e.g., under appropriate conditions). As used herein, RNAi agents may act via RNA interference mechanisms (i.e., by interacting with RNA interference pathways in mammalian cells, such as RNA-induced silencing complexes or RISC) or through any alternative mechanism or pathway. While it is believed that the term RNAi agent, as used herein, acts primarily through RNA interference mechanisms, the disclosed RNAi agents are not bound to or limited to any particular pathway or mechanism of action. The RNAi agents disclosed herein contain sense and antisense strands and include, but are not limited to, short (or small) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and dicer substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to the targeted mRNA (i.e., INHBE mRNA). RNAi agents may include one or more modified nucleotides and / or one or more non-phosphodiester linkages.

[0064] As used herein, when referring to the expression of a given gene, the terms “silence,” “reduction,” “inhibition,” “downregulation,” or “knockdown” mean that when cells, cell populations, tissues, organs, or subjects are treated with the RNAi agents described herein, the expression of that gene is reduced compared to a second cell, cell population, tissue, organ, or subject that has not been treated in this way, as measured by the level of RNA transcribed from that gene in the cell, cell population, tissue, organ, or subject in which the gene is transcribed, or by the level of polypeptides, proteins, or protein subunits translated from that mRNA.

[0065] As used herein, the terms "sequence" and "nucleotide sequence" refer to a series or order of nucleobases or nucleotides, described using a series of letters in standard nomenclature. Nucleic acid molecules may contain unmodified and / or modified nucleotides. Nucleotide sequences may contain unmodified and / or modified nucleotides.

[0066] As used herein, “base,” “nucleotide base,” or “nucleobase” refers to a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, and includes primary purine bases adenine and guanine, and primary pyrimidine bases cytosine, thymine, and uracil. Nucleobases can be further modified to include, but are not limited to, universal bases, hydrophobic bases, hybrid bases, size-enhanced bases, and fluorinated bases (see, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed., Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphorous amide compounds containing modified nucleobases) is known in the art.

[0067] As used herein, the term "nucleotide" has the same meaning as commonly understood in the art. Thus, as used herein, the term "nucleotide" refers to a glycoside comprising a sugar moiety, a base moiety, and a covalently linked group (linking group) (e.g., a phosphate ester, thiophosphate, or dithiophosphate internucleotide linking group), and encompasses naturally occurring nucleotides (e.g., DNA or RNA) and non-naturally occurring nucleotides comprising modified sugar and / or base moieties (also referred to herein as nucleotide analogs). In this document, a single nucleotide may be referred to as a monomer or unit.

[0068] As used herein, and unless otherwise stated, the term "complementary" in describing a first nucleobase or nucleotide sequence (e.g., a sense strand or targeted mRNA of an RNAi agent) associated with a second nucleobase or nucleotide sequence (e.g., an antisense strand of an RNAi agent or a single-stranded antisense oligonucleotide) refers to the ability of an oligonucleotide or polynucleotide containing the first nucleotide sequence to hybridize (form base-pair hydrogen bonds under mammalian physiological conditions (or, under other suitable in vivo or in vitro conditions)) and form a double-stranded or double-helix structure under certain standard conditions. Those skilled in the art will be able to select the set of conditions most suitable for hybridization experiments. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include native or modified nucleotides or nucleotide mimics, at least to the extent that the hybridization requirements described above are met. Sequence identity or complementarity is independent of modification. For example, a and Af, as defined herein, are complementary to U (or T) and identical to A (for the purpose of determining identity or complementarity).

[0069] As used herein, "perfect complementarity" or "complete complementarity" means that in a hybridization pair of nucleobase or nucleotide sequences, all (100%) bases in the sequential sequence of the first oligonucleotide will hybridize with the same number of bases in the sequential sequence of the second oligonucleotide. The sequential sequence may contain all or part of the first or second nucleotide sequence.

[0070] As used herein, "partial complementarity" means that in a hybridization pair of nucleobase or nucleotide sequences, at least 70% but not all of the bases in the sequential sequence of the first oligonucleotide will hybridize with the same number of bases in the sequential sequence of the second oligonucleotide. The sequential sequence may contain all or part of the first or second nucleotide sequence.

[0071] As used herein, "substantially complementary" means that in a hybridization pair of nucleobase or nucleotide sequences, at least 85% but not all of the bases in the sequential sequence of the first oligonucleotide will hybridize with the same number of bases in the sequential sequence of the second oligonucleotide. The sequential sequence may contain all or part of the first or second nucleotide sequence.

[0072] As used herein, the terms “complementary,” “fully complementary,” “partially complementary,” and “substantially complementary” are used to describe nucleobase or nucleotide matches between the sense and antisense strands of an RNAi agent or between the antisense strand of an RNAi agent and the sequence of INHBE mRNA.

[0073] As used herein, when applied to nucleic acid sequences, the terms "substantially identical" or "substantially identical" mean that a nucleotide sequence (or a portion thereof) has at least approximately 85% sequence identity or higher compared to a reference sequence, such as at least 90%, at least 95%, or at least 99%. The percentage of sequence identity is determined by comparing two best-aligned sequences within a comparison window. This percentage is calculated by determining the number of positions in both sequences where the same type of nucleic acid base occurs to produce a number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to produce the percentage of sequence identity. The subject matter disclosed herein covers nucleotide sequences substantially identical to those disclosed herein.

[0074] As used herein, the terms “individual,” “patient,” and “subject” are used interchangeably to refer to any member of any animal species, including but not limited to birds, humans, and other primates, as well as other mammals, including commercially relevant mammals or animal models such as mice, rats, monkeys, cattle, pigs, horses, sheep, cats, and dogs. Preferably, the subject is a human.

[0075] As used herein, the terms “treat,” “treatment,” etc., refer to methods or procedures taken to provide relief or reduction of the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, “treat” and “treatment” can include prevention, management, preventive treatment, and / or suppression or reduction of the number, severity, and / or frequency of one or more symptoms of a disease in a subject.

[0076] As used herein, when referring to RNAi agents, the phrase “introduction into cells” means the functional delivery of the RNAi agent into cells. The phrase “functional delivery” means the delivery of the RNAi agent into cells in a manner that enables the RNAi agent to have the desired biological activity (e.g., sequence-specific inhibition of gene expression).

[0077] Unless otherwise stated, as used herein, symbols The use of means that any one or more groups that fall within the scope of the subject matter described herein may be connected to it.

[0078] As used herein, the term "isomer" refers to compounds with the same molecular formula but different atomic bonding properties or sequences, or different spatial arrangements of their atoms. Isomers with different spatial arrangements of atoms are called "stereoisomers." Stereoisomers that are not mirror images of each other are called "diastereomers," and stereoisomers that are not mirror images of each other are called "enantiomers," or sometimes optical isomers. The carbon atom bonded to four different substituents is called the "chiral center."

[0079] As used herein, unless explicitly identified in the structure as having a particular conformation, for each structure in which an asymmetric center is present and thereby produces enantiomers, diastereomers, or other stereoisomers, each structure disclosed herein is intended to represent all such possible isomers, including their optically pure and racemic forms. For example, the structures disclosed herein are intended to cover mixtures of diastereomers as well as single stereoisomers.

[0080] As used in the claims herein, the phrase “consisting of” excludes any element, step, or ingredient not specified in the claims. When used in the claims herein, the phrase “consisting substantially of” limits the scope of the claims to the specified materials or steps and those materials or steps that do not substantially affect the essential and novel features of the claimed invention.

[0081] Those skilled in the art will readily understand and recognize that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state, depending on the environment in which the compound or composition is situated. Therefore, as used herein, the structures disclosed contemplate that certain functional groups (e.g., OH, SH, or NH) may be protonated or deprotonated. As those skilled in the art will readily understand, the disclosure herein is intended to cover the disclosed compounds and compositions regardless of their protonated state based on the environment (e.g., pH). Accordingly, compounds described herein having unstable protons or basic atoms should also be understood to represent salt forms of the corresponding compounds. The compounds described herein may be in the form of free acids, free bases, or salts. Pharmaceutically acceptable salts of the compounds described herein should be understood to be within the scope of this invention.

[0082] As used herein, when referring to the connection between two compounds or molecules, the terms “connected” or “combined” mean that the two compounds or molecules are joined by a covalent bond. Unless otherwise stated, the terms “connected” and “combined” as used herein may refer to the connection between a first compound and a second compound, with or without any intermediate atoms or groups.

[0083] As used herein, the term "including" is used to refer to the phrase "including but not limited to" and is used interchangeably with it. Unless the context clearly indicates otherwise, the term "or" is used to refer to the term "and / or" and is used interchangeably with it.

[0084] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While similar or equivalent methods and materials may be used in the practice or testing of this invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. In case of conflict, this specification (including definitions) shall prevail. Furthermore, materials, methods, and examples are illustrative only and not intended to be limiting.

[0085] When values ​​are explicitly listed, it should be understood that values ​​of approximately the same quantity or amount as the listed values ​​are also within the scope of this disclosure. When a combination is disclosed, each sub-combination of the elements of that combination is also specifically disclosed and within the scope of this disclosure. Conversely, when different elements or groups of elements are disclosed individually, their combinations are also disclosed. When any element of the disclosure is disclosed as having multiple alternatives, instances in which each alternative is excluded individually or in arbitrary combination with other alternatives are also disclosed; more than one element of this disclosure may have such exclusions, and all combinations of elements having such exclusions are thus disclosed.

[0086] When referring to measurable values ​​such as parameters, quantities, durations of time, etc., the terms “approximately” or “roughly” as used herein mean a variation of + / -20% or less, + / -10% or less, + / -5% or less, or + / -1% or less of the specified value, provided that such variation is suitable for implementation in this disclosure. It is to be understood that the value referred to by the modifier “approximately” or “roughly” is itself. For example, “approximately 4” includes 4.

[0087] Other objects, features, embodiments, and advantages of the present invention will become apparent from the following detailed description, drawings, and claims.

[0088] RNAi agents This document describes RNAi agents for inhibiting INHBE gene expression. Each INHBE RNAi agent comprises a sense strand and an antisense strand. The sense strand can be 15 to 49 nucleotides in length. The antisense strand can be 18 to 49 nucleotides in length. The sense strand and antisense strand can be the same length, or they can be different lengths. In some embodiments, the sense strand and antisense strand are each independently 18 to 27 nucleotides in length. In some embodiments, the sense strand and antisense strand are each 21-26 nucleotides in length. In some embodiments, the sense strand and antisense strand are each 21-24 nucleotides in length. In some embodiments, the sense strand and antisense strand are each independently 19-21 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length, and the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length, and the antisense strand is about 23 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides long and the antisense strand is 21 nucleotides long. In some embodiments, both the sense strand and the antisense strand are 21 nucleotides long. In some embodiments, the length of the antisense strand of the RNAi agent is 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long. In some embodiments, the length of the sense strand of the RNAi agent is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides long. The sense and antisense strands are annealed to form a double strand, and in some embodiments, the double-stranded RNAi agent has a double strand length of approximately 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.

[0089] Examples of nucleotide sequences for forming the INHBE RNAi agent are provided in Tables 2, 3, 4, and 5C. Examples of RNAi agent duplexes including the sense and antisense strand sequences in Tables 2, 3, 4, and 5C are shown in Tables 5A, 5B, and 5C.

[0090] In some embodiments, the region of complete, substantially or partially complementary complementarity between the sense and antisense strands is 15-26 nucleotides in length (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleotides) and is located at or near the 5' end of the antisense strand (e.g., this region may be separated from the 5' end of the antisense strand by 0, 1, 2, 3 or 4 incompletely complementary, substantially complementary or partially complementary nucleotides).

[0091] The sense strand of the INHBE RNAi agent described herein comprises at least 15 consecutive nucleotides, which has at least 85% identity with the core sequence (also referred to herein as the "core segment" or "core sequence") of the same number of nucleotides in the INHBE mRNA. In some embodiments, the sense strand core sequence is 100% (completely) complementary to or at least about 85% (substantially) complementary to the core sequence in the antisense strand, and thus the sense strand core sequence is generally identical or at least about 85% identical to a nucleotide sequence of the same length present in the INHBE mRNA target (sometimes referred to, for example, the target sequence). In some embodiments, the length of the sense strand core segment is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the length of the sense strand core segment is 17 nucleotides. In some embodiments, the length of the sense strand core segment is 19 nucleotides.

[0092] The antisense strand of the INHBE RNAi agent described herein comprises at least 15 consecutive nucleotides, which is at least 85% complementary to the core segment of the same number of nucleotides in the INHBE mRNA and the core segment of the corresponding sense strand. In some embodiments, the antisense strand core segment is 100% (completely) complementary or at least about 85% (substantially) complementary to a nucleotide sequence of the same length present in the INHBE mRNA target (e.g., the target sequence). In some embodiments, the length of the antisense strand core segment is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the length of the antisense strand core segment is 19 nucleotides. In some embodiments, the length of the antisense strand core segment is 17 nucleotides. The sense strand core segment sequence may have the same length as the corresponding antisense core sequence, or it may have a different length.

[0093] The sense and antisense strands of an INHBE RNAi agent anneal to form a double helix. The sense and antisense strands of an INHBE RNAi agent can be partially, substantially, or completely complementary to each other. Within the complementary double helix region, the sense core sequence is at least 85% or 100% complementary to the antisense core sequence. In some embodiments, the sense core sequence contains a sequence of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 nucleotides, said sequence being at least 85% or 100% complementary to the corresponding 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotide sequences of the antisense core sequence (i.e., the sense and antisense core sequences of the INHBE RNAi agent have regions of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 nucleotides with at least 85% or 100% base pairing).

[0094] In some embodiments, the antisense strand of the INHBE RNAi agent disclosed herein differs from any of the antisense strand sequences in Tables 2, 3, or 5C by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the INHBE RNAi agent disclosed herein differs from any of the sense strand sequences in Tables 2, 4, or 5C by 0, 1, 2, or 3 nucleotides.

[0095] In some implementations, the sense strand and / or antisense strand may optionally and independently contain additional 1, 2, 3, 4, 5, or 6 nucleotides (extensions) at the 3', 5', or 3' and 5' ends of the core sequence. The antisense strand nucleotides (if present) may be complementary to or not complementary to the corresponding sequence in the INHBE mRNA. The sense strand nucleotides (if present) may be identical to or different from the corresponding sequence in the INHBE mRNA. The antisense strand nucleotides (if present) may be complementary to or not complementary to the corresponding sense strand nucleotides (if present).

[0096] As used herein, the extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' ends of the sense strand core sequence and / or antisense strand core sequence. The extended nucleotides on the sense strand may be complementary or non-complementary to the nucleotides (core sequence nucleotides or extended nucleotides) in the corresponding antisense strand. Conversely, the extended nucleotides on the antisense strand may be complementary or non-complementary to the nucleotides (core sequence nucleotides or extended nucleotides) in the corresponding sense strand. In some embodiments, both the sense and antisense strands of the RNAi agent contain 3' and 5' extensions. In some embodiments, one or more 3' extended nucleotides of one strand pair with one or more 5' extended nucleotide bases of the other strand. In other embodiments, one or more 3' extended nucleotides of one strand do not pair with one or more 5' extended nucleotide bases of the other strand. In some embodiments, the INHBE RNAi agent comprises an antisense strand with a 3' extension and a sense strand with a 5' extension. In some embodiments, the extended nucleotides are unpaired and form overhangs. As used herein, "protruding end" refers to one or more unpaired nucleotides located at the end of the sense or antisense strand that do not form part of the hybrid or double-stranded portion of the RNAi agent disclosed herein.

[0097] In some embodiments, the INHBE RNAi agent comprises a 3' extended antisense strand having a length of 1, 2, 3, 4, 5, or 6 nucleotides. In other embodiments, the INHBE RNAi agent comprises a 3' extended antisense strand having a length of 1, 2, or 3 nucleotides. In some embodiments, one or more of the antisense strand extended nucleotides comprise nucleotides complementary to the corresponding INHBE mRNA sequence. In some embodiments, one or more of the antisense strand extended nucleotides comprise nucleotides not complementary to the corresponding INHBE mRNA sequence.

[0098] In some embodiments, the INHBE RNAi agent comprises a 3' extended sense strand having a length of 1, 2, 3, 4, or 5 nucleotides. In some embodiments, one or more of the sense strand extending nucleotides comprise adenosine, uracil, or thymidine nucleotides, AT dinucleotides, or nucleotides corresponding to or identical to nucleotides in the INHBE mRNA sequence. In some embodiments, the 3' sense strand extension comprises, but is not limited to, one of the following sequences: T, UT, TT, UU, UUT, TTT, or TTTT (each listed from 5' to 3').

[0099] The sense strand may have a 3' extension and / or a 5' extension. In some embodiments, the INHBE RNAi agent comprises a sense strand with a 5' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides contain nucleotides that correspond to or are identical to nucleotides in the INHBE mRNA sequence.

[0100] Examples of sequences for forming INHBE RNAi agents are provided in Tables 2, 3, 4, and 5C. In some embodiments, the antisense strand of the INHBE RNAi agent comprises a sequence from any of the sequences in Tables 2, 3, or 5C. In some embodiments, the antisense strand of the INHBE RNAi agent comprises or consists of any of the modified sequences in Table 3. In some embodiments, the antisense strand of the INHBE RNAi agent comprises the sequence of nucleotides at positions 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 (5' to 3') from any of the sequences in Tables 2, 3, or 5C. In some embodiments, the sense strand of the INHBE RNAi agent comprises a sequence from any of the sequences in Tables 2, 4, or 5C. In some embodiments, the sense strand of the INHBE RNAi agent comprises the sequence of nucleotides at positions 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 (5' to 3' end) of any of the sequences in Tables 2, 4, or 5C. In some embodiments, the sense strand of the INHBE RNAi agent comprises or consists of a modified sequence of any of the modified sequences in Table 4.

[0101] As used herein, "blunt-end" refers to the end of a double-stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (forming complementary base pairs). In some embodiments, the sense and antisense strands of the RNAi agent described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agent described herein contain different numbers of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent are blunt-ended. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi agent are blunt-ended. In some embodiments, both ends of the RNAi agent are blunt-ended. In some embodiments, neither end of the RNAi agent is blunt-ended.

[0102] As used herein, a "frayed end" refers to the end of a double-stranded RNAi agent in which the terminal nucleotides of the two annealed strands originate from a pair (i.e., do not form overhangs) but are not complementary (i.e., form non-complementary pairs). In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent form a frayed end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi agent form a frayed end. In some embodiments, both ends of the RNAi agent form frayed ends. In some embodiments, neither end of the RNAi agent is a frayed end. In some embodiments, one or more unpaired nucleotides at the end of one strand of the double-stranded RNAi agent form overhangs. The unpaired nucleotides can be on either the sense strand or the antisense strand, producing 3' or 5' overhangs. In some implementations, the RNAi agent contains: a blunt end and a loose end, a blunt end and a 5' overhang, a blunt end and a 3' overhang, a loose end and a 5' overhang, a loose end and a 3' overhang, two 5' overhangs, two 3' overhangs, a 5' overhang and a 3' overhang, two loose ends, or two blunt ends. Typically, when present, the overhangs are located at the 3' end of the sense strand, the antisense strand, or both the sense and antisense strands.

[0103] The INHBE RNAi agents disclosed herein may also comprise one or more modified nucleotides. In some embodiments, substantially all nucleotides of the sense strand and substantially all nucleotides of the antisense strand of the INHBE RNAi agent are modified nucleotides. The INHBE RNAi agents disclosed herein may further comprise one or more modified internucleotide links, such as one or more phosphate thioides or phosphate dithioides links. In some embodiments, the INHBE RNAi agent contains one or more modified nucleotides and one or more modified internucleotide links. In some embodiments, a 2'-modified nucleotide is combined with a modified internucleotide link.

[0104] In some embodiments, the INHBE RNAi agent is prepared or provided as a salt, a mixed salt, or a free acid. In some embodiments, the INHBE RNAi agent is prepared as a pharmaceutically acceptable salt. In some embodiments, the INHBE RNAi agent is prepared as a pharmaceutically acceptable sodium salt. Such forms known in the art are within the scope of the invention disclosed herein.

[0105] Modified nucleotides When used in various oligonucleotide constructs, the modified nucleotides can maintain the activity of the compounds in cells, improve the serum stability of these compounds, and minimize the possibility of activating interferon activity in humans after administration of the oligonucleotide constructs.

[0106] In some embodiments, the INHBE RNAi agent contains one or more modified nucleotides. As used herein, a “modified nucleotide” is a nucleotide other than a ribonucleotide (2'-hydroxynucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides may include, but are not limited to, deoxyribonucleotides, nucleotide mimics, baseless nucleotides, 2'-modified nucleotides, reverse nucleotides, nucleotides containing modified nucleobases, bridging nucleotides, peptide nucleic acids (PNAs), 2',3'-open-ring nucleotide mimics (unlocked nucleobase analogs), locked nucleotides, 3'-O-methoxy (2' nucleoside-linked) nucleotides, 2'-F-arabinonucleotides, 5'-Me,2'-fluoronucleotides, morpholinonucleotides, vinylphosphonate deoxyribonucleotides, nucleotides containing vinylphosphonates, and nucleotides containing cyclopropylphosphonates. 2'-Modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides, 2'-fluoronucleotides (also referred to herein as 2'-deoxy-2'-fluoronucleotides), 2'-deoxynucleotides, 2'-methoxyethyl (2'-O-2-methoxyethyl) nucleotides (also referred to as 2'-MOE), 2'-amino nucleotides, and 2'-alkyl nucleotides. All positions in a given compound need not be uniformly modified. Instead, more than one modification may be incorporated into a single INHBE RNAi agent or even into a single nucleotide. Sense and antisense strands of INHBE RNAi agents can be synthesized and / or modified using methods known in the art. Modification at one nucleotide is independent of modification at another nucleotide.

[0107] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, adenine, and guanine 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives, adenine and guanine 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives, 2-thiouracil, 2- Thiothymine, 2-thiocytosine, 5-halogenated uracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halogenated, 8-amino, 8-mercapto, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halogenated (e.g., 5-bromo), 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazoguanine, 7-deazoadenine, 3-deazoguanine and 3-deazoadenine.

[0108] In some embodiments, the 5' and / or 3' ends of the antisense strand may include a baseless residue (Ab), also referred to as a "baseless site" or "baseless nucleotide." A baseless residue (Ab) is a nucleotide or nucleoside lacking a nucleobase at the 1' position of the sugar moiety. In some embodiments, the baseless residue may be placed inside the nucleotide sequence. In some embodiments, Ab or AbAb may be added to the 3' end of the antisense strand. In some embodiments, the 5' end of the sense strand may include one or more additional baseless residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb, or Ab is added to the 3' end of the sense strand. In some embodiments, the baseless (deoxyribose) residue may be replaced with a ribitol (baseless ribose) residue.

[0109] In some embodiments, all or substantially all nucleotides of the RNAi agent are modified nucleotides. As used herein, an RNAi agent in which substantially all nucleotides are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) ribonucleotides (i.e., unmodified) in both the sense and antisense strands. As used herein, a sense strand in which substantially all nucleotides are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) unmodified ribonucleotides in the sense strand. As used herein, an antisense strand in which substantially all nucleotides are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) unmodified ribonucleotides in the antisense strand. In some embodiments, one or more nucleotides of the RNAi agent are unmodified ribonucleotides. The chemical structures of some modified nucleotides are listed in Table 6 herein.

[0110] Modified nucleoside interlinking In some implementations, one or more nucleotides of the INHBE RNAi agent are linked via non-standard ligation or main chain (i.e., modified nucleoside-to-nucleotide ligation or modified main chain). Modified nucleoside links or backbones include, but are not limited to, thiophosphate groups (represented herein as lowercase "s"), dithiophosphate groups (represented herein as lowercase "ss"), chiral thiophosphates, thiophosphates, dithiophosphates, phosphate triesters, aminoalkyl-phosphate triesters, alkylphosphonates (e.g., methylphosphonates or 3'-alkylenephosphonates), chiral phosphonates, hypophosphonates, aminophosphates (e.g., 3'-aminoaminophosphates, aminoalkylaminophosphates, or thionophosphoramidates), thioalkylphosphonates, thioalkylphosphate triesters, morpholino links, borane phosphates with normal 3'-5' links, 2'-5' linked analogs of borane phosphates, or borane phosphates with reverse polarity, wherein adjacent nucleoside unit pairs are linked by 3'-5' to 5'-3' or 2'-5' to 5'-2'. In some embodiments, the modified nucleoside links or backbones lack a phosphorus atom. Modified internucleotide linkages lacking phosphorus atoms include, but are not limited to, linkages between short-chain alkyl or cycloalkyl sugars, linkages between mixed heteroatoms and alkyl or cycloalkyl sugars, or linkages between one or more short-chain heteroatoms or heterocyclic sugars. In some embodiments, the modified internucleotide backbone includes, but is not limited to, siloxane backbones, sulfide backbones, sulfone backbones, methylacetyl and thiomethylacetyl backbones, methylenemethylacetyl and thiomethylacetyl backbones, olefin-containing backbones, aminosulfonate backbones, methyleneimino and methylenehydrazine backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2 components.

[0111] In some embodiments, the sense strand of the INHBE RNAi agent may contain 1, 2, 3, 4, 5, or 6 thiophosphate or dithiophosphate links, and the antisense strand of the INHBE RNAi agent may contain 1, 2, 3, 4, 5, or 6 thiophosphate or dithiophosphate links, or both the sense and antisense strands may independently contain 1, 2, 3, 4, 5, or 6 thiophosphate or dithiophosphate links. In some embodiments, the sense strand of the INHBE RNAi agent may contain 1, 2, 3, or 4 thiophosphate or dithiophosphate links, and the antisense strand of the INHBE RNAi agent may contain 1, 2, 3, or 4 thiophosphate or dithiophosphate links, or both the sense and antisense strands may independently contain 1, 2, 3, or 4 thiophosphate or dithiophosphate links.

[0112] In some embodiments, the sense strand of the INHBE RNAi agent contains at least two phosphate-thiophosphate or phosphate-dithiophosphate nucleoside links. In some embodiments, the phosphate-thiophosphate or phosphate-dithiophosphate nucleoside links are located between nucleotides at positions 1-3 starting from the 3' end of the sense strand. In some embodiments, one phosphate-thiophosphate or phosphate-dithiophosphate nucleoside link is located at the 5' end of the sense strand nucleotide sequence, and another phosphate-thiophosphate or phosphate-dithiophosphate link is located at the 3' end of the sense strand nucleotide sequence. In some embodiments, two phosphate-thiophosphate or phosphate-dithiophosphate nucleoside links are located at the 5' end of the sense strand, and another phosphate-thiophosphate or phosphate-dithiophosphate link is located at the 3' end of the sense strand. In some embodiments, the sense strand does not contain any phosphate-thiophosphate or phosphate-dithiophosphate nucleoside links between nucleotides, but contains one, two, or three phosphate-thiophosphate or phosphate-dithiophosphate links between the terminal nucleotides at both the 5' and 3' ends and optionally present reverse abase-free end caps. In some implementations, the targeting ligand is linked to the sense chain via a thiophosphate or dithiophosphate.

[0113] In some embodiments, the antisense strand of the INHBE RNAi agent contains four phosphate-thiophosphate or dithiophosphate nucleoside links. In some embodiments, the four phosphate-thiophosphate or dithiophosphate nucleoside links are between nucleotides at positions 1-3 from the 5' end of the antisense strand and between nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end. In some embodiments, three phosphate-thiophosphate or dithiophosphate nucleoside links are located between positions 1-4 from the 5' end of the antisense strand, and a fourth phosphate-thiophosphate or dithiophosphate nucleoside link is located between positions 20-21 from the 5' end of the antisense strand. In some embodiments, the INHBE RNAi agent contains at least three or four phosphate-thiophosphate or dithiophosphate nucleoside links in the antisense strand.

[0114] Capped residues or parts In some embodiments, the sense chain may include one or more capping residues or portions, sometimes referred to in the art as “cap,” “terminal cap,” or “capped residue.” As used herein, a “capped residue” is a nonnucleotide compound or other portion that may be incorporated at one or more ends of the nucleotide sequence of an RNAi agent disclosed herein. In some cases, capping residues may provide certain beneficial properties to the RNAi agent, such as protection against exonuclease degradation. In some embodiments, an inverse abase-free residue (invAb) (also referred to in the art as an “inverse abase-free site”) is added as a capping residue. (See, for example, F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16; U.S. Patent No. 5,998,203). Capping residues are generally known in the art and include, for example, inverse abase-free residues and carbon chains, such as terminal C3H7 (propyl), C6H… 13 (Hexyl) or C 12 H 25 (Dodecyl) group. In some embodiments, the capping residue is located at the 5' end, 3' end, or both of the sense chain. In some embodiments, the 5' end and / or 3' end of the sense chain may contain more than one reverse abase-free deoxyribose moiety as a capping residue.

[0115] In some embodiments, one or more inverse abase residues (invAbs) are added to the 3' end of the sense strand. In some embodiments, one or more inverse abase residues (invAbs) are added to the 5' end of the sense strand. In some embodiments, one or more inverse abase residues or inverse abase sites are inserted between the nucleotide sequences of the sense strands of the targeting ligand and the RNAi agent. In some embodiments, the inclusion of one or more inverse abase residues or inverse abase sites at or near one or more ends of the sense strand of the RNAi agent enables enhancement of the activity or other desired properties of the RNAi agent.

[0116] In some embodiments, one or more inverse abase residues (invAbs) are added to the 5' end of the sense strand. In some embodiments, one or more inverse abase residues may be inserted between the nucleotide sequence of the sense strand of the targeting ligand and the RNAi agent. Inverse abase residues may be linked via phosphate esters, thiophosphate esters (e.g., shown herein as (invAbs)s), dithiophosphate esters, or other linkages. In some embodiments, the inclusion of one or more inverse abase residues at or near one or more ends of the sense strand of the RNAi agent enhances the activity or other desired properties of the RNAi agent. In some embodiments, the inverse abase (deoxyribose) residues may be replaced with inverse ribitol (abase-free ribose) residues. In some embodiments, the 3' end of the core segment sequence of the antisense strand or the 3' end of the antisense strand sequence may include inverse abase residues. The chemical structures of the inverse abase deoxyribose residues are shown in Table 6 below.

[0117] INHBE RNAi agent The INHBE RNAi agents disclosed in this article are designed to target specific locations on the INHBE gene (e.g., SEQ ID NO: 1).

[0118] NM_031479.5 Human inhibin subunit βE (INHBE), mRNA transcript (SEQ ID NO: 1): 1 agtagccaga catgagctgt gagggtcaag cacagctatc catcagatga tctactttca 61 gccttcctga gtcccagaca atagaagaca ggtggctgta cccttggcca agggtaggtg 121 tggcagtggt gtctgctgtc actgtgccct cattggcccc cagcaatcag actcaacaga 181 cggagcaact gccatccgag gctcctgaac cagggccatt caccaggagc atgcggctcc 241 ctgatgtcca gctctggctg gtgctgctgt gggcactggt gcgagcacag gggacagggt 301 ctgtgtgtcc ctcctgtggg ggctccaaac tggcacccca aggaacga gctctggtgc 361 421 ctcatcctcc accccaggca gcgctgacca gagccctccg gagactacag ccagggagtg 481 tggctccagg gaatggggag gaggtcatca gctttgctac tgtcacagac tccacttcag 541 cctacagctc cctgctcact tttcacctgt ccactcctcg gtcccaccac ctgtaccatg 601 cccgcctgtg gctccacgtg ctccccaccc ttcctggcac tctttgcttg aggatcttcc 661 gatgggggacc aaggaggagg cgccaagggt cccgcactct cctggctgag caccacatca 721 ccaacctggg ctggcatacc ttaactctgc cctctagtgg cttgaggggt gagaagtctg 781 841 aaccgaggcg gctcttggac acagcaggac accagcagcc cttcctagag cttaagatcc 901 gagccaatga gcctggagca ggccgggcca ggaggaggac ccccacctgt gagcctgcga 961 cccccttatg ttgcaggcga gaccattacg tagacttcca ggaactggga tggcgggact 1021 ggatactgca gcccgagggg taccagctga attactgcag tgggcagtgccctccccacc 1081 tggctggcag cccaggcatt gctgcctctt tccattctgc cgtcttcagcctcctcaaag 1141 ccaacaatcc ttggcctgcc agtacctcct gttgtgtccc tactgcccgaaggcccctct 1201 ctctcctcta cctggatcat aatggcaatg tggtcaagac ggatgtgccagatatggtgg 1261 tggaggcctg tggctgcagc tagcaagagg acctggggct ttggagtgaagagaccaaga 1321 tgaagtttcc caggcacagg gcatctgtga ctggaggcat cagattcctgatccacaccc 1381 caacccaaca accacctggc aatatgactc acttgacccc tatgggacccaaatgggcac 1441 tttcttgtct gagactctgg cttattccag gttggctgat gtgttgggagatgggtaaag 1501 cgtttcttct aaaggggtct acccagaaag catgatttcc tgccctaagtcctgtgagaa 1561 gatgtcaggg actagggagg gagggaggga aggcagagaa aaattacttagcctctccca 1621 agatgagaaa gtcctcaagt gaggggagga ggaagcagat agatggtccagcaggcttga 1681 agcagggtaa gcaggctggc ccagggtaag ggctgttgag gtaccttaagggaaggtcaa 1741 gagggagatg ggcaaggcgc tgagggagga tgcttagggg acccccagaaacaggagtca 1801 ggaaaatgag gcactaagcc taagaagttc cctggttttt cccaggggacaggacccact 1861 gggagacaag catttatact ttctttcttc ttttttatt tttgagatcgagtctcgct 1921 ctgtcaccag gctggagtgc agtgacacga tcttggctca ctgcaacctccgtctcctgg 1981 gttcaagtga ttcttctgcc tcagcctccc gagcagctgg gattacaggcgcccactaat 2041 ttttgtattc ttagtagaaa cgaggtttca acatgttggc caggatggtctcaatctctt 2101 gacctcttga tccacccgac ttggcctccc gaagtgatga gattataggcgtgagccacc 2161 gcgcctggct tatactttct tataaaaag gagaaagaaa atcaaaaatgtgagtcata 2221 aagaagggtt agggtgatgg tccagagcaa cagttcttca agtgtactctgtaggcttct 2281 gggaggtccc ttttcagggg tgtccacaaa gtcaaagcta tttcataataactaaca 2341 tgttatttgc cttttgaatt ctcattatct taaaattgta ttgtggagttttccagaggc 2401 cgtgtgacat gtgattacat catctttctg acatcattgt taatggaatgtgtgcttgta As defined herein, antisense sequences are designed to target the INHBE gene at a given location on the gene when paired with gene bases, such that the 5' terminal nucleobase of the antisense strand aligns with the position 21 nucleotides downstream (towards the 3' end) from that location on the gene. For example, as shown in Tables 1 and 2 herein, an antisense sequence designed to target the INHBE gene at position 1322 requires that the 5' terminal nucleobase of the antisense strand align with position 1342 of the INHBE gene when paired with gene bases.

[0119] As provided herein, the INHBE RNAi agent does not require the nucleotide at position 1 (5'→3') of the antisense strand to be complementary to the gene, provided that the antisense strand has at least 85% complementarity with the gene over a core sequence of at least 16 consecutive nucleotides (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% complementarity). For example, for the INHBE RNAi agent disclosed herein designed to target position 402 of the INHBE gene, the 5' nucleotide of the antisense strand of the INHBE RNAi agent is aligned with position 422 of the gene; however, the 5' nucleotide of the antisense strand may, but is not required to, be complementary to position 422 of the INHBE gene, provided that the antisense strand has at least 85% complementarity with the gene over a core sequence of at least 16 consecutive nucleotides (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity). In particular, as shown in the various examples disclosed herein, the specific site of gene binding by the antisense strand of the INHBE RNAi agent (e.g., whether the INHBE RNAi agent is designed to target the INHBE gene at position 402, position 520, or other positions) is important for the level of repression achieved by the INHBE RNAi agent.

[0120] In some embodiments, the INHBE RNAi agent disclosed herein targets the INHBE gene at or near the location of the INHBE gene sequence shown in Table 1. In some embodiments, the antisense strand of the INHBE RNAi agent disclosed herein includes a core sequence that is fully complementary, substantially complementary, or at least partially complementary to the target INHBE 19mer sequence disclosed in Table 1.

[0121] Table 1. Target sequence of INHBE 19-mer mRNA (derived from human inhibin subunit βE (INHBE), mRNA, GenBank NM_031479.5 (SEQ ID NO: 1)) In some embodiments, the INHBE RNAi agent includes an antisense strand, wherein position 19 (5'→3') of the antisense strand is capable of forming a base pair with position 1 of the 19-mer target sequence disclosed in Table 1.

[0122] In some embodiments, the INHBE RNAi agent includes an antisense strand, wherein position 2 (5'→3') of the antisense strand is capable of forming a base pair with position 18 of the 19-mer target sequence disclosed in Table 1. In some embodiments, the INHBE RNAi agent includes an antisense strand, wherein positions 2 to 18 (5'→3') of the antisense strand are capable of forming a base pair with each of the corresponding complementary bases at positions 18 to 2 of the 19-mer target sequence disclosed in Table 1.

[0123] For the RNAi agents disclosed herein, the nucleotide at position 1 (5' to 3') of the antisense strand may be perfectly complementary to the INHBE gene or may not be complementary to the INHBE gene. In some embodiments, the nucleotide at position 1 (5' to 3') of the antisense strand is U, A, or dT. In some embodiments, the nucleotide at position 1 (5' to 3') of the antisense strand forms an A:U or U:A base pair with the sense strand.

[0124] In some embodiments, the INHBE RNAi antisense strand comprises the nucleotide sequence (5' to 3') at positions 2-18, 2-19, 2-20, or 2-21 of any of the antisense strand sequences in Tables 2, 3, or 5C. In some embodiments, the INHBE RNAi sense strand comprises the nucleotide sequence (5' to 3') at positions 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18, or 1-18 of any of the sense strand sequences in Tables 2, 4, or 5C.

[0125] In some embodiments, the INHBE RNAi antisense strand comprises the nucleotide sequence (5' to 3') at positions 2-18, 2-19, 2-20, or 2-21 of any of the antisense strand sequences in Tables 2, 3, or 5C. In some embodiments, the INHBE RNAi sense strand comprises the nucleotide sequence (5' to 3') at positions 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18, or 1-18 of any of the sense strand sequences in Tables 2, 4, or 5C.

[0126] In some implementations, the INHBE RNAi agent comprises: (i) an antisense strand comprising the nucleotide sequence (5' to 3') at positions 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the nucleotide sequence (5' to 3') at positions 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18, or 1-18 of any of the sense strand sequences in Table 2 or Table 4.

[0127] In some implementations, the INHBE RNAi agent includes the core 19-mer nucleotide sequence shown in Table 2 below.

[0128] Table 2. Base sequences of the antisense and sense strands of INHBE RNAi agents (N = any nucleobase; I = inosine nucleotide; (A = hypoxanthine) 2N ) = 2-aminoadenine nucleotide) The sense and antisense strands of an INHBE RNAi agent containing or composed of sequences from Table 2 can be modified or unmodified nucleotides. In some embodiments, an INHBE RNAi agent having sense and antisense strand sequences containing or composed of sequences from Table 2 is wholly or substantially entirely composed of modified nucleotides.

[0129] In some embodiments, the antisense strand of the INHBE RNAi agent disclosed herein differs from any of the antisense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the INHBE RNAi agent disclosed herein differs from any of the sense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides.

[0130] As used herein, each N listed in the sequences disclosed in Table 2 may be independently selected from any and all nucleobases (including those present on modified and unmodified nucleotides). In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleobases complementary to the N nucleotides at the corresponding positions on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleobases not complementary to the N nucleotides at the corresponding positions on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have the same nucleobases as the N nucleotides at the corresponding positions on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleobases different from the N nucleotides at the corresponding positions on the other strand.

[0131] Table 3 provides the antisense strands of some modified INHBE RNAi agents and their underlying unmodified nucleobase sequences. Table 4 provides the sense strands of some modified INHBE RNAi agents and their underlying unmodified nucleobase sequences. In the formation of INHBE RNAi agents, each nucleotide in each underlying sequence listed in Tables 3 and 4 above, as well as Table 2, can be a modified nucleotide.

[0132] The INHBE RNAi agent described herein is formed by annealing the antisense strand with the sense strand. A sense strand containing a sequence listed in Table 2 or Table 4 may hybridize with any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences have regions with at least 85% complementarity over 16, 17, 18, 19, 20, or 21 consecutive nucleotide sequences.

[0133] In some implementations, the antisense strand of the INHBE RNAi agent contains a nucleotide sequence from any of the sequences in Table 2 or Table 3.

[0134] In some embodiments, the INHBE RNAi agent comprises or consists of a duplex having or composed of a sense strand and an antisense strand nucleobase sequence having any one of the sequences in Table 2, Table 3 or Table 4.

[0135] Examples of antisense strands containing modified nucleotides are provided in Tables 3 and 5C. Examples of sense strands containing modified nucleotides are provided in Tables 4 and 5C.

[0136] As used in Tables 3, 4, and 5C, the following symbols are used to represent modified nucleotides and linker groups: A = adenosine-3'-phosphate C = cytidine-3'-phosphate G = guanosine-3'-phosphate U = uridine-3'-phosphate I = Inosine-3'-phosphate a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-thiophosphate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-thiophosphate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-thiophosphate t = 2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-thiophosphate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-thiophosphate i = 2'-O-methylinosine-3'-phosphate is = 2'-O-methylinosine-3'-thiophosphate iss = 2'-O-methylinosine-3'-dithiophosphate Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-Fluoroadenosine-3'-Thiophosphate Cf = 2'-Fluorocytidine-3'-phosphate Cfs = 2'-Fluorocytidine-3'-Thiophosphate Gf = 2'-Fluoroguanosine-3'-phosphate Gfs = 2'-Fluoroguanosine-3'-Thiophosphate Tf = 2'-Fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-fluoro-5'-methyluridine-3'-thiophosphate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-thiophosphate A UNA = 2',3'-Octopylated adenosine-3'-phosphate (see Table 6) A UNA s = 2',3'-open-chain adenosine-3'-thiophosphate (see Table 6) C UNA = 2',3'-Octopycyl-3'-phosphate (see Table 6) C UNA s = 2',3'-open-cytidine-3'-thiophosphate (see Table 6) G UNA = 2',3'-Octopyguanosine-3'-phosphate (see Table 6) G UNA s = 2',3'-Octoprosine-3'-thiophosphate (see Table 6) U UNA = 2',3'-open-ring uridine-3'-phosphate (see Table 6) U UNA s = 2',3'-open-ring uridine-3'-thiophosphate (see Table 6) a_2N = 2'-O-methyl-2-aminoadenosine-3'-phosphate (see Table 6) a_2Ns = 2'-O-methyl-2-aminoadenosine-3'-thiophosphate (see Table 6) (invAb) = inverse abase-free deoxyribonucleotide (see Table 6) (invAb)s = inverse abase-free deoxyribonucleotide-5'-thiophosphate (see Table 6) cPrpa = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-phosphate (see Table 6) cPrpas = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-thiophosphate (see Table 6) cPrpu = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-phosphate (see Table 6) cPrpus = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-thiophosphate (see Table 6) dT = 2'-deoxythymidine-3'-phosphate dTs = 2'-deoxythymidine-3'-thiophosphate dTss = 2'-deoxythymidine-3'-dithiophosphate dU = 2'-deoxyuridine-3'-phosphate dUs = 2'-deoxyuridine-3'-thiophosphate dUss = 2'-deoxyuridine-3'-dithiophosphate dC = 2'-deoxycytidine-3'-phosphate dCs = 2'-deoxycytidine-3'-thiophosphate dG = 2'-deoxyguanosine-3'-phosphate dGs = 2'-deoxyguanosine-3'-thiophosphate dA = 2'-deoxyadenosine-3'-phosphate dAs = 2'-deoxyadenosine-3'-thiophosphate dAss = 2'-deoxyadenosine-3'-dithiophosphate (NAG37) = See Table 6 (NAG37)s = See Table 6 As will be readily understood by those skilled in the art, unless otherwise indicated by the sequence (e.g., via a thiophosphate linking "s"), when present in oligonucleotides, nucleotide monomers are linked to each other via 5'-3'-phosphodiester bonds. As will be clearly understood by those skilled in the art, as shown in the modified nucleotide sequences disclosed herein, the inclusion of thiophosphate or dithiophosphate links replaces the phosphodiester links typically present in oligonucleotides. Furthermore, it will be readily understood by those skilled in the art that, in vitro, the terminal nucleotide at the 3' end of a given oligonucleotide sequence typically has a hydroxyl (-OH) group at the corresponding 3' position of a given monomer, rather than a phosphate moiety. Additionally, for the various embodiments disclosed herein, when viewing the corresponding strand from 5' to 3', an inverted baseless residue is inserted such that the 3' position of the deoxyribose is linked at the 3' end of the preceding monomer on the corresponding strand (see, for example, Table 6). Furthermore, as will be readily understood and recognized by those skilled in the art, while the thiophosphate chemical structures described herein typically exhibit anion on the sulfur atom, the inventions disclosed herein cover all thiophosphate tautomers and resonance structures (e.g., where the sulfur atom has a double bond and the anion is on the oxygen atom). Unless otherwise expressly stated herein, this understanding is used when describing the INHBE RNAi agents and compositions thereof disclosed herein.

[0137] Examples of some of the targeting ligands, targeting groups, and linker groups that can be used with the INHBE RNAi agents disclosed herein are provided in Table 6 below. More specifically, the targeting groups and linker groups (which together can form a targeting ligand) include (NAG37) and (NAG37)s, the chemical structures of which are provided in Table 6 below. Each sense strand and / or antisense strand may have any of the targeting ligands, targeting groups, or linker groups listed herein, as well as other groups, conjugated to the 5' and / or 3' ends of the sequence.

[0138] Table 3. INHBE RNAi agent antisense strand sequence Table 4. Sense sequences of INHBE RNAi agents The INHBE RNAi agent described herein is formed by annealing the antisense strand with the sense strand. A sense strand containing a sequence listed in Table 2, Table 4, or Table 5C can hybridize with any antisense strand containing a sequence listed in Table 2, Table 3, or Table 5C, provided that the two sequences have regions with at least 85% complementarity over 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotide sequences.

[0139] In some embodiments, the antisense strand of the INHBE RNAi agent disclosed herein differs from any of the antisense strand sequences in Table 3 or Table 5C by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the INHBE RNAi agent disclosed herein differs from any of the sense strand sequences in Table 4 or Table 5C by 0, 1, 2, or 3 nucleotides.

[0140] In some embodiments, the INHBE RNAi agent antisense strand comprises the nucleotide sequence of any one of the sequences in Table 2, Table 3, or Table 5C. In some embodiments, the INHBE RNAi agent antisense strand comprises the nucleotide sequence (5' to 3' end) at positions 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 of any one of the sequences in Table 2, Table 3, or Table 5C. In some embodiments, the INHBE RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3 or Table 5C.

[0141] In some embodiments, the sense strand of the INHBE RNAi agent comprises the nucleotide sequence of any one of the sequences in Table 2, Table 4, or Table 5C. In some embodiments, the sense strand of the INHBE RNAi agent comprises the nucleotide sequence (5' to 3' end) at positions 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, or 4-21 of any one of the sequences in Table 2, Table 4, or Table 5C. In some embodiments, the sense strand of the INHBE RNAi agent comprises or consists of a modified sequence of any one of the modified sequences in Table 4 or Table 5C.

[0142] For the INHBE RNAi agent disclosed herein, the nucleotide at position 1 (5' to 3') of the antisense strand may be perfectly complementary to the INHBE gene or may not be complementary to the INHBE gene. In some embodiments, the nucleotide at position 1 (5' to 3') of the antisense strand is U, A, or dT (or a modified version thereof). In some embodiments, the nucleotide at position 1 (5' to 3') of the antisense strand forms an A:U or U:A base pair with the sense strand.

[0143] A sense strand containing sequences listed in Tables 2, 4, or 5C can hybridize with any antisense strand containing sequences listed in Tables 2, 3, or 5C, provided that the two sequences have regions of at least 85% complementarity over 16, 17, 18, 19, 20, or 21 consecutive nucleotide sequences. In some embodiments, the INHBE RNAi agent has a sense strand consisting of a modified sequence from any of the modified sequences in Tables 4 or 5C, and an antisense strand consisting of a modified sequence from any of the modified sequences in Tables 3 or 5C. Some representative sequence pairings are exemplified by the duplex ID Nos shown in Tables 5A, 5B, and 5C.

[0144] In some embodiments, the INHBE RNAi agent comprises, consists of, or is substantially composed of a duplex represented by any of the duplex ID Nos presented herein. In some embodiments, the INHBE RNAi agent comprises the sense and antisense nucleotide sequences of any of the duplexes represented by any of the duplex ID Nos presented herein. In some embodiments, the INHBE RNAi agent comprises the sense and antisense nucleotide sequences of any of the duplexes represented by any of the duplex ID Nos presented herein, and a targeting group and / or a linking group, wherein the targeting group and / or linking group are covalently linked (i.e., conjugated) to the sense or antisense strand. In some embodiments, the INHBE RNAi agent comprises modified sense and antisense nucleotide sequences of any of the duplex ID Nos presented herein. In some embodiments, the INHBERNAi agent comprises a sense and antisense strand modified nucleotide sequence of any of the duplex ID Nos presented herein, as well as a targeting group and / or a linking group, wherein the targeting group and / or linking group are covalently linked to the sense or antisense strand.

[0145] In some embodiments, the INHBE RNAi agent comprises an antisense strand and a sense strand having a nucleotide sequence of any one of the antisense / sense duplexes in Table 2 or Tables 5A, 5B, and 5C, and further comprises a targeting group or targeting ligand. In some embodiments, the INHBE RNAi agent comprises an antisense strand and a sense strand having a nucleotide sequence of any one of the antisense / sense duplexes in Table 2 or Tables 5A, 5B, and 5C, and further comprises a desialylate glycoprotein receptor ligand targeting group.

[0146] A targeting group, with or without a connector, may be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, or 5C. A connector, with or without a targeting group, may be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, and 5C.

[0147] In some implementations, the INHBE RNAi agent comprises an antisense strand and a sense strand having a nucleotide sequence of any one of the antisense / sense duplexes in Table 2 or Tables 5A, 5B and 5C, and further comprises a targeting ligand selected from (NAG37) and (NAG37)s (each as defined in Table 6).

[0148] In some implementations, the INHBE RNAi agent comprises an antisense strand and a sense strand having any one of the antisense strand and / or sense strand nucleotide sequences in Table 3 or Table 4.

[0149] In some embodiments, the INHBE RNAi agent comprises an antisense strand and a sense strand of a modified nucleotide sequence having any one of the antisense strand and / or sense strand nucleotide sequences of any one of the duplexes in Tables 5A, 5B, and 5C, and further comprises a desialylate glycoprotein receptor ligand targeting group.

[0150] In some implementations, the INHBE RNAi agent comprises, is composed of, or is substantially composed of any of the duplexes in Tables 5A, 5B3, and 5C.

[0151] Table 5A. INHBE RNAi agent duplexes with corresponding sense and antisense strand ID numbers and sequence ID numbers of modified and unmodified nucleotide sequences. Table 5B. INHBE RNAi agent duplexes with corresponding sense and antisense strand IDs at the target site on the INHBE gene (SEQ ID NO:1). INHBE RNAi agent double-stranded ID AC004053 is an RNAi agent that targets mouse INHBE.

[0152] Table 5C. INHBE RNAi agent duplexes showing chemically modified antisense and sense strand sequences. In some embodiments, the INHBE RNAi agent is prepared or provided as a salt, a mixed salt, or a free acid. The RNAi agents described herein, upon delivery to cells expressing the INHBE gene, inhibit or knock down the expression of one or more INHBE genes in vivo and / or in vitro.

[0153] Targeting ligands or groups, linking groups, and delivery mediators In some embodiments, the INHBE RNAi agent is conjugated to one or more non-nucleotide groups, including but not limited to targeting groups, linker groups, targeting ligands, delivery polymers, or delivery mediators. Non-nucleotide groups can enhance the targeting, delivery, or attachment of the RNAi agent. Examples of targeting groups and linker groups are provided in Table 6. Non-nucleotide groups can be covalently linked to the 3' and / or 5' ends of the sense and / or antisense strands. In some embodiments, the INHBE RNAi agent contains non-nucleotide groups linked to the 3' and / or 5' ends of the sense strand. In some embodiments, non-nucleotide groups are linked to the 5' end of the sense strand of the INHBE RNAi agent. Non-nucleotide groups can be directly or indirectly linked to the RNAi agent via linker / connector groups. In some embodiments, non-nucleotide groups are linked to the RNAi agent via unstable, cleavable, or reversible bonds or linkers.

[0154] In some embodiments, the non-nucleotide group enhances the pharmacokinetic or biodistribution properties of the RNAi agent or conjugate to which it is attached, thereby improving the cell-specific or tissue-specific distribution and cell-specific uptake of the RNAi agent or conjugate. In some embodiments, the non-nucleotide group enhances the endocytosis of the RNAi agent.

[0155] Targeting groups or targeting moieties enhance the pharmacokinetic or biodistributional properties of the conjugates or RNAi agents to which they are attached, thereby improving the cell-specific (and in some cases organ-specific) distribution and cell-specific (or organ-specific) uptake of the conjugates or RNAi agents. Targeting groups can be monovalent, divalent, trivalent, tetravalent, or have a higher valence for their target. Representative targeting groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity for cell surface molecules.

[0156] In some embodiments, a linker, such as a PEG linker or one, two, or three base-free and / or ribitol (base-free ribose) residues (which can be used as linkers in some cases), is used to attach the targeting group to the RNAi agent. In some embodiments, the targeting ligand comprises a cluster of galactose derivatives.

[0157] The INHBE RNAi agents described herein can be synthesized having reactive groups, such as amino groups (also referred to herein as amines), at the 5'-terminus and / or 3'-terminus. These reactive groups can then be used to attach the target moiety using methods commonly employed in the art.

[0158] In some embodiments, the targeting group comprises a desialyl glycoprotein receptor ligand. As used herein, a desialyl glycoprotein receptor ligand is a ligand containing a portion having an affinity for the desialyl glycoprotein receptor. As described herein, the desialyl glycoprotein receptor is highly expressed on hepatocytes. In some embodiments, the desialyl glycoprotein receptor ligand comprises or is composed of one or more galactose derivatives. As used herein, the term galactose derivative includes galactose and galactose derivatives with an affinity for the desialyl glycoprotein receptor equal to or greater than that of galactose. Galactose derivatives include, but are not limited to: galactose, galactosamine, N-formylgalactosamine, N-acetylgalactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, and N-isobutyrylgalactosamine (see, for example: ST. Iobst and K. Drickamer, JBC, 1996, 271, 6686). Galactose derivatives and clusters of galactose derivatives that can be used to target oligonucleotides and other molecules to the liver in vivo are known in the art (see, for example, Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945).

[0159] Galactose derivatives have been used to target molecules to hepatocytes in vivo via their binding to desialyl glycoprotein receptors expressed on the surface of hepatocytes. Binding of desialyl glycoprotein receptor ligands to the desialyl glycoprotein receptors facilitates cell-specific targeting to hepatocytes and the internalization of molecules into hepatocytes. Desialyl glycoprotein receptor ligands can be monomers (e.g., having a single galactose derivative, also known as monovalent or monodentate) or polymers (e.g., having multiple galactose derivatives). Galactose derivatives or clusters of galactose derivatives can be attached to the 3' or 5' end of the sense or antisense strand of an RNAi agent using methods known in the art. Preparation of targeting ligands (e.g., clusters of galactose derivatives) is described, for example, in International Patent Application Publication No. WO 2018 / 044350 of Arrowhead Pharmaceuticals, Inc. and International Patent Application Publication No. WO 2017 / 156012 of Arrowhead Pharmaceuticals, Inc., the contents of which are incorporated herein by reference in their entirety.

[0160] As used herein, a galactose derivative cluster comprises a molecule having 2 to 4 terminal galactose derivatives. The terminal galactose derivatives are attached to the molecule via their C-1 carbon. In some embodiments, the galactose derivative cluster is a galactose derivative trimer (also known as a trianthal galactose derivative or trivalent galactose derivative). In some embodiments, the galactose derivative cluster comprises an N-acetyl-galactosamine moiety. In some embodiments, the galactose derivative cluster comprises three N-acetyl-galactosamine moieties. In some embodiments, the galactose derivative cluster is a galactose derivative tetramer (also known as a tetraanthal galactose derivative or tetravalent galactose derivative). In some embodiments, the galactose derivative cluster comprises four N-acetyl-galactosamine moieties.

[0161] As used herein, a galactose derivative trimer contains three galactose derivatives, each attached to a central branch point. As used herein, a galactose derivative tetramer contains four galactose derivatives, each attached to a central branch point. The galactose derivatives can be attached to the central branch point via the C-1 carbon of the sugar. In some embodiments, the galactose derivatives are attached to the branch point via a linker or spacer. In some embodiments, the linker or spacer is a flexible hydrophilic spacer, such as a PEG group (see, for example, U.S. Patent No. 5,885,968; Biessen et al., J. Med. Chem. 1995, Vol. 39, pp. 1538-1546). In some embodiments, the PEG spacer is a PEG3 spacer. The branch point can be any small molecule that allows attachment of three galactose derivatives and further allows attachment of the branch point to an RNAi agent. Examples of branch point groups are dilysine or diglutamic acid. Branch point attachment to the RNAi agent can occur via a linker or spacer. In some embodiments, the linker or spacer group comprises a flexible hydrophilic spacer group, such as, but not limited to, a PEG spacer group. In some embodiments, the linker comprises a rigid linker, such as a cyclic group. In some embodiments, the galactose derivative comprises or is composed of N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster comprises a galactose derivative tetramer, which may be, for example, an N-acetyl-galactosamine tetramer.

[0162] Some embodiments of this disclosure include pharmaceutical compositions for delivering an INHBE RNAi agent to hepatocytes in vivo. Such pharmaceutical compositions may include, for example, an INHBE RNAi agent conjugated to a galactose derivative cluster. In some embodiments, the galactose derivative cluster comprises a galactose derivative trimer (which may be, for example, an N-acetyl-galactosamine trimer) or a galactose derivative tetramer (which may be, for example, an N-acetyl-galactosamine tetramer).

[0163] The targeting ligand or targeting group can be attached to the 3' or 5' end of the sense or antisense strand of the INHBE RNAi agent disclosed herein.

[0164] Targeting ligands include, but are not limited to, (NAG37) and (NAG37)s as defined in Table 6. Other targeting groups and targeting ligands, including galactose cluster targeting ligands, are known in the art.

[0165] In some embodiments, a linker group is conjugated to the RNAi agent. The linker group facilitates the covalent connection of the agent to a target group, delivery polymer, or delivery medium. The linker group may be attached to the 3' and / or 5' end of the sense or antisense strand of the RNAi agent. In some embodiments, the linker group is attached to the sense strand of the RNAi agent. In some embodiments, the linker group is conjugated to the 5' or 3' end of the sense strand of the RNAi agent. In some embodiments, the linker group is conjugated to the 5' end of the sense strand of the RNAi agent. Examples of linker groups may include, but are not limited to: reactive groups, such as primary amines and alkynes, alkyl groups, non-basic nucleotides, ribitols (non-basic ribose), and / or PEG groups.

[0166] In some embodiments, the targeting group is internally linked to nucleotides on the sense and / or antisense strands of the RNAi agent. In some embodiments, the targeting group is linked to the RNAi agent via a linker.

[0167] A linker or connecting group is a connection between two atoms that links a chemical group (e.g., an RNAi agent) or target segment to another chemical group (e.g., a targeting group or delivery polymer) or target segment via one or more covalent bonds. Unstable connections contain unstable bonds. The connection may optionally include a spacer group that increases the distance between the two joined atoms. The spacer group may further increase the flexibility and / or length of the connection. Spacer groups include, but are not limited to, alkyl, alkenyl, alkynyl, aryl, aralkyl, areneyl, and arynyl; each may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and sugars. Spacer groups are well known in the art, and the foregoing list is not intended to limit the scope of the specification.

[0168] In some embodiments, when a single composition includes two or more RNAi agents, each RNAi agent may be linked to the same target group or two different target groups (i.e., target groups with different chemical structures). In some embodiments, the target group is linked to the INHBE RNAi agent disclosed herein without the use of an additional adapter. In some embodiments, the target group itself is designed to have adapters or other sites to facilitate readily available conjugation. In some embodiments, when a single molecule includes two or more INHBE RNAi agents, each RNAi agent may utilize the same adapter or different adapters (i.e., adapters with different chemical structures).

[0169] Any of the INHBE RNAi agent nucleotide sequences listed in Tables 2, 3, 4, or 5C, whether modified or unmodified, may contain 3' and / or 5' targeting or linking groups. Any of the INHBE RNAi agent sequences listed in Tables 3 or 4 or described elsewhere herein containing 3' or 5' targeting or linking groups may alternatively omit 3' or 5' targeting or linking groups, or may contain different 3' or 5' targeting or linking groups, including but not limited to those depicted in Table 6. Any of the INHBE RNAi agent duplexes listed in Tables 5A, 5B, and 5C, whether modified or unmodified, may further contain targeting or linking groups, including but not limited to those depicted in Table 6, and the targeting or linking group may be attached to the 3' or 5' end of the sense or antisense strand of the INHBE RNAi agent duplex.

[0170] Table 6 provides examples of targeting groups and linking groups (which, when combined, can form targeting ligands). Tables 4 and 5C provide several embodiments of the sense strand of INHBE RNAi agents having targeting groups or linking groups attached to the 5' or 3' end.

[0171] Table 6. Structures of various modified nucleotides, targeting ligands or targeting groups, capped residues, and linker groups. Other linking groups known in the art can be used.

[0172] In some embodiments, a delivery medium can be used to deliver RNAi agents to cells or tissues. The delivery medium is a compound that improves the delivery of RNAi agents to cells or tissues. Delivery mediators may include, but are not limited to, polymers such as amphiphilic polymers, membrane-active polymers, peptides, melittin peptides, melittin-like peptides (MLPs), lipids, reversibly modified polymers or peptides, or reversibly modified membrane-active polyamines. In some embodiments, the RNAi agent may be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, or other delivery systems available in the art. RNAi agents can also be chemically conjugated to target groups, lipids (including but not limited to cholesterol and cholesterol derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, for example, WO 2000 / 053722, WO 2008 / 0022309, WO 2011 / 104169 and WO2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each of which is incorporated herein by reference), hydrogels, cyclodextrins, biodegradable nanocapsules and bioadhesive microspheres, protein carriers, or other delivery systems known and available in the art suitable for the delivery of nucleic acids or oligonucleotides.

[0173] Pharmaceutical compositions and formulations The INHBE RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as "pharmaceuticals"). In some embodiments, the pharmaceutical compositions comprise at least one INHBE RNAi agent. These pharmaceutical compositions are particularly useful for inhibiting the expression of target mRNAs in target cells, cell populations, tissues, or organisms.

[0174] The pharmaceutical composition may be used to treat subjects suffering from diseases, dysregulations, or conditions that would benefit from reduced levels of target INHBE mRNA or inhibition of target gene expression. The pharmaceutical composition may be used to treat subjects at risk of developing diseases, dysregulations, symptoms, or conditions that would benefit from reduced levels of target mRNA or inhibition of target gene expression. In one embodiment, the method includes administering an INHBE RNAi agent linked to a target ligand as described herein to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including mediators, carriers, diluents, and / or delivery polymers) are added to the pharmaceutical composition comprising the INHBE RNAi agent, thereby forming a pharmaceutical formulation or agent suitable for in vivo delivery to a subject (including a human).

[0175] The pharmaceutical compositions and methods disclosed herein, including INHBE RNAi agents, reduce the level of target mRNA in cells, cell populations, tissues, organs, or subjects, including by administering a therapeutically effective amount of the INHBE RNAi agent described herein to the subject, thereby inhibiting the expression of INHBE mRNA in the subject. In some embodiments, the subject has previously been identified as having pathogenic upregulation of the target gene in hepatocytes. In some embodiments, the subject has previously been identified or diagnosed with obesity, diabetes, liver inflammation, dyslipidemia, or metabolic disease. In some embodiments, the subject is suffering from symptoms associated with a disease such as obesity, diabetes, liver inflammation, dyslipidemia, or metabolic disease. In some embodiments, the subject will benefit from a reduction in INHBE gene expression in the subject's liver.

[0176] In some embodiments, the pharmaceutical composition comprising an INHBE RNAi agent is used to treat or manage clinical manifestations associated with obesity, diabetes, liver inflammation, dyslipidemia, or metabolic diseases. In some embodiments, a therapeutically (including preventatively) effective amount of one or more pharmaceutical compositions is administered to a subject requiring such treatment. In some embodiments, administration of any of the disclosed INHBE RNAi agents can be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.

[0177] In some embodiments, a therapeutically effective amount of one or more pharmaceutical compositions comprising an INHBE RNAi agent is administered to a subject, thereby treating the symptoms. In other embodiments, a preventatively effective amount of one or more INHBE RNAi agents is administered to a subject, thereby preventing or suppressing at least one symptom.

[0178] The route of administration is the way in which the INHBE RNAi agent comes into contact with the body. Methods of administering drugs and oligonucleotides and nucleic acids to treat mammals are generally known in the art and can be applied to the administration of the compositions described herein. The INHBE RNAi agents disclosed herein can be administered via any suitable route in formulations appropriately tailored to a specific route. Thus, the pharmaceutical compositions described herein can be administered by injection, such as intravenous, intramuscular, intradermal, subcutaneous, intra-articular, or intraperitoneal injection. In some embodiments, the pharmaceutical compositions described herein are administered via subcutaneous injection.

[0179] Pharmaceutical compositions comprising the INHBE RNAi agent described herein can be delivered to cells, cell populations, tissues, or subjects using oligonucleotide delivery technologies known in the art. Generally, any suitable method recognized in the art for delivering nucleic acid molecules (in vitro or in vivo) is applicable to the compositions described herein. For example, delivery can be made via local administration (e.g., direct injection, implantation, or topical application), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or local (including buccal and sublingual) administration. In some embodiments, the composition is administered via subcutaneous or intravenous infusion or injection.

[0180] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0181] As used herein, a pharmaceutical composition or agent comprises a pharmacologically effective amount of at least one of the said therapeutic compounds and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient (excipient) is a substance other than the active pharmaceutical ingredient (API, therapeutic product, such as an INHBE RNAi agent) intentionally included in a drug delivery system. Excipients do not exert or are not intended to exert a therapeutic effect at the intended dose. Excipients may serve to: a) facilitate the processing of the drug delivery system during manufacturing; b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the API; c) aid in product identification; and / or d) enhance any other property of the overall safety and effectiveness of API delivery during storage or use. Pharmaceutically acceptable excipients may or may not be inert substances.

[0182] Excipients include, but are not limited to: absorption enhancers, anti-adhesion agents, defoamers, antioxidants, adhesives, buffers, carriers, coating agents, colorants, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavoring agents, flow aids, wetting agents, lubricants, oils, polymers, preservatives, brine, salt, solvents, sugars, surfactants, suspending agents, sustained-release matrices, sweeteners, thickeners, tensioning agents, mediators, water repellents, and wetting agents.

[0183] Suitable pharmaceutical compositions for injection include sterile aqueous solutions (in the case of water solubility) or dispersions and sterile powders for immediate preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, antibacterial water, Cremophor® ELTM (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). Suitable carriers should be stable under manufacturing and storage conditions and should be protected against contamination by microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Appropriate flowability can be maintained, for example, by using coatings such as lecithin, by maintaining the desired particle size in the case of dispersions, and by using surfactants. In many cases, isotonic agents, such as sugars, polyols (e.g., mannitol, sorbitol), and sodium chloride, are preferably included in the composition. Prolonged absorption of injectable compositions can be achieved by including agents that delay absorption (e.g., aluminum monostearate and gelatin) in the composition.

[0184] Sterile injectable solutions can be prepared by mixing the desired amount of the active compound with one or a combination of the ingredients listed above as needed in a suitable solvent, followed by filtration and sterilization. Typically, dispersions are prepared by mixing the active compound with a sterile medium containing a base dispersion medium and any other desired ingredients from those listed above. In the case of sterile powders used to prepare sterile injectable solutions, preparation methods include vacuum drying and freeze-drying, which produce a powder containing the active ingredient plus any additional desired ingredients from its previously sterile filtered solution.

[0185] In some embodiments, pharmaceutical formulations comprising the INHBE RNAi agent disclosed herein, suitable for subcutaneous administration, can be prepared in aqueous sodium phosphate buffer (e.g., INHBE RNAi agent formulated in water with 0.5 mM sodium dihydrogen phosphate and 0.5 mM disodium hydrogen phosphate). In some embodiments, pharmaceutical formulations comprising the INHBE RNAi agent disclosed herein, suitable for subcutaneous administration, can be prepared in water for injection (sterile water). INHBE RNAi agents disclosed herein, suitable for subcutaneous administration, can be prepared in isotonic saline (0.9%).

[0186] Formulations suitable for intra-articular administration can be in the form of sterile aqueous formulations of the drug (which may be in microcrystalline form), such as aqueous microcrystalline suspensions. Liposome formulations or biodegradable polymer systems may also be used to provide drugs for intra-articular and ocular administration.

[0187] Formulations of the INHBE RNAi agent disclosed herein suitable for oral administration can also be prepared. In some embodiments, the INHBE RNAi agent disclosed herein is administered orally. In some embodiments, the INHBE RNAi agent disclosed herein is formulated in a capsule for oral administration.

[0188] The active compound can be prepared with a carrier (e.g., a controlled-release formulation, including implants and microencapsulated delivery systems) that protects the compound from rapid elimination from the body. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations will be apparent to those skilled in the art. Liposome suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, such as those described in U.S. Patent No. 4,522,811.

[0189] For ease of administration and uniform dosage, INHBE RNAi agents can be formulated in unit dosage form. Unit dosage form refers to physically discrete units suitable as a unit dose for a subject to be treated; each unit contains a predetermined amount of active compound calculated to produce the desired therapeutic effect, as well as the desired drug delivery system. The specifications of the unit dosage form disclosed herein are determined by and directly depend on the unique characteristics of the active compound and the therapeutic effect to be achieved, as well as the inherent limitations in the field of formulating such active compounds for individualized treatment.

[0190] Pharmaceutical compositions may contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to, antipruritic agents, astringents, local anesthetics, analgesics, antihistamines, or anti-inflammatory agents (e.g., acetaminophen, NSAIDs, diphenhydramine, etc.). Cells, tissues, or isolated organs expressing or containing RNAi agents as defined herein are also envisioned as potential candidates for use as “pharmaceutical compositions.” As used herein, “pharmacologically effective amount,” “therapeuticly effective amount,” or simply “effective amount” refers to the amount of RNAi agent that produces a pharmacological, therapeutic, or preventative outcome.

[0191] In some embodiments, in addition to administering the RNAi agent disclosed herein, the methods disclosed herein further include the step of administering a second therapeutic agent or treatment. In some embodiments, the second therapeutic agent is another INHBE RNAi agent (e.g., an INHBE RNAi agent targeting a different sequence within the INHBE target). In other embodiments, the second therapeutic agent may be a small molecule drug, an antibody, an antibody fragment, or an aptamer.

[0192] In some embodiments, the INHBE RNAi agent is optionally combined with one or more adjunctive therapeutic agents. The INHBE RNAi agent and the adjunctive therapeutic agent may be administered in a single composition or they may be administered separately. In some embodiments, one or more adjunctive therapeutic agents are administered alone in a dosage form separate from the RNAi agent (e.g., the INHBE RNAi agent is administered subcutaneously, while the adjunctive therapeutic agent involved in the dosing regimen of the treatment is administered orally). In some embodiments, the INHBE RNAi agent is administered subcutaneously to a subject in need, and one or more optional adjunctive therapeutic agents are administered orally, together providing a treatment regimen for diseases and conditions associated with obesity, diabetes, liver inflammation, dyslipidemia, or metabolic disorders. In some embodiments, the INHBE RNAi agent is administered subcutaneously to a subject in need, and one or more optional adjunctive therapeutic agents are administered separately via subcutaneous injection. In some embodiments, the INHBE RNAi agent is combined with one or more adjunctive therapeutic agents in a single dosage form (e.g., formulated as a "cocktail" of a single composition for subcutaneous injection). With or without one or more additional therapeutic agents, the INHBERNAi agent may be combined with one or more excipients to form a pharmaceutical composition. In some embodiments, the INHBE RNAi agent may be combined with a glucagon-like peptide-1 (GLP-1) agonist. In some embodiments, the GLP-1 agonist may be selected from duraglutide, telposide, exenatide, smegglutide, liraglutide, and lixisenatide.

[0193] Typically, the effective amount of an INHBE RNAi agent will be in the range of about 0.1 to about 100 mg / kg body weight per dose, for example, about 1.0 to about 50 mg / kg body weight per dose. In some embodiments, the effective amount of the active compound will be in the range of about 0.25 to about 5 mg / kg body weight per dose. In some embodiments, the effective amount of the active ingredient will be in the range of about 0.5 to about 4 mg / kg body weight per dose. In some embodiments, the effective amount of the INHBE RNAi agent may be a fixed dose. In some embodiments, the fixed dose is in the range of about 5 mg to about 1,000 mg of INHBE RNAi agent. In some embodiments, the fixed dose is in the range of 50 to 400 mg of INHBE RNAi agent. Dosing may be weekly, bi-weekly, monthly, quarterly, or at any other interval, depending on the dose of the INHBE RNAi agent administered, the activity level of the specific INHBE RNAi agent, and the desired level of inhibition for the specific subject. The examples described herein illustrate levels of inhibition suitable for certain animal species. The dosage administered will depend on variables such as the patient's or subject's overall health condition, the relative bioavailability of the delivered compound, the drug formulation, the presence and type of excipients in the formulation, and the route of administration. Furthermore, it should be understood that the initial dose may be increased beyond the aforementioned upper limits to rapidly achieve the desired blood or tissue levels, or the initial dose may be less than the optimal dose.

[0194] For the purpose of treating a disease or for the formation of a pharmaceutical agent or composition for treating a disease, the pharmaceutical compositions described herein, including INHBE RNAi agents, may be combined with excipients or with a second therapeutic agent or treatment, the second therapeutic agent or treatment including but not limited to: second or other RNAi agents, small molecule drugs, antibodies, antibody fragments, peptides and / or aptamers.

[0195] When added to pharmaceutically acceptable excipients or adjuvants, the INHBE RNAi agent can be packaged in kits, containers, packages, or dispensers. The pharmaceutical compositions described herein can be packaged in pre-filled syringes, pen syringes, auto-injectors, infusion bags / devices, or vials.

[0196] Treatment and suppression of expression methods The INHBE RNAi agents disclosed herein can be used to treat subjects (e.g., humans or other mammals) suffering from diseases or disorders that would benefit from the administration of RNAi agents. In some embodiments, the RNAi agents disclosed herein can be used to treat subjects (e.g., humans) who would benefit from reduced and / or suppressed INHBE mRNA expression and / or INHBE protein levels, or subjects who have been diagnosed with or are suffering from symptoms associated with diseases such as obesity, diabetes, liver inflammation, dyslipidemia, or metabolic disorders.

[0197] In some embodiments, a therapeutically effective amount of any one or more INHBE RNAi agents is administered to the subject. Treatment of the subject may include therapeutic and / or prophylactic treatment. A therapeutically effective amount of any one or more INHBE RNAi agents described herein is administered to the subject. The subject may be a person, a patient, or a human patient. The subject may be an adult, adolescent, child, or infant. Administration of the pharmaceutical compositions described herein may be to humans or animals.

[0198] The INHBE RNAi agents described herein can be used to treat at least one symptom in subjects suffering from INHBE-related diseases or dysregulations, or diseases or dysregulations at least partially mediated by INHBE gene expression. In some embodiments, the INHBE RNAi agents are used to treat or manage clinical presentations in subjects suffering from diseases or dysregulations that would benefit from a reduction in INHBE mRNA or are at least partially mediated by a reduction in INHBE mRNA. A therapeutically effective amount of one or more of the INHBE RNAi agents described herein, or a composition containing an INHBE RNAi agent, is administered to the subject. In some embodiments, the methods disclosed herein include administering a composition containing an INHBE RNAi agent described herein to a subject to be treated. In some embodiments, a preventatively effective amount of any one or more of the INHBE RNAi agents is administered to the subject, thereby treating the subject by preventing or suppressing at least one symptom.

[0199] In some embodiments, this disclosure provides a method for treating a disease, disorder, condition, or pathological state that is at least partially mediated by INHBE gene expression in a patient in need, wherein the method includes administering any of the INHBE RNAi agents described herein to the patient.

[0200] In some implementations, the 5' end of the sense chain is coupled to a targeting ligand containing a structure of (NAG37)s.

[0201] In some embodiments, compared to subjects who had not received INHBE RNAi, the gene expression level and / or mRNA level of the INHBE gene was reduced by at least approximately 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%. The gene expression level and / or mRNA level in the subjects may be reduced in the subjects' cells, cell populations, and / or tissues. In some embodiments, compared to subjects who had not received INHBE RNAi, INHBE gene expression in the cytoplasm of hepatocytes was suppressed by at least approximately 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or greater than 65%.

[0202] In some implementations, the expression level of INHBE protein in subjects who have received the INHBE RNAi agent is reduced by at least approximately 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% compared to subjects before or without receiving the INHBE RNAi agent. The protein expression level in the subjects may be reduced in the subjects' cells, cell populations, tissues, blood, and / or other fluids.

[0203] The reduction in INHBE mRNA expression levels and INHBE protein expression levels can be assessed using any method known in the art. As used herein, a reduction or decrease in INHBE mRNA levels and / or protein levels is collectively referred to herein as a reduction or decrease in INHBE or inhibition or reduction of INHBE gene expression. The examples described herein illustrate known methods for assessing inhibition of INHBE gene expression. Those skilled in the art will further recognize suitable methods for assessing inhibition of INHBE gene expression in vivo and / or in vitro.

[0204] In some embodiments, this document discloses methods for treating (including preventative or preventive treatment) diseases, disorders, or symptoms caused by conditions such as obesity, diabetes, liver inflammation, dyslipidemia, or metabolic diseases, wherein the method comprises administering a therapeutically effective amount of an INHBE RNAi agent to a subject in need, said INHBE RNAi agent comprising an antisense strand comprising a sequence comprising any one of the sequences in Table 2, 3, or 5C, and a sense strand comprising any one of the sequences in Table 2, 4, or 5C, which is at least partially complementary to the antisense strand. In some embodiments, this document discloses methods for treating (including prophylactic or preventative treatment) a disease or symptom caused by a condition such as obesity, diabetes, liver inflammation, dyslipidemia, or metabolic disease, wherein the method comprises administering a therapeutically effective amount of an INHBERNAi agent to a subject in need, said INHBERNAi agent comprising a sense strand comprising any one of the sequences in Tables 2, 4, or 5C and an antisense strand comprising a sequence at least partially complementary to the sense strand comprising any one of the sequences in Tables 2, 3, or 5C.

[0205] In some implementations, the 5' end of the sense chain is coupled to a targeting ligand containing a structure of (NAG37)s.

[0206] In some embodiments, this document discloses a method for inhibiting the expression of the INHBE gene in cells, wherein the method includes administering an INHBE RNAi agent to cells, said INHBE RNAi agent comprising an antisense strand that is at least partially complementary to a portion of an INHBE mRNA having sequences in Table 1. In some embodiments, this document discloses a method for inhibiting the expression of the INHBE gene in cells, wherein the method includes administering an INHBE RNAi agent to cells, said INHBE RNAi agent comprising an antisense strand comprising a sequence comprising any one of the sequences in Tables 2, 3, or 5C, and a sense strand comprising any one of the sequences in Tables 2, 4, or 5C that is at least partially complementary to the antisense strand. In some embodiments, this document discloses a method for inhibiting the expression of the INHBE gene in cells, wherein the method includes administering an INHBE RNAi agent, said INHBE RNAi agent comprising a sense strand comprising any one of the sequences in Tables 2, 4, or 5C, and an antisense strand comprising any one of the sequences in Tables 2, 3, or 5C that is at least partially complementary to the sense strand.

[0207] In some embodiments, INHBE RNAi is administered to subjects in need as first-line therapy. In some embodiments, INHBE RNAi is administered to subjects in need as second-line therapy. In some embodiments, INHBE RNAi is administered as second-line therapy to patients who have failed one or more first-line standard of care therapies. In some embodiments, INHBE RNAi is administered as maintenance therapy after administration of one or more prior therapies. In some embodiments, INHBE RNAi is administered as maintenance therapy after administration of one or more standard of care therapies. In some embodiments, INHBE RNAi is administered in combination with one or more adjunctive therapies. In some embodiments, one or more adjunctive therapies are standard of care therapies. In some embodiments, one or more adjunctive therapies are oral therapies.

[0208] The use of INHBE RNAi agents provides a method for the therapeutic (including preventative) treatment of diseases / dysregulations associated with or related to elevated INHBE gene expression, such as obesity, diabetes, liver inflammation, dyslipidemia, or metabolic disorders. The INHBE RNAi agents mediate RNA interference to inhibit the expression of one or more genes essential for the production of INHBE proteins. INHBE RNAi agents can also be used to treat or prevent various diseases, dysregulations, or conditions, including, for example, obesity, diabetes, liver inflammation, dyslipidemia, or metabolic disorders. Furthermore, compositions for the in vivo delivery of INHBE RNAi agents to liver cells, and particularly to hepatocytes, are described.

[0209] Cells, tissues, organs and non-human objects Cells, tissues, organs, and non-human objects including at least one of the INHBE RNAi agents described herein are considered. Cells, tissues, organs, or non-human objects are prepared by delivering the RNAi agent to the cell, tissue, organ, or non-human object.

[0210] Explanatory Implementation Plan Illustrative embodiments of the disclosed technology are provided herein. These embodiments are illustrative only and do not limit the scope of this disclosure or the appended claims.

[0211] Implementation Plan 1. An RNAi agent for inhibiting the expression of the repressin subunit βE (INHBE) gene, comprising: i. An antisense strand comprising at least 17 consecutive nucleotides differing from any of the sequences in Tables 2, 3, or 5C by 0 or 1 nucleotide; and ii. A sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand.

[0212] Implementation Scheme 2. The RNAi agent of Implementation Scheme 1, wherein the antisense strand comprises nucleotides 2-18 of any one of the sequences in Table 2, Table 3 or Table 5C.

[0213] Implementation Scheme 3. An RNAi agent of Implementation Scheme 1 or Implementation Scheme 2, wherein the sense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides differing by 0 or 1 nucleotide from any of the sense strand sequences in Table 2, Table 4 or Table 5C, and wherein the sense strand has a region having at least 85% complementarity with the antisense strand over 17 consecutive nucleotides.

[0214] Implementation Scheme 4. An RNAi agent of any one of Implementation Schemes 1-3, wherein at least one nucleotide of the RNAi agent is a modified nucleotide or includes a modified nucleoside linker.

[0215] Implementation Scheme 5. An RNAi agent of any one of Implementation Schemes 1-3, wherein all or substantially all nucleotides of the sense strand and / or antisense strand of the RNAi agent are modified nucleotides.

[0216] Implementation Scheme 6. An RNAi agent according to any one of Implementation Schemes 4-5, wherein the modified nucleotide is selected from: 2'-O-methyl nucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2',3'-open-ring nucleotide mimic, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, baseless nucleotide, ribitol, reverse nucleotide, reverse 2'-O-methyl nucleotide, reverse 2'-deoxynucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholinonucleotide, nucleotide containing vinylphosphonate, nucleotide containing cyclopropylphosphonate, and 3'-O-methyl nucleotide.

[0217] Implementation Scheme 7. The RNAi agent of Implementation Scheme 5, wherein all or substantially all of the modified nucleotides are 2'-O-methyl nucleotides, 2'-fluoronucleotides, or combinations thereof.

[0218] Implementation Scheme 8. An RNAi agent of any one of Implementation Schemes 1-7, wherein the antisense strand consists of, is substantially composed of, or contains the nucleotide sequence of any one of the modified antisense strand sequences in Table 3 or Table 5C.

[0219] Implementation Scheme 9. An RNAi agent of any one of Implementation Schemes 1-8, wherein the sense strand consists of, is substantially composed of, or contains the nucleotide sequence of any one of the modified sense strand sequences in Table 4 or Table 5C.

[0220] Implementation Scheme 10. The RNAi agent of Implementation Scheme 1, wherein the antisense strand comprises a nucleotide sequence of any one of the modified sequences in Table 3 or Table 5C, and the sense strand comprises a nucleotide sequence of any one of the modified sequences in Table 4 or Table 5C.

[0221] Implementation Scheme 11. An RNAi agent of any one of Implementation Schemes 1-10, wherein the RNAi agent is linked to a target ligand.

[0222] Implementation Scheme 12. An RNAi agent of any one of Implementation Schemes 1-11, wherein the targeting ligand has an affinity for the desialyl glycoprotein receptor.

[0223] Implementation Scheme 13. An RNAi agent of Implementation Scheme 11 or 12, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0224] Implementation Scheme 14. An RNAi agent of any one of Implementation Schemes 11-13, wherein the targeting ligand comprises a structure of (NAG37) or (NAG37)s.

[0225] Implementation Scheme 15. An RNAi agent of any one of Implementation Schemes 11-14, wherein the targeting ligand is linked to the sense strand.

[0226] Implementation Scheme 16. The RNAi agent of Implementation Scheme 15, wherein the targeting ligand is attached to the 5' end of the sense strand.

[0227] Implementation Scheme 17. An RNAi agent of any one of Implementation Schemes 1-16, wherein the sense strand is 15 to 30 nucleotides in length and the antisense strand is 18 to 30 nucleotides in length.

[0228] Implementation Scheme 18. The RNAi agent of Implementation Scheme 17, wherein the sense strand and antisense strand are each 18 to 27 nucleotides in length.

[0229] Implementation Scheme 19. The RNAi agent of Implementation Scheme 18, wherein the sense strand and antisense strand are each 18 to 24 nucleotides in length.

[0230] Implementation Scheme 20. The RNAi agent of Implementation Scheme 19, wherein the sense strand and antisense strand are each 21 nucleotides in length.

[0231] Implementation Scheme 21. An RNAi agent of any one of Implementation Schemes 1-20, wherein the RNAi agent has two blunt ends.

[0232] Implementation Scheme 22. An RNAi agent of any one of Implementation Schemes 1-21, wherein the sense strand comprises one or two end caps.

[0233] Implementation Scheme 23. An RNAi agent of any one of Implementation Schemes 1-22, wherein the sense strand comprises one or two reverse abase-free residues.

[0234] Implementation Scheme 24. The RNAi agent of Implementation Scheme 1, wherein the RNAi agent comprises a sense strand and an antisense strand, the sense strand and the antisense strand forming a double-stranded sequence of any one of the double-stranded sequences shown in Tables 5A, 5B or 5C.

[0235] Implementation Scheme 25. An RNAi agent of any one of Implementation Schemes 1-24, wherein the sense strand comprises an inverted baseless residue at the 3' end of a nucleotide sequence, at the 5' end of a nucleotide sequence, or at both.

[0236] Implementation Scheme 26. The RNAi agent of Implementation Scheme 1, comprising an antisense strand, said antisense strand consisting of, substantially consisting of, or containing a nucleotide sequence that differs from, one of the following nucleotide sequences (5'→3') by 0 or 1 nucleotide: UAUUAAGAAAGUAUAAGCCAG (SEQ ID NO: 621); or TGACAAGAAAGUGCCCAUUUG (SEQ ID NO: 748).

[0237] Implementation Scheme 27. The RNAi agent of Implementation Scheme 26, wherein the sense strand consists of, is substantially composed of, or contains a nucleotide sequence that differs from, one of the following nucleotide sequences (5'→3') by 0 or 1 nucleotide: CUGGCUUAUACUUUCUUAAUA (SEQ ID NO: 684); or CAAAUGGGCACUUUCUUGUCA (SEQ ID NO: 699).

[0238] Implementation Scheme 28. The RNAi agent of Implementation Scheme 26 or Implementation Scheme 27, wherein all or substantially all nucleotides are modified nucleotides.

[0239] Implementation Scheme 29. The RNAi agent of Implementation Scheme 1, comprising an antisense strand, said antisense strand comprising, consisting of, or substantially consisting of a modified nucleotide sequence differing from, one of the following nucleotide sequences (5'→3') by 0 or 1 nucleotide: usAfsuuAfagaaagUfaUfaAfgccassg(SEQ ID NO: 391); or dTssGfsacaaGfaaagUfgCfcCfauuussg(SEQ ID NO: 427); Where a represents 2'-O-methyladenosine, c represents 2'-O-methylcytidine, g represents 2'-O-methylguanosine, and u represents 2'-O-methyluridine; Af represents 2'-fluoroadenosine, Cf represents 2'-fluorocytidine, Gf represents 2'-fluoroguanosine, and Uf represents 2'-fluorouridine; dT represents 2'-deoxythymidine; s represents a thiophosphate linker, and ss represents a dithiophosphate linker; and all or substantially all nucleotides on the sense strand are modified nucleotides.

[0240] Implementation Scheme 30. The RNAi agent of Implementation Scheme 1, wherein the sense strand comprises, consists of, or is substantially composed of a modified nucleotide sequence that differs from, one of the following nucleotide sequences (5'→3') by 0 or 1 nucleotide: cuggcuuaUfaCfUfuucuuaaua(SEQ ID NO: 515); or caaaugggCfAfCfuuucuuguca(SEQ ID NO: 530); Wherein a represents 2'-O-methyladenosine, c represents 2'-O-methylcytidine, g represents 2'-O-methylguanosine, and u represents 2'-O-methyluridine; Af represents 2'-fluoroadenosine, Cf represents 2'-fluorocytidine, Gf represents 2'-fluoroguanosine, and Uf represents 2'-fluorouridine; s represents a thiophosphate linker, and ss represents a dithiophosphate linker; and wherein all or substantially all nucleotides on the sense strand are modified nucleotides.

[0241] Implementation Scheme 31. An RNAi agent of any one of Implementation Schemes 26-30, wherein the sense strand further comprises an inverted abase-free residue at the 3' end of the nucleotide sequence, at the 5' end of the nucleotide sequence, or at both.

[0242] Implementation Scheme 32. An RNAi agent of any one of Implementation Schemes 26-31, wherein the RNAi agent is linked to a target ligand.

[0243] Implementation Scheme 33. An RNAi agent according to any one of Implementation Schemes 26-32, wherein the RNAi agent comprises: ,or .

[0244] Implementation Scheme 34. An RNAi agent of any one of Implementation Schemes 1-33, wherein the RNAi agent is a pharmaceutically acceptable salt.

[0245] Implementation Scheme 35. The RNAi agent of Implementation Scheme 34, wherein the RNAi agent is a sodium salt.

[0246] Implementation Scheme 36. An RNAi agent of any one of Implementation Schemes 1-35, wherein the 5' end of the sense strand is coupled to a targeting ligand containing a structure of (NAG37)s.

[0247] Implementation Scheme 37. A composition comprising an RNAi agent of any one of Implementation Schemes 1-36, wherein the composition comprises a pharmaceutically acceptable excipient.

[0248] Implementation Scheme 38. The composition of Implementation Scheme 37, wherein the pharmaceutically acceptable excipient is water for injection.

[0249] Implementation Scheme 39. The composition of Implementation Scheme 38, wherein the pharmaceutically acceptable excipient is isotonic saline.

[0250] Implementation Scheme 40. A method for inhibiting the expression of the repressor subunit βE (INHBE) gene in cells, the method comprising introducing into cells an effective amount of an RNAi agent of any one of Implementation Schemes 1-36 or a composition of any one of Implementation Schemes 37-39.

[0251] Implementation Scheme 41. The method of Implementation Scheme 40, wherein the cells are in the subject.

[0252] Implementation Scheme 42. The method of Implementation Scheme 41, wherein the subject is a human subject.

[0253] Implementation Scheme 43. The method of any one of Implementation Schemes 40-42, wherein the expression of the INHBE gene is suppressed by at least about 30%.

[0254] Implementation Scheme 44. The method of any one of Implementation Schemes 40-43, wherein the INHBE activity is reduced by at least approximately 50%.

[0255] Implementation Scheme 45. A method for treating INHBE-related diseases, disorders, or symptoms, said method comprising administering to a subject in need a therapeutically effective amount of any one of the compositions of Implementation Schemes 37-39.

[0256] Implementation scheme 46. The method of implementation scheme 45, wherein the disease is obesity, diabetes, liver inflammation, dyslipidemia or metabolic disease.

[0257] Implementation Scheme 47. The method of any one of Implementation Schemes 45-46, wherein the RNAi agent is administered at a dose of about 0.05 mg / kg to about 5.0 mg / kg of human subject body weight.

[0258] Implementation Scheme 48. The method of any one of Implementation Schemes 45-47, wherein the RNAi agent is administered in two or more doses.

[0259] Implementation Scheme 49. The method of any one of Implementation Schemes 45-48, wherein the weight of the human subject is reduced by at least 5%.

[0260] Implementation scheme 50. The method of any one of implementation schemes 45-48, wherein the human subject has reduced triglycerides, LDL cholesterol or total cholesterol.

[0261] Implementation Scheme 51. The method of any one of Implementation Schemes 45-48, wherein the serum activin E protein level of the subject is reduced.

[0262] Implementation Scheme 52. An RNAi agent of any one of Implementation Schemes 1-36 or a composition according to any one of Implementation Schemes 37-39, for the treatment of at least part of a disease, disorder or symptom mediated by a reduction in INHBE gene expression.

[0263] Implementation Scheme 53. The RNAi agent of Implementation Scheme 52, wherein the disease is obesity, diabetes, liver inflammation, dyslipidemia or metabolic disease.

[0264] Implementation Scheme 54. Use of any RNAi agent of any one of Implementation Schemes 1-36 or any composition of any one of Implementation Schemes 37-39 for the preparation of a pharmaceutical composition for the treatment of at least a portion of a disease, disorder or symptom mediated by a reduction in INHBE gene expression.

[0265] Implementation Scheme 55. Use of Implementation Scheme 54, wherein the disease is obesity, diabetes, liver inflammation, dyslipidemia or metabolic disease.

[0266] Implementation Scheme 56. According to any one of Implementation Schemes 52-55, the RNAi agent is administered at a dose of about 0.05 mg / kg to about 5.0 mg / kg of human subject weight.

[0267] Implementation Scheme 57. A method for inhibiting the expression of the INHBE gene in cells, the method comprising introducing an effective amount of an RNAi agent targeting INHBE mRNA into the cells, wherein the RNAi agent reduces INHBE activity by at least about 50%.

[0268] Implementation Scheme 58. An RNAi agent targeting INHBE mRNA, wherein the RNAi agent inhibits the activity level of INHBE protein in cells.

[0269] Implementation Plan 59. Figures 5A-5C Compounds of the formula shown, or pharmaceutically acceptable salts thereof.

[0270] Implementation Plan 60. Figures 6A-6C The compound shown in the figure.

[0271] Implementation Plan 61. Figures 7A-7C Compounds of the formula shown, or pharmaceutically acceptable salts thereof.

[0272] Implementation Plan 62. Figures 8A-8C The compound shown in the figure.

[0273] The implementation schemes and projects provided above will now be illustrated with the following non-limiting examples. Example

[0274] Example 1. Synthesis of INHBE RNAi agent. Synthesize the INHBE RNAi double strands shown in Tables 5A, 5B, and 5C above according to the following general procedure: A. synthesis The sense and antisense strands of RNAi agents are synthesized on a solid phase for oligonucleotide synthesis using phosphoramide technology. Such standard synthesis is commonly known in the art. Depending on scale, MerMade96E® (Bioautomation), MerMade12® (Bioautomation), or OP Pilot 100 (GE Healthcare) are used. Synthesis is performed on a solid support made of controlled-aperture glass (CPG, 500 Å or 600 Å, available from Prime Synthesis, Aston, PA, USA). Monomers located at the 3' end of the respective strand are attached to the solid support serving as the starting point for synthesis. All RNA and 2'-modified RNA phosphoramides are purchased from Thermo Fisher Scientific (Milwaukee, WI, USA) or Hongene Biotech (Shanghai, PRC). 2'-O-methylphosphoramide comprises the following: (5'-O-dimethoxytriphenylmethyl-N... 6 -(benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide, 5'-O-dimethoxy-triphenylmethyl-N 4 -(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropyl-amino)phosphamide, (5'-O-dimethoxytriphenylmethyl-N 2-(isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide and 5'-O-dimethoxytriphenylmethyl-2'-O-methyluridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide. 2'-Deoxy-2'-fluorophosphamide carries the same protecting group as 2'-O-methylphosphamide (amidites). 5'-(4,4'-dimethoxytriphenylmethyl)-2',3'-open-ring uridine and 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphamide were also purchased from Thermo Fisher Scientific or Hongene Biotech. 5'-Dimethoxytriphenylmethyl-2'-O-methyl-inosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide was purchased from Glen Research (Virginia) or Hongene Biotech. Cyclopropylphosphonate phosphoramide was synthesized according to International Patent Application Publication No. WO 2017 / 214112 (see also Altenhofer et al., Chem. Communications (Royal Soc. Chem.), 57(55):6808-6811 (July 2021)). Reverse baseless (3'-O-dimethoxytriphenylmethyl-2'-deoxyribose-5'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide was purchased from ChemGenes (Wilmington, MA, USA) or SAFC (St Louis, MO, USA). 5'-O-dimethoxytriphenylmethyl-N 2 N 6 -(phenoxyacetic acid ester)-2'-O-methyl-diaminopurine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide was obtained from ChemGenes or Hongene Biotech.

[0275] Phosphite containing the targeting ligand was dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other phosphorite was dissolved in anhydrous acetonitrile (50 mM), or anhydrous dimethylformamide and molecular sieve (3 Å) were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activating agent solution. Coupling times were 12 min (RNA), 15 min (targeting ligand), 90 s (2'-OMe), and 60 s (2'-F). To introduce the thiophosphate linker, a 100 mM solution of 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used. Unless specifically identified as a “naked” RNAi agent without a target ligand, the duplexes of each INHBE RNAi agent synthesized and tested in the following examples used N-acetyl-galactosamine (NAG) in the target ligand chemical structures shown in Table 6, but these may be substituted with other galactose derivatives to attach in accordance with the structures and descriptions provided herein, to the extent that those skilled in the art would understand.

[0276] (NAG37) and (NAG37)s-targeting ligand phosphorusamide compounds can be synthesized according to Arrowhead Pharmaceuticals, Inc. International Patent Application Publication No. WO 2018 / 044350 and other similar comparable methods. Flowcharts depicting methods suitable for synthesizing NAG37 phosphorusamides (phosphorusamide compounds containing targeting ligands) are shown in Schemes 1 and 2 below.

[0277] Option 1. Synthesize 5 Trifluoroacetic acid (TFA) salt 5 was synthesized as shown in Scheme 1. D-galactosamine was peracetylated using acetic anhydride in pyridine and catalytic N,N-dimethylaminopyridine to form acetate 5A. Treatment of 5A with trimethylsilyl trifluoromethanesulfonate enabled the formation of a fused ring system of 5B by ortho-substitution of α-acetate with an adjacent acetamide group, resulting in oxazoline 5B as an unseparated intermediate. Treatment of the amino alcohol 5C with benzyl chloroformate protected the amine and formed primary alcohol 5D. Adding 5D to the solution of 5B opened the oxazoline and reformed the acetamide functional group. The resulting intermediate 5E was separated by precipitation from methyl tert-butyl ether, and the solid was further purified by re-slurrying in ethyl acetate and n-heptane. The Cbz group was hydrogenolyzed in tetrahydrofuran with palladium / carbon and trifluoroacetic acid to produce 5 in TFA salt form in THF solution, which was used without further purification.

[0278] N-Cbz-L-glutamic acid 5-tert-butyl ester 1 was activated with isovaleryl chloride to form a mixed anhydride. Glutamic acid 2 protected with di-tert-butyl ester was added to give amide 3, which was separated into an ethyl acetate solution and used without further purification. All tert-butyl esters were deprotected with formic acid to give triacid 4. After solvent exchange, the crude solid of 4 was separated from hexane and dissolved in methyl tert-butyl ether for further water washing, followed by concentration of the solution for the next step. TFA salt 5 was coupled with each of the three free carboxylic acids to form a trianthraquinone acetylgalactosamine compound 6. Crude product 6 was separated by precipitation with methyl tert-butyl ether, followed by three precipitations with methanol and methyl tert-butyl ether. Hydrogenolysis of the Cbz group of 6 yielded a primary amine 7, which was separated into a TFA salt by precipitation with methyl tert-butyl ether. The TFA salt was used without further purification and coupled with cis-4-hydroxycyclohexanecarboxylic acid (7A) to obtain a secondary alcohol 8. After separating the crude solids, 8 was dissolved in acetonitrile and methyl tert-butyl ether, and subsequently purified by precipitation three times with n-heptane. The secondary alcohol was phosphorylated with 2-cyanoethyl N,N,N',N'-tetraisopropylphosphonamide to produce NAG37 phosphoramide. NAG37 phosphoramide was purified by resuspending in a mixture of acetonitrile, methyl tert-butyl ether, and n-heptane to meet HPLC purity requirements. 31 Specifications for P-NMR purity.

[0279] Option 2. Synthesis of NAG37 phosphorusamide B. Cleavage and deprotection of support-bound oligomers. After solid-phase synthesis, the dried solid support was treated with a 1:1 volume mixture of 40% by weight methylamine aqueous solution and 28% ammonium hydroxide solution (Aldrich) at 30°C for 1.5 hours. The solution was evaporated, and the solid residue was reconstituted in water (see below).

[0280] C. Purification Crude oligomers were purified by anion-exchange HPLC using a TSKgel SuperQ-5PW 13µm column and a Shimadzu LC-8 system. Buffer A consisted of 20 mM Tris, 5 mM EDTA, pH 9.0, and 20% acetonitrile, while buffer B was identical to buffer A with the addition of 1.5 M sodium chloride. UV traces were recorded at 260 nm. Appropriate fractions were collected and subsequently run on size-resistance HPLC using a GE Healthcare XK 26 / 40 column packed with Sephadex G25 fine powder, with a run buffer of either filtered DI water or 100 mM ammonium bicarbonate, pH 6.7, and 20% acetonitrile.

[0281] D. Annealing Complementary strands were mixed to form an RNAi agent by combining equimolar RNA solutions (sense and antisense) in 1× phosphate-buffered saline (Corning, Cellgro). A portion of the RNAi agent was lyophilized and stored at -15 to -25°C. The duplex concentration was determined by measuring the absorbance of the solution in 1× phosphate-buffered saline on a UV-Vis spectrometer. The absorbance at 260 nm was then multiplied by a conversion factor and a dilution factor to determine the duplex concentration. The conversion factor used was 0.050 mg / (mL∙cm) or calculated from an experimentally determined extinction coefficient.

[0282] Example 2. INHBE-GLuc AAV mouse model. To evaluate certain INHBE RNAi agents in vivo, an INHBE-GLuc (Gaussian luciferase) AAV (adeno-associated virus) mouse model was used. Six- to eight-week-old male C57BL / 6 mice were transduced with INHBE-GLuc AAV serotype 8 (INHBE-Gluc AAV8), administered at least 14 days prior to administration of the INHBE RNAi agent or control. The INHBE-GLuc AAV genome contains the 231-2413 region of the human INHBE cDNA sequence (GenBank NM_031479.5) inserted into the 3' UTR of the GLuc reporter gene sequence. INHBE-GLuc AAV model mice were generated by intravenous injection of the corresponding virus at a total volume of 10 mL / kg animal body weight in PBS at a concentration of 5E12 to 1E13 GC / kg (genome copies per kilogram of body weight). GLuc expression was measured by inhibiting INHBE expression through INHBE RNAi, which resulted in simultaneous inhibition of GLuc expression. Serum GLuc expression levels were measured using the Pierce™ Gaussian luciferase glow detection kit (Thermo Fisher Scientific) before treatment (between day -7 and day 1 before administration), and mice were grouped according to mean GLuc levels.

[0283] Mice were anesthetized with 2-3% isoflurane, and blood samples were collected from the submandibular region into serum separation tubes (Sarstedt AG & Co., Nümbrecht, Germany). The blood was allowed to clot at ambient temperature for 20 minutes. The tubes were centrifuged at 8,000 × g for 3 minutes to separate the serum, which was then stored at 4°C. The serum was collected and measured using the Pierce™ Gaussian luciferase glow detection kit according to the manufacturer's instructions. Serum GLuc levels for each animal could be normalized relative to the control group of mice injected with the vector to account for non-treatment-related changes in INHBE expression in this model. To do this, firstly, the GLuc level for each animal at a time point was divided by the animal's pre-treatment expression level (day 1) to determine the expression ratio "normalized relative to pre-treatment". Then, the expression at a specific time point was normalized relative to the control group by dividing the individual animal's "normalized relative to pre-treatment" ratio by the average "normalized relative to pre-treatment" ratio of all mice in the standard vector control group. Alternatively, serum GLuc levels in each animal can be assessed simply by normalizing them relative to pre-treatment levels.

[0284] Example 3. In vivo testing of INHBE RNAi agent in mice. On day 1, four (n=4) female C57bl / 6 mice in each group were administered INHBE RNAi (3.0 mg / kg) via subcutaneous (SQ) injection at a volume of 200 μL / 20 g body weight in saline or in saline. The administration regimen was as shown in Table 7 below.

[0285] Table 7. Dosage groups in Example 3. The injection is administered subcutaneously into the loose skin in the neck and shoulder area. The animal is weighed prior to administration, and the dosage volume is adjusted individually based on the animal's weight. Serum is collected on day 15 post-injection.

[0286] Each INHBE RNAi agent comprises a modified nucleotide with the sense strand conjugated at the 5' end to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having a modified sequence as shown in the double-stranded structure herein. (For specific modifications and structural information related to INHBE RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6).

[0287] Using mActinB as an endogenous control, the INHBE mRNA level was quantified by qPCR. The results are shown in Table 8 below.

[0288] Table 8. Mean INHBE normalized relative to the control in mice from Example 3. The INHBE RNAi agents in groups 2-4 showed cross-reactivity across mouse and human INHBE. A single dose of 3.0 mg / kg of the INHBE RNAi agent showed inhibition of INHBE up to at least day 15, with inhibition of AC911861 reaching ~77% on day 15.

[0289] Example 4. In vivo testing of INHBE RNAi agent in mice. The INHBE-GLuc-AAV model was used as described in Example 2 above. On day -14, four (n=4) male C57bl / 6 mice in each group were administered ~5×10^12 GC / kg INHBE-Gluc AAV8 via intravenous (IV) injection. On day 1, mice were administered INHBERNAi (9.0 mg / kg) via subcutaneous (SQ) injection at a volume of 250 μL / 25 g body weight in saline or a saline-reconstituted form. The administration regimen was as per Table 9 below.

[0290] Table 9. Dosage groups in Example 4. The injection was administered subcutaneously into the loose skin in the neck and shoulder area. Animals were weighed prior to administration, and the dosage volume was adjusted individually based on their body weight. Serum was collected on days -7, 1, 8, 15, and 22 post-injection.

[0291] Each INHBE RNAi agent comprises a modified nucleotide with the sense strand conjugated at the 5' end to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having a modified sequence as shown in the double-stranded structure herein. (For specific modifications and structural information related to INHBE RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6).

[0292] GLuc levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 10 below, where the mean GLuc reflects the normalized average of GLuc. GLuc expression was measured by simultaneously inhibiting GLuc expression through the INHBE RNAi agent, which inhibited INHBE expression.

[0293] Table 10. Mean GLuc in INHBE-AAV-Gluc mice of Example 4, normalized relative to pre-treatment and saline control. Compared to saline control group 1, groups 2–11 showed a reduction in AAV-INHBE on days 8 and 22. Compared to saline control group 1, groups 2–10 showed a reduction in AAV-INHBE on day 15. More specifically, AC911856 achieved ~91% inhibition on day 8. The INHBE RNAi agent achieved a reduction in AAV-INHBE until at least day 22. Notably, group 3 (9.0 mg / kg AC911864) achieved ~88% inhibition (0.120) on day 22.

[0294] Example 5. In vivo testing of INHBE RNAi agent in mice. The INHBE-GLuc-AAV model was used as described in Example 2 above. On day -14, four (n=4) male C57bl / 6 mice in each group were administered ~5×10^12 GC / kg INHBE-Gluc AAV8 via intravenous (IV) injection. On day 1, mice were administered INHBERNAi (9 mg / kg) in saline or saline solution via subcutaneous (SQ) injection at an injection volume of 200 μL / 20 g body weight. The administration regimen was as per Table 11 below.

[0295] Table 11. Dosage groups in Example 5. The injection was administered subcutaneously into the loose skin in the neck and shoulder area. Animals were weighed prior to administration, and the dosage volume was adjusted individually based on their body weight. Serum was collected on days -7, 1, 8, 15, and 22 post-injection.

[0296] Each INHBE RNAi agent comprises a modified nucleotide with the sense strand conjugated at the 5' end to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having a modified sequence as shown in the double-stranded structure herein. (For specific modifications and structural information related to INHBE RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6).

[0297] GLuc levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 12 below, where the mean GLuc reflects the normalized average of GLuc. GLuc expression was measured by simultaneously inhibiting GLuc expression through the INHBE RNAi agent, which inhibited INHBE expression.

[0298] Table 12. Mean GLuc in INHBE-AAV-Gluc mice of Example 5, normalized relative to pre-treatment and saline control. Compared to saline control group 1, groups 2–12 showed a reduction in AAV-INHBE on days 8 and 15. Compared to saline control group 1, groups 2–8, 11, and 12 showed a reduction in AAV-INHBE on day 22. More specifically, AC911864 achieved ~90% inhibition on day 15. Some INHBE RNAi agents achieved AAV-INHBE reduction until at least day 22. Notably, group 3 (9.0 mg / kg AC911864) achieved ~87% inhibition (0.129) on day 22.

[0299] Example 6. In vivo testing of INHBE RNAi agent in mice. The INHBE-GLuc-AAV model was used as described in Example 2 above. On day -21, four (n=4) male C57bl / 6 mice in each group were administered ~5×10^12 GC / kg INHBE-Gluc AAV8 via intravenous (IV) injection. On day 1, mice were administered INHBERNAi (1.0 mg / kg) via subcutaneous (SQ) injection at a volume of 250 μL / 25 g body weight in saline or a saline-reconstituted form. The administration regimen was as per Table 13 below.

[0300] Table 13. Dosage groups in Example 6. The injection was administered subcutaneously into the loose skin in the neck and shoulder area. Animals were weighed prior to administration, and the dosage volume was adjusted individually based on their body weight. Serum was collected on days -7, 1, 8, 15, and 22 post-injection.

[0301] Each INHBE RNAi agent comprises a modified nucleotide with the sense strand conjugated at the 5' end to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having a modified sequence as shown in the double-stranded structure herein. (For specific modifications and structural information related to INHBE RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6).

[0302] GLuc levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 14 below, where the mean GLuc reflects the normalized average of GLuc. GLuc expression was measured by simultaneously inhibiting GLuc expression through the INHBE RNAi agent, which inhibited INHBE expression.

[0303] Table 14. Mean GLuc in INHBE-AAV-Gluc mice of Example 6, normalized relative to pre-treatment and saline control. Compared to the saline control group 1, groups 2–13 showed a reduction in AAV-INHBE on days 8, 15, and 22. More specifically, AC004045 achieved ~68% inhibition on day 15. The INHBE RNAi agent achieved a reduction in AAV-INHBE until at least day 22. Notably, group 8 (1.0 mg / kg AC912695) achieved ~62% inhibition (0.379) on day 22.

[0304] Example 7. In vivo testing of INHBE RNAi agent in mice. The INHBE-GLuc-AAV model was used as described in Example 2 above. On day -21, four (n=4) male C57bl / 6 mice in each group were administered ~5 × 10^12 GC / kg INHBE-Gluc AAV8 via intravenous (IV) injection. On day 1, mice were administered INHBERNAi (1.0 mg / kg) via subcutaneous (SQ) injection at a volume of 250 μL / 25 g body weight in saline or a saline-reconstituted form. The administration regimen was as per Table 15 below.

[0305] Table 15. Dosage groups in Example 7. The injection was administered subcutaneously into the loose skin in the neck and shoulder area. Animals were weighed prior to administration, and the dosage volume was adjusted individually based on their body weight. Serum was collected on days -7, 1, 8, 15, and 22 post-injection.

[0306] Each INHBE RNAi agent comprises a modified nucleotide with the sense strand conjugated at the 5' end to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having a modified sequence as shown in the double-stranded structure herein. (For specific modifications and structural information related to INHBE RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6).

[0307] GLuc levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 16 below, where the mean GLuc reflects the normalized average of GLuc. GLuc expression was measured by simultaneously inhibiting GLuc expression through the INHBE RNAi agent, which inhibited INHBE expression.

[0308] Table 16. Mean GLuc in INHBE-AAV-Gluc mice of Example 7, normalized relative to pre-treatment and saline control. Compared to the saline control group 1, groups 2–15 showed a reduction in AAV-INHBE on days 8, 15, and 22. More specifically, AC004185 achieved ~68% inhibition on day 15. The INHBE RNAi agent achieved a reduction in AAV-INHBE until at least day 22. Notably, group 15 (1.0 mg / kg AC004185) achieved ~59% inhibition (0.410) on day 22.

[0309] Example 8. In vivo testing of INHBE RNAi agent in mice. The INHBE-GLuc-AAV model was used as described in Example 2 above. On day -21, eight (n=8) (for group 1) or four (n=4) (for groups 2-19) male C57bl / 6 mice were administered ~5 × 10^12 GC / kg INHBE-Gluc AAV8 via intravenous (IV) injection. On day 1, mice were administered INHBE RNAi (1.0 mg / kg) in saline or saline solution via subcutaneous (SQ) injection at a volume of 250 μL / 25 g body weight. The administration regimen was as per Table 17 below.

[0310] Table 17. Dosage groups in Example 8. The injection was administered subcutaneously into the loose skin in the neck and shoulder area. Animals were weighed prior to administration, and the dosage volume was adjusted individually based on their body weight. Serum was collected on days -7, 1, 8, 15, and 22 post-injection.

[0311] Each INHBE RNAi agent comprises a modified nucleotide with the sense strand conjugated at the 5' end to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having a modified sequence as shown in the double-stranded structure herein. (For specific modifications and structural information related to INHBE RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6).

[0312] GLuc levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 18 below, where the mean GLuc reflects the normalized average of GLuc. GLuc expression was measured by simultaneously inhibiting GLuc expression through the INHBE RNAi agent, which inhibited INHBE expression.

[0313] Table 18. Mean GLuc in INHBE-AAV-Gluc mice of Example 8, normalized relative to pre-treatment and saline control. Compared to the saline control group 1, groups 2–10 showed a reduction in AAV-INHBE on days 8, 15, and 22. More specifically, AC004285 achieved ~78% inhibition on day 15. The INHBE RNAi agent achieved a reduction in AAV-INHBE until at least day 22. Notably, group 4 (1.0 mg / kg AC004285) achieved ~67% inhibition (0.333) on day 22.

[0314] Example 9. In vivo testing of INHBE RNAi agent in cynomolgus monkeys. INHBE inhibition of the INHBE RNAi agent was tested in cynomolgus monkeys. On days 1 and 29, two (n=2) or three (n=3) female cynomolgus monkeys in each test group were administered the INHBE RNAi agent (3.0 mg / kg) at a dose volume of 0.3 mL / kg via subcutaneous (SQ) injection in the mid-scapular region using a syringe and needle. Liver biopsies were collected from all test animals on days -7 (before administration), 15, 29, 57, and 85. All animals were fasted for at least 12 hours but no more than 18 hours prior to sedation and liver biopsy collection. The administration regimen was as per Table 19 below.

[0315] Table 19. Administration of drugs to cynomolgus monkeys in Example 9. Prior to each SQ injection, the test animals were first sedated. Sedation was achieved using ketamine hydrochloride (10 mg / kg) administered as an intramuscular (IM) injection (not into the quadriceps). Individual doses of the INHBERNAi agent were calculated based on the daily recorded body weight.

[0316] For each animal, liver biopsy samples (approximately 40 mg each (30 to 60 mg; ±10%)) were collected for exploratory gene knockdown analysis.

[0317] Serum blood was collected on days -7, 1, 15, 29, 57, and 85 prior to liver biopsy sample collection or dose administration (if applicable), and from any animals found to be in a morbid state or euthanized at unplanned intervals. The collection site was the femoral vein, with the saphenous vein used as an alternative collection site.

[0318] Liver biopsies and serum collected from experimental animals were used for the analysis of INHBE expression and additional biological parameters. Liver biopsies were collected on days -7, 15, 29 (before administration), 57, and 85.

[0319] Liver biopsies were collected as part of a sedation procedure. Animals were fasted overnight (at least 12 hours but less than 18 hours) prior to each liver biopsy collection. The liver biopsy sample collected from each animal was approximately 40 mg (30 to 60 mg; ±10%).

[0320] INHBE expression and additional biological parameters from collected liver biopsies were analyzed. Using cARL1 as an endogenous control gene, hepatic cINHBE mRNA expression levels were quantified by qPCR and normalized relative to day -7 (before drug administration). qPCR INHBE expression data are shown in Table 20 below.

[0321] Table 20. INHBE expression in the liver of cynomolgus monkeys in Example 9. Two subcutaneous SQ injections of 3.0 mg / kg were administered on days 1 and 29, achieving deep knockdown of the INHBE transcripts for at least 85 days. Groups 1–4 showed reductions in INHBE at days 15, 29, 57, and 85 compared to day 7 prior to administration. More specifically, AC004047 achieved ~76% inhibition (0.242) on day 85; AC004285 achieved ~83% inhibition (0.174) on day 57 (at the nadir).

[0322] Example 10. In vivo testing of INHBE RNAi agent in mice. In vivo testing of INHBE RNAi agents was conducted in diet-induced obese (DIO) C57 albino mice. Ten (n=10) female DIO mice in each group were administered INHBE RNAi (9.0 mg / kg) via subcutaneous (SQ) injection with saline (Group 1) or via saline-reconstituted INHBE RNAi (Group 2) to saline-reconstituted mice (Group 2) on days 1, 8, 15, 22, 29, 36, 43, 50, 57, 64, 71, 78, 85, 92, 99, 106, and 113. DIO mice were administered telposide (0.42 mg / kg) via subcutaneous (SQ) injection on day 1 and daily until day 119 (Group 3); Group 3 mice were administered telposide daily except for weekend days. On day 100, all test groups (Groups 1–3) were administered 200 μL / 30 g body weight (BW) via oral gavage with 15% glucose solution. Dosage is administered according to Table 21 below.

[0323] RNAi agent AC004053 is specific to mouse INHBE mRNA and targets position 585 of GenBank NM_008382.3.

[0324] Table 21. Dosage groups in Example 10. DIO mice were received and acclimatized on day -9, and their weight was recorded on day -7. All animals were fasted for six (6) hours on days -5, 29, and 100 (before blood collection and glucose administration). Blood was collected from all animals on days -5, 29, and 100 (after fasting and before glucose administration) for fasting blood glucose and serum. Further blood collections were made on day 100, 15, 30, 60, 90, and 120 minutes after glucose administration for glucose tolerance testing (GTT) via test strips. All animals were euthanized on day 119, and liver tissue was harvested.

[0325] Each INHBE RNAi agent comprises a modified nucleotide with the sense strand conjugated at the 5' end to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having a modified sequence as shown in the double-stranded structure herein. (For specific modifications and structural information related to INHBE RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6).

[0326] Using mActB as an endogenous control gene, the expression level of hepatic INHBE mRNA was quantified by qPCR and normalized relative to group 1 mice treated with saline. qPCR INHBE expression data are shown in Table 22 below.

[0327] Table 22. INHBE expression levels in mice from Example 10. The INHBE RNAi agent AC004053 showed significant inhibition of INHBE, achieving ~94% inhibition (0.056) at 9.0 mg / kg on day 119.

[0328] On day 119, DIO mice were administered a single dose of CL 316,243 β3-adrenergic agonist at 1.0 mg / kg body weight (20 mL / kg injection volume) via intraperitoneal (IP) injection. Thirty minutes after CL 316,243 injection, the DIO animals were sacrificed and whole blood was collected.

[0329] Pharmacological and biological parameters of serum were analyzed from collected blood samples. Serum non-esterified fatty acid (NEFA) levels were quantified using Randox NEFA. Serum ketone levels were quantified using Randox D-3-hydroxybutyrate (Ranbut). All measurements were performed according to the manufacturer's instructions. Serum measurement results are shown in Table 23 below.

[0330] Table 23. Serum NEFA and ketone levels in mice from Example 10. Treatment of DIO mice with the INHBE RNAi agent AC004053 also improved the sensitivity of these DIO mice to catecholamines, as evidenced by the increased circulating ketone levels.

[0331] In DIO mice, weekly administration of INHBE RNAi significantly inhibited weight gain. Figure 1A As shown, mice treated with the INHBE RNAi agent AC004053 exhibited less weight gain over time compared to the saline control group, with ~20% less weight gain at weeks 11–16. Significance levels are expressed as ****=p<0.0001, ***=p<0.001, **=p<0.01, *=p<0.05, and ns=not significant.

[0332] In DIO mice, weekly administration of INHBE RNAi significantly reduced fat mass. DIO mice were imaged by dual-energy X-ray absorptiometry (DEXA) scans on days 91 and 119. The DEXA scan data from day 119 are presented below. Figure 1B and 1C As shown, weekly administration of AC004053 resulted in reduced fat mass (both fat percentage and fat mass) compared to the saline control group. DIO mice treated with AC004053 maintained lean meat mass, as... Figure 1D and 1E As shown (both lean meat percentage and lean meat volume).

[0333] In DIO mice, weekly administration of INHBE RNAi maintained glucose homeostasis. DIO mice treated with AC004053 showed similar fasting blood glucose levels compared to the saline control group. Figure 1F Similar fasting insulin levels Figure 1G Similar insulin resistance homeostasis model assessment (HOMA-IR) levels ( Figure 1H Similar glucose levels after glucose bolus injection ( Figure 1I ) and similar glucose area under the curve (AUC) levels ( Figure 1J(As an oral glucose tolerance test). The significance level is expressed as ****=p<0.0001, ***=p<0.001, **=p<0.01, *=p<0.05, and ns=not significant.

[0334] These results indicate that knocking down INHBE has a significant pharmacological effect in reducing body weight in DIO mice.

[0335] Example 11. In vivo testing of INHBE RNAi agent in mice. In vivo testing of INHBE RNAi in genetically diabetic db / db mice. Ten male db / db mice in each group (n=10) were administered INHBE RNAi (9.0 mg / kg) via subcutaneous (SQ) injection with saline (Group 1) or via saline-reconstituted INHBE RNAi (Groups 2, 4, and 5) on days 1, 8, 15, 22, 29, 36, 43, 50, 57, and 64. db / db mice were administered telposide (0.14 mg / kg or 0.48 mg / kg) via subcutaneous (SQ) injection (Groups 3–5) on day 1 and daily until day 67; mice in Groups 3–5 were administered telposide daily except for weekend days. On days 29 and 57, all test groups (Groups 1–5) were administered 200 μL / 30 g body weight (BW) via oral gavage with 15% glucose solution. Dosage is administered according to Table 24 below.

[0336] RNAi agent AC004053 is specific to mouse INHBE mRNA and targets position 585 of GenBank NM_008382.3.

[0337] Table 24. Dosage groups in Example 11. db / db mice were received and acclimatized on day -14, and their weight was recorded on day -11. All animals were fasted for 6 hours on days -11, 29, and 57 (before blood collection and glucose administration). Blood was collected from all animals on days -11, 29, 36, and 57 (after fasting, before glucose administration, and before RNAi / telborpeptide administration) for fasting blood glucose and serum. Following glucose administration, further blood was collected on days 29 and 57, at 15, 30, 60, 90, and 120 minutes after the glucose bolus for a glucose tolerance test (GTT) using test strips. On day 67, all animals were euthanized, and liver tissue was harvested.

[0338] Each INHBE RNAi agent comprises a modified nucleotide with the sense strand conjugated at the 5' end to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having a modified sequence as shown in the double-stranded structure herein. (For specific modifications and structural information related to INHBE RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6).

[0339] Using mActB as an endogenous control gene, the expression level of hepatic INHBE mRNA was quantified by qPCR and normalized relative to group 1 mice treated with saline. qPCR INHBE expression data are shown in Table 25 below.

[0340] Table 25. INHBE expression levels in mice from Example 11. The INHBE RNAi agent AC004053 showed significant inhibition of INHBE, achieving ~93% inhibition (0.064) at 9.0 mg / kg on day 67.

[0341] In db / db mice, weekly administration of INHBE RNAi significantly inhibited weight gain. Figure 2A As shown, over time, mice treated with the INHBE RNAi agent AC004053 (Group 2, 9.0 mg / kg AC004053) showed less weight gain than the saline control group, with ~10-15% less weight gain than the control group on days ~29-57.

[0342] The significance level is expressed as ****=p<0.0001, ***=p<0.001, **=p<0.01, *=p<0.05, and ns=not significant.

[0343] In db / db mice, weekly administration of INHBE RNAi significantly reduced fat mass. The db / db mice were imaged by dual-energy X-ray absorptiometry (DEXA) scans on days 47 and 67. The DEXA scan data from day 67 are presented below. Figure 2B and 2C As shown, weekly administration of AC004053 (Group 2, 9.0 mg / kg AC004053) compared to the saline control group resulted in reduced fat mass (both fat percentage and fat mass). db / db mice treated with AC004053 maintained lean meat mass as follows: Figure 2D and 2E As shown (both lean meat percentage and lean meat volume).

[0344] In db / db mice, weekly administration of INHBE RNAi was used to maintain glucose homeostasis. db / db mice treated with AC004053 (Group 2, 9.0 mg / kg AC004053) showed similar fasting blood glucose levels compared to the saline control group. Figure 2F Similar glucose levels after glucose bolus injection ( Figure 2G ) and similar glucose area under the curve (AUC) levels ( Figure 2H (As an oral glucose tolerance test). The significance level is expressed as ****=p<0.0001, ***=p<0.001, **=p<0.01, *=p<0.05, and ns=not significant.

[0345] These results indicate that knocking down INHBE has a significant pharmacological effect in reducing the body weight of db / db mice.

[0346] Example 12. In vivo testing of INHBE RNAi agent in mice. The INHBE-GLuc-AAV model was used as described in Example 2 above. On day -21, four (n=4) male C57bl / 6 mice in each group were administered ~5 × 10^12 GC / kg INHBE-Gluc AAV8 via intravenous (IV) injection. On day 1, mice were administered INHBERNAi (1.0 mg / kg) in saline or saline-reconstituted via subcutaneous (SQ) injection at a volume of 250 μL / 25 g body weight. The administration regimen was as per Table 26 below.

[0347] Table 26. Dosage groups in Example 12. The injection was administered subcutaneously into the loose skin in the neck and shoulder area. Animals were weighed prior to administration, and the dosage volume was adjusted individually based on their body weight. Serum was collected on days -7, 1, 8, 15, and 22 post-injection.

[0348] Each INHBE RNAi agent comprises a modified nucleotide with the sense strand conjugated at the 5' end to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having a modified sequence as shown in the double-stranded structure herein. (For specific modifications and structural information related to INHBE RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6).

[0349] GLuc levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 27 below, where the mean GLuc reflects the normalized average of GLuc. GLuc expression was measured by simultaneously inhibiting GLuc expression through the INHBE RNAi agent, which inhibited INHBE expression.

[0350] Table 27. Mean GLuc normalized relative to pre-treatment and saline control in INHBE-AAV-Gluc mice of Example 12. Compared to the saline control group 1, groups 2–8 showed a reduction in AAV-INHBE on days 8, 15, and 22. More specifically, AC912695 at 1.0 mg / kg achieved ~84% inhibition (0.158) on day 15. The INHBE RNAi agent achieved a reduction in AAV-INHBE until at least day 22. Notably, group 3 (1.0 mg / kg AC912695) achieved ~68% inhibition (0.317) on day 22.

[0351] Example 13. In vivo testing of INHBE RNAi agent in mice. The INHBE-GLuc-AAV model was used as described in Example 2 above. On day -21, four (n=4) male C57bl / 6 mice in each group were administered ~5 × 10^12 GC / kg INHBE-Gluc AAV8 via intravenous (IV) injection. On day 1, mice were administered INHBERNAi (1.0 mg / kg) in saline or saline-reconstituted via subcutaneous (SQ) injection at a volume of 250 μL / 25 g body weight. The administration regimen was as per Table 28 below.

[0352] Table 28. Dosage groups in Example 13. The injection was administered subcutaneously into the loose skin in the neck and shoulder area. Animals were weighed prior to administration, and the dosage volume was adjusted individually based on their body weight. Serum was collected on days -7, 1, 8, 15, and 22 post-injection.

[0353] Each INHBE RNAi agent comprises a modified nucleotide with the sense strand conjugated at the 5' end to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having a modified sequence as shown in the double-stranded structure herein. (For specific modifications and structural information related to INHBE RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6).

[0354] GLuc levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 29 below, where the mean GLuc reflects the normalized average of GLuc. GLuc expression was measured by simultaneously inhibiting GLuc expression through the INHBE RNAi agent, which inhibited INHBE expression.

[0355] Table 29. Mean GLuc in INHBE-AAV-Gluc mice of Example 13, normalized relative to pre-treatment and saline control. Compared with the saline control group 1, groups 2–16 showed a reduction in AAV-INHBE on days 8, 15, and 22. More specifically, AC003824 achieved ~77% inhibition (0.234) on day 22 at 1.0 mg / kg.

[0356] Example 14. In vivo testing of INHBE RNAi agent in mice. The INHBE-GLuc-AAV model was used as described in Example 2 above. On day -21, six (n=6) male C57bl / 6 mice in each group were administered ~5 × 10^12 GC / kg INHBE-Gluc AAV8 via intravenous (IV) injection. On day 1, mice were administered INHBERNAi (0.75 mg / kg) in saline or saline-reconstituted via subcutaneous (SQ) injection at an injection volume of 250 μL / 25 g body weight. The administration regimen was as per Table 30 below.

[0357] Table 30. Dosage groups in Example 14. The injection was administered subcutaneously into the loose skin in the neck and shoulder area. Animals were weighed prior to administration, and the dosage volume was adjusted individually based on their body weight. Serum was collected on days -7, 1, 8, 15, and 22 post-injection.

[0358] Each INHBE RNAi agent comprises a modified nucleotide with the sense strand conjugated at the 5' end to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having a modified sequence as shown in the double-stranded structure herein. (For specific modifications and structural information related to INHBE RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6).

[0359] GLuc levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 31 below, where the mean GLuc reflects the normalized average of GLuc. GLuc expression was measured by simultaneously inhibiting GLuc expression through the INHBE RNAi agent, which inhibited INHBE expression.

[0360] Table 31. Mean GLuc in INHBE-AAV-Gluc mice of Example 14, normalized relative to pre-treatment and saline control. Compared with the saline control group 1, groups 2–15 showed a reduction in AAV-INHBE on days 8, 15, and 22 at a low dose (0.75 mg / kg). More specifically, AC005818 achieved ~78% inhibition (0.217) on day 22 at 0.75 mg / kg.

[0361] Example 15. In vivo testing of INHBE RNAi agent in mice. The INHBE-GLuc-AAV model was used as described in Example 2 above. On day -21, four (n=4) male C57bl / 6 mice in each group were administered ~5×10^12 GC / kg INHBE-Gluc AAV8 via intravenous (IV) injection. On day 1, mice were administered INHBERNAi (1.0 mg / kg) in saline or saline-reconstituted via subcutaneous (SQ) injection at an injection volume of 250 μL / 25 g body weight. The administration regimen was as per Table 32 below.

[0362] Table 32. Dosage groups in Example 15. The injection was administered subcutaneously into the loose skin in the neck and shoulder area. Animals were weighed prior to administration, and the dosage volume was adjusted individually based on their body weight. Serum was collected on days -7, 1, 8, 15, and 22 post-injection.

[0363] Each INHBE RNAi agent comprises a modified nucleotide with the sense strand conjugated at the 5' end to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having a modified sequence as shown in the double-stranded structure herein. (For specific modifications and structural information related to INHBE RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6).

[0364] GLuc levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 33 below, where the mean GLuc reflects the normalized average of GLuc. GLuc expression was measured by simultaneously inhibiting GLuc expression through the INHBE RNAi agent, which inhibited INHBE expression.

[0365] Table 33. Mean GLuc in INHBE-AAV-Gluc mice of Example 15, normalized relative to pre-treatment and saline control. Compared to the saline control group 1, groups 2–17 showed varying degrees of reduction in AAV-INHBE levels on days 8, 15, and 22. Group 5 (AC006210) showed almost no AAV-INHBE inhibition at all time points. Groups 8 and 12 showed almost no AAV-INHBE inhibition on days 15 and 22. Among the RNAi agents tested, group 2 (AC004285) at 1.0 mg / kg achieved the most potent AAV-INHBE inhibition on day 8, with ~72% inhibition (0.282). Some INHBE RNAi agents achieved AAV-INHBE reductions until at least day 22. Notably, group 2 (1.0 mg / kg AC004285) achieved ~59% inhibition (0.412) on day 22.

[0366] Example 16. In vivo testing of INHBE RNAi agent in mice. The INHBE-GLuc-AAV model was used as described in Example 2 above. On day -19, six (n=6) male C57bl / 6 mice in each group were administered ~5×10^12 GC / kg INHBE-Gluc AAV8 via intravenous (IV) injection. On day 1, mice were administered INHBERNAi (0.5 mg / kg or 1.0 mg / kg) in saline or saline-reconstituted via subcutaneous (SQ) injection at a volume of 250 μL / 25 g body weight. The administration regimen was as per Table 34 below.

[0367] Table 34. Dosage groups in Example 16. The injection was administered subcutaneously into the loose skin in the neck and shoulder area. Animals were weighed prior to administration, and the dosage volume was adjusted individually based on their body weight. Serum was collected on days -7, 1, 8, 15, and 28 post-injection.

[0368] Each INHBE RNAi agent comprises a modified nucleotide with the sense strand conjugated at the 5' end to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having a modified sequence as shown in the double-stranded structure herein. (For specific modifications and structural information related to INHBE RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6).

[0369] GLuc levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 35 below, where the mean GLuc reflects the normalized average of GLuc. GLuc expression was measured by simultaneously inhibiting GLuc expression through the INHBE RNAi agent, which inhibited INHBE expression.

[0370] Table 35. Mean GLuc in INHBE-AAV-Gluc mice of Example 16, normalized relative to pre-treatment and saline control. Compared with the saline control group 1, groups 2–15 showed varying degrees of reduction in AAV-INHBE levels on days 8, 15, and 22. Among the RNAi agents tested, group 9 (AC006559) achieved the most potent AAV-INHBE inhibition at 1.0 mg / kg on day 15, with ~79% inhibition (0.212). Dose-response was observed on day 8 in groups 2 and 3, 4 and 5, 6 and 7, 8 and 9, 12 and 13, and 14 and 15. Dose-response was also observed on day 15 in groups 2 and 3, 4 and 5, 6 and 7, 8 and 9, 12 and 13, and 14 and 15. Dose-response was observed in groups 2 and 3, 4 and 5, 6 and 7, 8 and 9, 12 and 13, and 14 and 15 on day 28. The INHBE RNAi agent achieved AAV-INHBE reduction until at least day 28. Notably, group 9 (1.0 mg / kg AC006559) achieved ~78% inhibition (0.219) on day 28.

[0371] Example 17. In vivo testing of INHBE RNAi agent in mice. The INHBE-GLuc-AAV model was used as described in Example 2 above. On day -21, six (n=6) male C57bl / 6 mice in each group were administered ~5 × 10^12 GC / kg INHBE-Gluc AAV8 via intravenous (IV) injection. On day 1, mice were administered INHBERNAi (0.75 mg / kg) via subcutaneous (SQ) injection at a volume of 250 μL / 25 g body weight in saline or a saline-reconstituted form. The administration regimen was as per Table 36 below.

[0372] Table 36. Dosage groups in Example 17. The injection was administered subcutaneously into the loose skin in the neck and shoulder area. Animals were weighed prior to administration, and the dosage volume was adjusted individually based on their body weight. Serum was collected on days -7, 1, 8, 15, and 22 post-injection.

[0373] Each INHBE RNAi agent comprises a modified nucleotide with the sense strand conjugated at the 5' end to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having a modified sequence as shown in the double-stranded structure herein. (For specific modifications and structural information related to INHBE RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6).

[0374] GLuc levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 37 below, where the mean GLuc reflects the normalized average of GLuc. GLuc expression was measured by simultaneously inhibiting GLuc expression through the INHBE RNAi agent, which inhibited INHBE expression.

[0375] Table 37. Mean GLuc in INHBE-AAV-Gluc mice of Example 17, normalized relative to pre-treatment and saline control. Compared to the saline control group 1, groups 2–14 showed varying degrees of reduction in AAV-INHBE levels on days 8, 15, and 22. Among the RNAi agents tested, group 11 (AC007400) at 0.75 mg / kg achieved the most potent AAV-INHBE inhibition on day 15, at ~81% (0.193). The INHBE RNAi agent achieved AAV-INHBE reductions until at least day 22. Notably, group 9 (0.75 mg / kg A007398) achieved ~73% inhibition (0.266) on day 22.

[0376] Example 18. In vivo testing of INHBE RNAi agent in mice. The INHBE-GLuc-AAV model was used as described in Example 2 above. On day -21, six (n=6) male C57bl / 6 mice in each group were administered ~5×10^12 GC / kg INHBE-Gluc AAV8 via intravenous (IV) injection. On day 1, mice were administered INHBERNAi (0.5 mg / kg or 1.0 mg / kg) via subcutaneous (SQ) injection at a volume of 250 μL / 25 g body weight in saline or saline-reconstituted form. The administration regimen was as per Table 38 below.

[0377] Table 38. Dosage groups in Example 18. The injection was administered subcutaneously into the loose skin in the neck and shoulder area. Animals were weighed prior to administration, and the dosage volume was adjusted individually based on their body weight. Serum was collected on days -7, 1, 8, 15, and 22 post-injection.

[0378] Each INHBE RNAi agent comprises a modified nucleotide with the sense strand conjugated at the 5' end to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having a modified sequence as shown in the double-stranded structure herein. (For specific modifications and structural information related to INHBE RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6).

[0379] GLuc levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 39 below, where the mean GLuc reflects the normalized average of GLuc. GLuc expression was measured by simultaneously inhibiting GLuc expression through the INHBE RNAi agent, which inhibited INHBE expression.

[0380] Table 39. Mean GLuc in INHBE-AAV-Gluc mice of Example 18, normalized relative to pre-treatment and saline control. Compared with the saline control group 1, groups 2–15 showed varying degrees of reduction in AAV-INHBE levels on days 8, 15, and 22. Among the RNAi agents tested, group 9 (AC007398) achieved the most potent AAV-INHBE inhibition at 1.0 mg / kg on day 22, at ~83% (0.174). The INHBE RNAi agents achieved AAV-INHBE reductions until at least day 22. Dose-response was observed for AC004007 (days 8, 15, and 22), AC007394 (days 8, 15, and 22), AC007400 (days 8, 15, and 22), and AC007398 (days 8, 15, and 22).

[0381] Example 19. In vivo testing of INHBE RNAi agent in mice. The INHBE-GLuc-AAV model was used as described in Example 2 above. On day -21, five (n=5) or six (n=6) male C57bl / 6 mice in each group were administered ~5 × 10^12 GC / kg INHBE-Gluc AAV8 via intravenous (IV) injection. On day 1, mice were administered INHBE RNAi (0.5 mg / kg or 1.0 mg / kg) in saline or saline solution via subcutaneous (SQ) injection at a volume of 250 μL / 25 g body weight. The administration regimen was as per Table 40 below.

[0382] Table 40. Dosage groups in Example 19. The injection was administered subcutaneously into the loose skin in the neck and shoulder area. Animals were weighed prior to administration, and the dosage volume was adjusted individually based on their body weight. Serum was collected on days -7, 1, 8, 15, and 22 post-injection.

[0383] Each INHBE RNAi agent comprises a modified nucleotide with the sense strand conjugated at the 5' end to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having a modified sequence as shown in the double-stranded structure herein. (For specific modifications and structural information related to INHBE RNAi agents (including the (NAG37)s ligand), see Tables 3, 4, 5A, 5B, 5C, and 6).

[0384] GLuc levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 41 below, where the mean GLuc reflects the normalized average of GLuc. GLuc expression was measured by simultaneously inhibiting GLuc expression through the INHBE RNAi agent, which inhibited INHBE expression.

[0385] Table 41. Mean GLuc in INHBE-AAV-Gluc mice of Example 19, normalized relative to pre-treatment and saline control. Compared to the saline control group 1, groups 2–19 showed varying degrees of reduction in AAV-INHBE levels on days 8, 15, and 22; group 16 showed negligible reductions at all time points. Among the RNAi agents tested, group 11 (AC005820) achieved the most potent AAV-INHBE inhibition at 1.0 mg / kg on day 15, at ~86% (0.142). The INHBE RNAi agent achieved AAV-INHBE reductions until at least day 22. Dose-response was observed in AC004007 (days 8, 15, and 22), AC007400 (days 8, 15, and 22), AC912692 (days 8, 15, and 22), AC008890 (days 8, 15, and 22), AC005820 (days 8, 15, and 22), AC008888 (days 8, 15, and 22), AC008889 (days 8, 15, and 22), and AC008891 (days 8, 15, and 22).

[0386] Example 20. In vivo testing of INHBE RNAi agent in cynomolgus monkeys. INHBE inhibition of the INHBE RNAi agent was tested in cynomolgus monkeys. On days 1 and 29, four cynomolgus monkeys (n=4) in each test group were administered the INHBE RNAi agent (1.5 mg / kg or 4.5 mg / kg) at a dose volume of 0.3 mL / kg via subcutaneous (SQ) injection in the mid-scapular region using a syringe and needle. The administration regimen was as shown in Table 42 below.

[0387] Table 42. Administration of drugs to cynomolgus monkeys in Example 20. The experimental animals were cynomolgus monkeys, weighing 3 to 7 kg or more, and were a mix of males and females, as shown in Table 42.

[0388] Prior to each SQ injection, the test animals were first sedated. Sedation was achieved using ketamine hydrochloride (10 mg / kg) administered as an intramuscular (IM) injection (not into the quadriceps). Individual doses of the INHBERNAi agent were calculated based on the daily recorded body weight.

[0389] For each animal, liver biopsy samples (approximately 40 mg each (30 to 60 mg; ±10%)) were collected for exploratory gene knockdown analysis.

[0390] Serum blood was collected on days -14, -7, 1, 15, 29, 52, and 85 prior to liver biopsy sample collection or dose administration (if applicable), and from any animals found to be in a morbid state or euthanized at unplanned intervals. The collection site was the femoral vein, with the saphenous vein used as an alternative collection site.

[0391] Liver biopsies and serum collected from experimental animals were used for the analysis of INHBE expression and additional biological parameters. Liver biopsies were collected on days -14, 15, 29 (before administration), 52, and 85.

[0392] Liver biopsies were collected as part of a sedation procedure. Animals were fasted overnight (at least 12 hours but less than 18 hours) prior to each liver biopsy collection. The liver biopsy sample collected from each animal was approximately 40 mg (30 to 60 mg; ±10%).

[0393] INHBE expression and additional biological parameters from collected liver biopsies were analyzed. Using cARL1 as an endogenous control gene, hepatic cINHBE mRNA expression levels were quantified by qPCR and normalized relative to day -7 (before drug administration). qPCR INHBE expression data are shown in Table 43 below.

[0394] Table 43. INHBE expression in the liver of cynomolgus monkeys in Example 20. Two subcutaneous SQ injections of 1.5 mg / kg or 4.5 mg / kg on days 1 and 29 resulted in INHBE RNAi knockdown of the INHBE transcript, lasting for at least 85 days. Groups 2–4 showed varying levels of INHBE reduction on days 15, 29, 57, and 85 compared to day 14 prior to administration. More notably, two doses of 4.5 mg / kg AC004285 achieved ~59% inhibition (0.411) on day 85; and ~75% inhibition (0.253) on day 52 (at the lowest point).

[0395] Serum INHBE was quantified by LC-MS / MS, with ALVLELAK as the analyte peptide sequence. Serum INHBE protein expression was normalized relative to the level on day -14 (before administration) for each corresponding test group. Serum INHBE protein levels are shown in Table 44 below.

[0396] Table 44. Serum INHBE expression in cynomolgus monkeys in Example 20. Two subcutaneous SQ injections of 1.5 mg / kg or 4.5 mg / kg on days 1 and 29 resulted in the knockdown of serum INHBE by the INHBE RNAi agent, lasting for at least 85 days. Groups 2–4 showed varying levels of INHBE reduction on days 15, 29, 57, and 85 compared to pre-dose day 14. More notably, two doses of 4.5 mg / kg AC004285 achieved ~67% inhibition (0.326) on day 85; and ~77% inhibition (0.225) on day 29 (at the nadir).

[0397] Example 21. INHBE RNAi agent in obese adult volunteers with and without type 2 diabetes Phase 1 / 2a clinical study The plan is to test the INHBE RNAi agent in human clinical trials.

[0398] Proposed study design: A phase 1 / 2a dose-escalation study to evaluate the safety, tolerability, pharmacokinetic (PK), and PD of single and multiple doses of INHBE RNAi in obese adult volunteers (in Part 1), and the safety, tolerability, and PD of repeated doses of INHBE RNAi in obese adult volunteers with and without type 2 diabetes receiving telposide (in Part 2). The duration of study participation will be approximately 24–32 weeks, from the start of the 56-day screening period to the end of the study (day 113 or 169 for Part 1, and day 169 for Part 2). The proposed study protocol is detailed in [link to study protocol details]. Figure 3 (Part 1) and Figure 4 This is explained in Part 2.

[0399] Overview of the proposed Part 1 Part 1A of the proposed study will evaluate a single escalation dose (SAD) of INHBE RNAi in obese volunteers in groups 1a, 2a, 3a, and 4a. Six participants will be recruited in each randomized group, with four receiving INHBE RNAi and two receiving placebo (PBO). Part 1B of the proposed study will evaluate multiple escalation doses (MAD) of INHBE RNAi in adult volunteers in groups 2b, 3b, and 4b. Again, six participants will be recruited in each randomized group, with four receiving INHBE RNAi and two receiving placebo (PBO). Eligible participants for Part 1 of the proposed study will be 18–65 years of age and obese (BMI 30–50 kg / m²). 2Adult non-pregnant, non-lactating subjects who had no evidence of type 2 diabetes at screening (confirmed by laboratory evaluation), had stable weight at screening (no weight gain or loss of >5% in the previous 3 months), and had at least one self-reported unsuccessful attempt to lose weight through lifestyle modifications.

[0400] Overview of the proposed Part 2 Part 2 of the proposed study will evaluate multiple doses of INHBE RNAi in obese subjects with and without type 2 diabetes who are also receiving telpolide. Groups 5A and 5B of Part 2 will each recruit and randomize 12 obese subjects without type 2 diabetes, with 8 receiving INHBE RNAi and 4 receiving placebo (PBO). Group 5C will recruit and randomize 12 obese subjects with type 2 diabetes, with 8 receiving INHBE RNAi and 4 receiving placebo (PBO). Figure 4 As shown, eligible subjects recruited in groups 5A, 5B, and 5C will be randomly assigned (2:1) to receive either combination therapy with telpolide and an INHBE RNAi agent (intervention group) or telpolide monotherapy (control / PBO group). In groups 5A and 5C, telpolide will be started on day 1 at a subcutaneous dose of 2.5 mg weekly for four weeks, followed by escalation to 5 mg weekly. In group 5B, telpolide will be started on day 1 at a subcutaneous dose of 2.5 mg weekly for four weeks in all subjects; subjects assigned to the control group will then have their dose escalated to 5 mg weekly, while subjects assigned to the intervention group will continue with 2.5 mg weekly subcutaneously. The INHBE RNAi agent (or a matched volume of PBO) will be administered subcutaneously on days 1 and 29 at dose levels determined based on safety and pharmacodynamic data from Part 1 of the study. Subjects in groups 5A, 5B, and 5C will be followed up until day 169 (end of study).

[0401] Eligible participants in Part 2 of the study, which will be subject to certain additional exclusion criteria, will include individuals aged 18–65 years with obesity (BMI 30–50 kg / m²). 2 Adult non-pregnant, non-lactating subjects who have type 2 diabetes (T2DM) in [group 5C] or not in [group 5A, 5B], have stable weight at screening (no weight gain or loss of >5% in the previous 3 months), and have at least one self-reported unsuccessful attempt to lose weight by lifestyle changes.

[0402] The primary objective of this study was to evaluate the safety and tolerability of single and multiple subcutaneous (SC) doses of ARO-INHBE in obese adult volunteers with and without type 2 diabetes. Furthermore, the study aimed to evaluate the pharmacokinetics (PK) of single and multiple SC doses of ARO-INHBE in obese adult volunteers, as well as the pharmacodynamics (PD) of single and multiple doses of ARO-INHBE in obese adult volunteers with and without type 2 diabetes.

[0403] The primary, secondary, and exploratory endpoints of the study were: • The incidence, frequency, and severity of treatment-emergent adverse events (TEAEs).

[0404] Plasma PK and urinary excretion of ARO-INHBE [Part 1 group].

[0405] • Changes in serum activin E protein from baseline and percentage change at the time of the planned visit.

[0406] • Change in weight from baseline and percentage change at the time of the planned visit.

[0407] The percentage of participants who achieved a weight loss of at least 5% from baseline by the end of the study (EOS).

[0408] • Changes in waist / hip circumference from baseline and percentage change at the time of the planned visit.

[0409] At the scheduled visit, changes and percentage changes from baseline were measured using magnetic resonance imaging (MRI) of total fat and lean tissue volume (measured from neck to knee), abdominal subcutaneous and visceral fat tissue volume, thigh muscle volume, and fat content.

[0410] • Changes and percentage changes in liver steatosis from baseline were measured using magnetic resonance imaging proton density fat fraction (MRI-PDFF) at the scheduled visit.

[0411] • At the planned visit, changes and percentage changes in lipid parameters (triglycerides, LDL cholesterol, HDL cholesterol, non-HDL cholesterol, total cholesterol, FFA / NEFA, ApoB, ApoB-48, ApoB-100) from baseline were recorded.

[0412] Changes and percentage changes in metabolic biomarkers (BHB, glycerol, adiponectin, leptin, adiponectin-leptin ratio) At the planned visit, glucose homeostasis measures were measured from baseline and percentage change. Glucose homeostasis measures include β-cell function and insulin sensitivity (HgbA1c, fasting blood glucose, insulin, glucagon, C-peptide, proinsulin, HOMA2-%B, HOMA2-IR, and Adipo-IR).

[0413] • During the planned visit, SBP and DBP changed from baseline.

[0414] Plasma and urinary metabolite identification by ARO-INHBE [Part 1 only] ARO-INHBE's plasma PK [Part 2 only, group 2] Incidence and titer of anti-drug antibodies (ADA) in ARO-INHBE (see Section 12.1.6.8 if criteria are met). Other implementation plans It should be understood that although the invention has been described in conjunction with its detailed specification, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the appended embodiments. Other embodiments, advantages, and modifications are within the scope of the appended claims.

Claims

1. An RNAi agent for inhibiting the expression of the repressin subunit βE (INHBE) gene, comprising: i. An antisense strand comprising at least 17 consecutive nucleotides differing from any of the sequences in Tables 2, 3, or 5C by 0 or 1 nucleotide; and ii. A sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand.

2. The RNAi agent of claim 1, wherein the antisense strand comprises nucleotides 2-18 of any one of the sequences in Table 2, Table 3, or Table 5C.

3. The RNAi agent of claim 1 or claim 2, wherein the sense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides differing by 0 or 1 nucleotide from any of the sense strand sequences in Table 2, Table 4 or Table 5C, and wherein the sense strand has a region having at least 85% complementarity with the antisense strand over 17 consecutive nucleotides.

4. The RNAi agent of any one of claims 1-3, wherein at least one nucleotide of the RNAi agent is a modified nucleotide or includes a modified nucleoside linker.

5. The RNAi agent of any one of claims 1-3, wherein all or substantially all nucleotides of the sense strand and / or antisense strand of the RNAi agent are modified nucleotides.

6. The RNAi agent of any one of claims 4-5, wherein the modified nucleotide is selected from: 2'-O-methyl nucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2',3'-open-ring nucleotide mimic, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, baseless nucleotide, ribitol, reverse nucleotide, reverse 2'-O-methyl nucleotide, reverse 2'-deoxynucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholinonucleotide, nucleotide containing vinylphosphonate, nucleotide containing cyclopropylphosphonate, and 3'-O-methyl nucleotide.

7. The RNAi agent of claim 5, wherein all or substantially all of the modified nucleotides are 2'-O-methylnucleotides, 2'-fluoronucleotides, or combinations thereof.

8. The RNAi agent of any one of claims 1-7, wherein the antisense strand consists of, is substantially composed of, or contains the nucleotide sequence of any one of the modified antisense strand sequences in Table 3 or Table 5C.

9. The RNAi agent of any one of claims 1-8, wherein the sense strand consists of, is substantially composed of, or contains the nucleotide sequence of any one of the modified sense strand sequences in Table 4 or Table 5C.

10. The RNAi agent of claim 1, wherein the antisense strand comprises a nucleotide sequence of any one of the modified sequences in Table 3 or Table 5C, and the sense strand comprises a nucleotide sequence of any one of the modified sequences in Table 4 or Table 5C.

11. The RNAi agent of any one of claims 1-10, wherein the RNAi agent is linked to a targeting ligand.

12. The RNAi agent of any one of claims 1-11, wherein the targeting ligand has an affinity for the desialyl glycoprotein receptor.

13. The RNAi agent of claim 11 or 12, wherein the targeting ligand comprises N-acetylgalactosamine.

14. The RNAi agent of any one of claims 11-13, wherein the targeting ligand comprises a structure of (NAG37) or (NAG37)s.

15. The RNAi agent of any one of claims 11-14, wherein the targeting ligand is linked to the sense strand.

16. The RNAi agent of claim 15, wherein the targeting ligand is attached to the 5' end of the sense strand.

17. The RNAi agent of any one of claims 1-16, wherein the sense strand is 15 to 30 nucleotides in length and the antisense strand is 18 to 30 nucleotides in length.

18. The RNAi agent of claim 17, wherein the sense strand and the antisense strand are each 18 to 27 nucleotides in length.

19. The RNAi agent of claim 18, wherein the sense strand and the antisense strand are each 18 to 24 nucleotides in length.

20. The RNAi agent of claim 19, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

21. The RNAi agent of any one of claims 1-20, wherein the RNAi agent has two blunt ends.

22. The RNAi agent of any one of claims 1-21, wherein the sense strand comprises one or two end caps.

23. The RNAi agent of any one of claims 1-22, wherein the sense strand comprises one or two reverse abase-free residues.

24. The RNAi agent of claim 1, wherein the RNAi agent comprises a sense strand and an antisense strand, the sense strand and the antisense strand forming a double-stranded sequence of any one of the double-stranded sequences shown in Tables 5A, 5B or 5C.

25. The RNAi agent of any one of claims 1-24, wherein the sense strand comprises an inverted baseless residue at the 3' end of the nucleotide sequence, at the 5' end of the nucleotide sequence, or at both.

26. The RNAi agent of claim 1, comprising an antisense strand, said antisense strand consisting of, substantially consisting of, or containing a nucleotide sequence that differs from, one of the following nucleotide sequences (5'→3') by 0 or 1 nucleotide: UAUUAAGAAAGUAUAAGCCAG (SEQ ID NO: 621); or TGACAAGAAAGUGCCCAUUUG (SEQ ID NO: 748).

27. The RNAi agent of claim 26, wherein the sense strand comprises, substantially comprises, or contains a nucleotide sequence that differs from, one of the following nucleotide sequences (5'→3') by 0 or 1 nucleotide: CUGGCUUAUACUUUCUUAAUA (SEQ ID NO: 684); or CAAAUGGGCACUUUCUUGUCA (SEQ ID NO: 699).

28. The RNAi agent of claim 26 or claim 27, wherein all or substantially all of the nucleotides are modified nucleotides.

29. The RNAi agent of claim 1, comprising an antisense strand, said antisense strand comprising, consisting of, or substantially consisting of a modified nucleotide sequence differing from, one of the following nucleotide sequences (5'→3') by 0 or 1 nucleotide: usAfsuuAfagaaagUfaUfaAfgccassg(SEQ ID NO: 391); or dTssGfsacaaGfaaagUfgCfcCfauuussg(SEQ ID NO: 427); Where a represents 2'-O-methyladenosine, c represents 2'-O-methylcytidine, g represents 2'-O-methylguanosine, and u represents 2'-O-methyluridine; Af represents 2'-fluoroadenosine, Cf represents 2'-fluorocytidine, Gf represents 2'-fluoroguanosine, and Uf represents 2'-fluorouridine; dT represents 2'-deoxythymidine; s represents a thiophosphate linker, and ss represents a dithiophosphate linker; and all or substantially all nucleotides on the sense strand are modified nucleotides.

30. The RNAi agent of claim 1, wherein the sense strand comprises, consists of, or is substantially composed of a modified nucleotide sequence differing from, one of the following nucleotide sequences (5'→3') by 0 or 1 nucleotide: cuggcuuaUfaCfUfuucuuaaua(SEQ ID NO: 515); or caaaugggCfAfCfuuucuuguca(SEQ ID NO: 530); Wherein a represents 2'-O-methyladenosine, c represents 2'-O-methylcytidine, g represents 2'-O-methylguanosine, and u represents 2'-O-methyluridine; Af represents 2'-fluoroadenosine, Cf represents 2'-fluorocytidine, Gf represents 2'-fluoroguanosine, and Uf represents 2'-fluorouridine; s represents a thiophosphate linker, and ss represents a dithiophosphate linker; and wherein all or substantially all nucleotides on the sense strand are modified nucleotides.

31. The RNAi agent of any one of claims 26-30, wherein the sense strand further comprises an inverted abase-free residue at the 3' end, the 5' end, or both of the nucleotide sequence.

32. The RNAi agent of any one of claims 26-31, wherein the RNAi agent is linked to a targeting ligand.

33. The RNAi agent of any one of claims 26-32, wherein the RNAi agent comprises: ,or 。 34. The RNAi agent of any one of claims 1-33, wherein the RNAi agent is a pharmaceutically acceptable salt.

35. The RNAi agent of claim 34, wherein the RNAi agent is a sodium salt.

36. The RNAi agent of any one of claims 1-35, wherein the 5' end of the sense strand is coupled to a targeting ligand comprising a structure containing (NAG37)s.

37. A composition comprising an RNAi agent according to any one of claims 1-36, wherein the composition comprises a pharmaceutically acceptable excipient.

38. The composition of claim 37, wherein the pharmaceutically acceptable excipient is water for injection.

39. The composition of claim 38, wherein the pharmaceutically acceptable excipient is isotonic saline.

40. A method for inhibiting the expression of the repressor subunit βE (INHBE) gene in cells, the method comprising introducing into cells an effective amount of the RNAi agent of any one of claims 1-36 or the composition of any one of claims 37-39.

41. The method of claim 40, wherein the cells are within the subject.

42. The method of claim 41, wherein the subject is a human subject.

43. The method of any one of claims 40-42, wherein the expression of the INHBE gene is suppressed by at least about 30%.

44. The method of any one of claims 40-43, wherein the INHBE activity is reduced by at least about 50%.

45. A method for treating INHBE-related diseases, disorders, or symptoms, said method comprising administering to a human subject in need a therapeutically effective amount of the composition of any one of claims 37-39.

46. ​​The method of claim 45, wherein the disease is obesity, diabetes, liver inflammation, dyslipidemia, or metabolic disease.

47. The method of any one of claims 45-46, wherein the RNAi agent is administered at a dose of about 0.05 mg / kg to about 5.0 mg / kg of human subject weight.

48. The method of any one of claims 45-47, wherein the RNAi agent is administered in two or more doses.

49. The method of any one of claims 45-48, wherein the human subject's weight is reduced by at least 5%.

50. The method of any one of claims 45-48, wherein the human subject has reduced triglycerides, LDL cholesterol, or total cholesterol.

51. The method of any one of claims 45-48, wherein the serum activin E protein level of the subject is reduced.

52. The RNAi agent of any one of claims 1-36 or the composition of any one of claims 37-39, for treating at least partially a disease, disorder, or symptom mediated by a reduction in INHBE gene expression.

53. The RNAi agent of claim 52, wherein the disease is obesity, diabetes, liver inflammation, dyslipidemia, or metabolic disease.

54. Use of the RNAi agent of any one of claims 1-36 or the composition of any one of claims 37-39 for the preparation of a pharmaceutical composition for treating at least partially mediated diseases, disorders, or symptoms caused by a reduction in INHBE gene expression.

55. The use of claim 54, wherein the disease is obesity, diabetes, liver inflammation, dyslipidemia, or metabolic disease.

56. The use according to any one of claims 52-55, wherein the RNAi agent is administered at a dose of about 0.05 mg / kg to about 5.0 mg / kg of human subject weight.

57. A method for inhibiting the expression of the INHBE gene in cells, the method comprising introducing an effective amount of an RNAi agent targeting INHBE mRNA into the cells, wherein the RNAi agent reduces INHBE activity by at least about 50%.

58. An RNAi agent targeting INHBE mRNA, wherein the RNAi agent inhibits the activity level of INHBE protein in cells.

59. Compounds of the formulas shown in Figures 5A-5C, or pharmaceutically acceptable salts thereof.

60. Compounds of the formulas shown in Figures 6A-6C.

61. A compound of the formula shown in Figures 7A-7C, or a pharmaceutically acceptable salt thereof.

62. Compounds of the formulas shown in Figures 8A-8C.

Citation Information

Patent Citations

  • Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides

    US4522811A

  • Triantennary cluster glycosides, their preparation and use

    US5885968A

  • Enzymatic nucleic acids containing 5'-and / or 3'-cap structures

    US5998203A

  • Delivery of substances to cells

    WO2000053722A2

  • Polyconjugates for in vivo delivery of polynucleotides

    WO2008022309A2