Antibodies against influenza a h1n1 virus hemagglutinin and uses thereof
By developing a hemagglutinin antibody against influenza A H1N1 virus with a specific CDR sequence, the problems of insufficient antibody recognition specificity and binding affinity in existing technologies have been solved, achieving highly sensitive and specific immunoassay, which is suitable for the diagnosis and treatment of influenza A H1N1 virus.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- YOURUISAISI (WUHAN) BIOTECHNOLOGY CO LTD
- Filing Date
- 2024-11-27
- Publication Date
- 2026-05-29
AI Technical Summary
Current technologies lack antibodies with high specificity and binding affinity for hemagglutinin of the H1N1 influenza A virus, resulting in insufficient specificity, reliability, and accuracy of immune detection, making it difficult to effectively diagnose and treat H1N1 influenza A virus infection.
An antibody against hemagglutinin of influenza A (H1N1) virus was developed, containing specific light and heavy chain variable region (CDR) sequences, for use in the preparation of a detection kit. Combined with an enzyme-linked immunosorbent assay (ELISA) kit, and using an anti-mouse IgG antibody as a detection marker, a highly sensitive and specific detection of H1 subtype hemagglutinin was achieved.
It provides antibodies with high recognition specificity and binding affinity, capable of recognizing the H1N1 influenza A virus at extremely low concentrations, with detection limits reaching the pg level, improving the specificity, reliability, and accuracy of immunoassays, and making it suitable for high-specificity and high-sensitivity detection of biological samples.
Smart Images

Figure CN122103320A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of immunological detection and diagnostic technology, and in particular to antibodies against hemagglutinin of influenza A (H1N1) virus and their applications. Background Technology
[0002] Influenza A viruses, also known as influenza, are acute respiratory infectious diseases that occur seasonally each year and are one of the leading pathogens causing human morbidity and mortality. Influenza A viruses are spherical viruses coated with lipid molecules. The surface of their viral particles contains two proteins: hemagglutinin (HA) and neuraminidase (NA). When the influenza virus enters a host cell, the HA protein binds to sialic acid on the cell surface, causing the virus to adhere to the host surface and enter the host through endocytosis. After the new virus has replicated, the NA protein is responsible for releasing the new virus from the host cell. Based on the antigenicity of HA and NA, influenza A viruses can be further divided into different subtypes; currently, 18 HA subtypes (H1-H18) and 11 NA subtypes (N1-N11) have been identified. Influenza A viruses are highly variable and pathogenic to humans, and have caused several global pandemics. In April 2009, the H1N1 influenza A virus broke out in Mexico and the United States. Subsequently, the epidemic rapidly spread to many countries in the Americas, Europe, and Asia, becoming the dominant influenza virus strain globally, including in my country. The H1N1 influenza A virus is highly pathogenic, and infection easily leads to severe cases, posing a serious threat to human life, health, and social security. Several possible mechanisms for the development of severe cases and even death after H1N1 infection have been previously identified, including excessive immune responses, cytokine storms, and the formation of immune complexes. However, the exact pathogenesis of the influenza A virus remains unclear. Therefore, long-term effective surveillance of the H1N1 influenza A virus and the development of its treatments are of particular concern.
[0003] Antibody-mediated diagnosis and treatment have shown good results in the prevention and control of H1N1 influenza virus. On the one hand, immunological diagnostic technology based on antibody detection is an effective means of qualitative and quantitative detection of H1N1 influenza virus. On the other hand, neutralizing antibody therapy can achieve the goal of rapid treatment of H1N1 influenza by blocking the binding of the virus to target cells and inducing immune cells to kill virus-infected cells. Moreover, it has the advantages of high specificity, strong targeting and low toxicity. Antibody therapy for H1N1 influenza has shown great clinical advantages.
[0004] Given the importance of the hemagglutinin (HA) protein in the infection of host cells by influenza A virus, HA has become a key target for the development of specific antibodies against H1N1 influenza A virus and for diagnostic research. Therefore, developing specific antibodies against H1 subtype hemagglutinin is of significant public health importance for studying the possible pathogenic mechanisms of H1N1 influenza A virus and for the diagnosis and treatment of influenza virus infection. Summary of the Invention
[0005] To address the technical problems existing in the prior art, this invention provides an antibody with high recognition specificity, sensitivity, and binding affinity against hemagglutinin of the H1N1 influenza A virus. This invention further provides the application of the aforementioned antibody in the preparation of an H1N1 influenza A virus detection kit, and provides a detection kit containing the aforementioned antibody. This invention is specifically achieved through the following technical solutions:
[0006] The first aspect of this invention provides an antibody against hemagglutinin of influenza A (H1N1) virus, comprising a light chain variable region and a heavy chain variable region, wherein the amino acid sequence of CDR1 on the light chain variable region is “DHINNW”, the amino acid sequence of CDR2 is “GAT”, and the amino acid sequence of CDR3 is “QQYWSTPFT”; and the amino acid sequence of CDR1 on the heavy chain variable region is “GFSLANYG”, the amino acid sequence of CDR2 is “VWAAGDT”, and the amino acid sequence of CDR3 is “AKTGTRGGYFDV”.
[0007] Furthermore, the amino acid sequence of the variable region of the antibody light chain is shown in SEQ ID NO.2, and the amino acid sequence of the variable region of the heavy chain is shown in SEQ ID NO.6.
[0008] Furthermore, the amino acid sequence of the antibody light chain is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.5.
[0009] Furthermore, the antibody is a full-length antibody or the antigen-binding region of the full-length antibody; the antigen-binding region is selected from Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv or sc(Fv)2.
[0010] A second aspect of the present invention provides a nucleic acid molecule that encodes an antibody against hemagglutinin of influenza A (H1N1) virus as described above.
[0011] Furthermore, the nucleic acid sequence of the antibody light chain variable region is as shown in the sequence of bases 1-321 of SEQ ID NO.10 or a complementary sequence, and the nucleic acid sequence of the heavy chain variable region is as shown in the sequence of bases 1-354 of SEQ ID NO.11 or a complementary sequence.
[0012] Furthermore, the nucleic acid sequence of the antibody light chain is as shown in SEQ ID NO.10 or a complementary sequence, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.11 or a complementary sequence.
[0013] The third aspect of the present invention provides the use of the antibody against hemagglutinin of influenza A H1N1 virus as described above in the preparation of an influenza A H1N1 virus detection kit.
[0014] A fourth aspect of the present invention provides a detection kit for influenza A (H1N1) virus, the detection kit comprising an antibody against hemagglutinin of influenza A (H1N1) virus as described above.
[0015] Furthermore, the detection kit is an enzyme-linked immunosorbent assay (ELISA) kit, and the detection kit also includes a detection label-modified secondary antibody, wherein the secondary antibody is an anti-mouse IgG antibody and the secondary antibody is used to bind to an antibody against hemagglutinin of influenza A H1N1 virus.
[0016] Compared with the prior art, the advantages and positive effects of the present invention are as follows:
[0017] The antibody provided by this invention exhibits high recognition specificity, sensitivity, and binding affinity for hemagglutinin of the H1N1 influenza A virus, and its half-maximum effective concentration (EC50) for recognizing and binding H1 subtype hemagglutinin is [value missing]. 50 With a detection limit as low as 0.01377 μg / mL, it provides a high-performance antibody tool for the qualitative or quantitative detection of influenza A H1N1 virus. It can effectively improve the specificity, reliability, accuracy and precision of immunoassay for influenza A H1N1 virus, and the detection limit can reach the pg level, which plays an important role in the diagnosis and treatment of influenza virus infection. Attached Figure Description
[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0019] Figure 1 This is an electrophoresis image of the recombinant HA-H1(D18-Q528 R343S) protein purified in Example 1 of this invention;
[0020] Figure 2 This is a graph showing the antibody titer detection results of mouse immune serum in Example 1 of the present invention;
[0021] Figure 3This is an electrophoresis diagram of the monoclonal antibody purified in Example 1 of the present invention;
[0022] Figure 4 This is a curve showing the antibody titer of the monoclonal antibody binding to H1 subtype hemagglutinin in Example 2 of the present invention.
[0023] Figure 5 This is a sensitivity curve for detecting H1 subtype hemagglutinin using monoclonal antibody in Example 3 of the present invention. Detailed Implementation
[0024] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The embodiments described herein are for illustrative purposes only and are not intended to limit the invention.
[0025] Based on the information contained herein, various changes to the precise description of the invention can be readily made by those skilled in the art without departing from the spirit and scope of the appended claims. It should be understood that the scope of the invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are merely illustrative of specific aspects of the invention. In fact, various modifications to embodiments of the invention that will be apparent to those skilled in the art or related fields are covered within the scope of the appended claims.
[0026] To better understand the invention and not to limit its scope, all figures and other numerical values used in this invention to indicate amounts, percentages, or other quantities should, in all cases, be understood to be modified by the word "approximately." Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods.
[0027] Additionally, it should be noted that, unless otherwise defined, the scientific and technical terms used in the context of this invention should have the meanings commonly understood by those skilled in the art.
[0028] The terms “comprising,” “including,” “containing,” “having,” and similar words are non-restrictive and can include other steps and components that do not affect the result. The term “and / or” should be considered as a specific disclosure of each of the two specified features or components, with or without the other. For example, “A and / or B” is considered to include (i) A, (ii) B, and (iii) A and B.
[0029] The terms "mouse monoclonal antibody," "monoclonal antibody," "mouse-derived antibody," and "mouse monoclonal antibody" have the same meaning. Unless otherwise specified, they all refer to mouse antibodies that specifically bind to H1 subtype hemagglutinin (HA). The modifier "mouse" indicates that the antibody's complementarity-determining region (CDR) is derived from a mouse immunoglobulin sequence.
[0030] An antibody is an immunoglobulin molecule that specifically binds to a target antigen or epitope through at least one antigen recognition site located in the variable region of the immunoglobulin molecule. In this invention, the term "antibody" should be interpreted in the broadest sense and includes various antibody structures, including but not limited to so-called full-length antibodies, antibody fragments, and their genetic or chemical modifications, provided they exhibit the desired antigen-binding activity.
[0031] A typical antibody molecule (full-length antibody) consists of two identical light chains (L) and two identical heavy chains (H). Light chains can be classified into two types: κ chains and λ chains; heavy chains can be classified into five types: μ, δ, γ, α, and ε chains, with antibodies defined as IgM, IgD, IgG, IgA, and IgE, respectively. The amino acid sequences near the N-terminus of both the heavy and light chains vary considerably, while the amino acid sequences of other parts are relatively constant. The regions with significant amino acid sequence variation near the N-terminus in both the light and heavy chains are called variable regions (V), and the regions with relatively stable amino acid sequences near the C-terminus are called constant regions (C). The variable regions of the heavy chain (VH) and light chain (VL) are usually the most variable parts of the antibody and contain antigen recognition sites. The VH and VL regions can be further subdivided into hypervariable regions (HVR) and framework regions (FR). The hypervariable region, also known as the complementarity-determining region (CDR), is a ring structure. Heavy chain CDRs and light chain CDRs are tightly joined together by the FR region and cooperate to form a surface that is complementary to the three-dimensional structure of the target antigen or epitope, determining the antibody's specificity and serving as the site for antibody recognition and antigen binding. The FR regions are the more conserved parts of the VH and VL, generally exhibiting a β-sheet configuration, linked by three CDRs forming a connecting loop. Each VH and VL typically consists of three CDRs and four FRs, arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
[0032] CDRs and FRs can be identified according to Kabat definitions, Chothia definitions, the sum of Kabat and Chothia definitions, AbM definitions, contact definitions, IMGT unique numbering definitions and / or conformational definitions, or any CDR determination method known in the art. As used in this invention, they are defined by the IMGT numbering system.
[0033] The light chain constant region (CL) and heavy chain constant region (CH) do not directly participate in antibody-antigen binding, but they exhibit different effector functions, such as involvement in antibody-dependent cytotoxicity. The CL lengths of different Ig types (κ or λ) are generally consistent, but the CH lengths differ among Ig classes; for example, IgG, IgA, and IgD include CH1, CH2, and CH3, while IgM and IgE include CH1, CH2, CH3, and CH4. The amino acid sequences of the antibody heavy and light chain constant regions are well-known in the art.
[0034] Full-length antibodies are the most complete antibody molecular structures, with a typical Y-type molecular structure. Therefore, in the context of this invention, "full-length antibody," "complete antibody," and "Y-type antibody" have the same meaning and can be used interchangeably.
[0035] An antibody fragment is one or more portions or segments of a full-length antibody that substantially retain the same biological function or activity as the full-length form. Specifically, an antibody fragment includes at least the same CDR region as the full-length antibody, and more preferably the same variable region, thereby retaining complete antigen recognition and binding sites, enabling it to bind to the same antigens, especially the same epitopes, as the full-length antibody. Typical examples of antibody fragments include Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv, and sc(Fv)2, which can be obtained using conventional techniques in the art.
[0036] (i) Fab: An antigen-binding fragment (Fab) is a monovalent fragment consisting of a complete light chain (variable and constant regions) and a portion of a heavy chain (variable and first constant region). Fragments such as Fab, F(ab')2, and Fab' can be obtained by protease cleavage of a full-length antibody. For example, under the action of papain, IgG can be degraded into two Fab fragments and one Fc fragment; under the action of pepsin, IgG can be degraded into one F(ab')2 fragment and one pFc' fragment. The F(ab')2 fragment is further reduced to form two Fab' fragments. Because Fab possesses an antigen-binding region and a portion of a constant region, it not only has antibody-antigen affinity and excellent tissue penetration like scFv, but also has a more stable structure.
[0037] (ii)F(ab)2: Contains a bivalent segment consisting of two Fabs connected by a disulfide bridge in the hinge region.
[0038] (iii) Fv: The variable fragment (Fv) is located at the N-terminus of the antibody Fab fragment. It contains only the variable region and consists of a variable region of one light chain and one heavy chain. It is a non-covalently bound dimer of VH and VL (VH-VL dimer). The three CDRs of each variable region interact to form an antigen-binding site on the surface of the VH-VL dimer, which has the ability to recognize and bind antigens, although the affinity is lower than that of the intact antibody.
[0039] (iv)(Fv)2: Consists of two Fv segments covalently linked together.
[0040] (v)scFv: A single-chain variable fragment (scFv) is an Fv fragment composed of a single polypeptide chain, consisting of a heavy chain variable region (VH) and a light chain variable region (VL) linked by a flexible linker (typically composed of 10-25 amino acids). It retains the original antibody's specificity for binding to the antigen. The linker in this invention is not particularly limited as long as it does not interfere with the expression of the antibody variable regions linked to its two ends. Compared to full-length antibodies, scFv has a smaller molecular weight, thus exhibiting higher penetration and lower immune side effects.
[0041] The (vi)sc(Fv)2 segment is formed by connecting two heavy chain variable regions and two light chain variable regions through a joint, etc.
[0042] In some embodiments, the full-length sequence of the antibody or antibody fragment of the present invention may include a complementarity-determining region (CDR) and a framework region (FR) derived from a murine immunoglobulin sequence. In other embodiments, the antibody may contain amino acid residues encoded by a non-murine immunoglobulin sequence, such as humanized antibodies, chimeric antibodies, etc., to reduce the body's rejection response while maintaining the desired specificity and affinity. The term "chimeric antibody" refers to an antibody in which a portion is derived from a specific source or species, while the remainder is derived from a different source or species. The term "humanized antibody" is a chimeric antibody containing the CDR region of a non-human antibody, such as a murine antibody, and the FR region derived from a human antibody. In some cases, the variable region of the non-human antibody binds to the constant region of a human antibody, such as a human-mouse chimeric antibody; in other cases, the CDR region of the non-human antibody binds to the FR region and constant region derived from a human antibody sequence, i.e., grafting the CDR region of the non-human antibody onto the FR sequence of a human antibody, where the framework sequence is derived from one or more other human antibody variable region framework sequences. In this invention, the CDR region in the chimeric antibody or humanized antibody is derived from the mouse CDR region.
[0043] The terms "monoclonal antibody" or similar terms are used interchangeably and refer to a homogeneous group of antibodies, meaning that the individual antibodies constituting the group are identical except for a small number of naturally occurring mutations and / or post-translational modifications (e.g., isomerization, amidation). A "monoclonal antibody" is highly specific, exhibiting a single binding specificity and affinity for the same or substantially identical epitopes on an antigen. The modifier "monoclonal" indicates that the antibody is obtained from a substantially homogeneous group of antibodies and should not be interpreted as limiting the source or method of preparation of the antibody. This antibody can be prepared by a variety of methods, including but not limited to hybridoma, phage display, yeast display, recombinant DNA, single-cell screening, or single-cell sequencing.
[0044] The term “specific binding” is a well-known term in the art. A molecule exhibits “specific binding” if it reacts more frequently, more rapidly, for a longer duration, and / or with greater affinity for a particular target antigen or epitope than it reacts with other target antigens or epitopes. “Specific binding”, or “preferred binding”, does not necessarily require (although may include) exclusive binding.
[0045] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings.
[0046] This invention provides an antibody against hemagglutinin of influenza A (H1N1) virus, comprising a light chain variable region and a heavy chain variable region. The amino acid sequence of CDR1 on the light chain variable region is “DHINNW”, the amino acid sequence of CDR2 is “GAT”, and the amino acid sequence of CDR3 is “QQYWSTPFT”. The amino acid sequence of CDR1 on the heavy chain variable region is “GFSLANYG”, the amino acid sequence of CDR2 is “VWAAGDT”, and the amino acid sequence of CDR3 is “AKTGTRGGYFDV”.
[0047] This invention uses the gene sequence corresponding to the D18-Q528 amino acid fragment of the H1N1 influenza virus (A / New Caledonia / 20 / 1999(H1N1)) as an immunogen. Mice are immunized using DNA immunoassay techniques to isolate the monoclonal antibody of this invention. This antibody can bind with high affinity to H1 subtype hemagglutinin, effectively recognizing and sensitively binding to antigen proteins in the reaction system even at extremely low antibody concentrations. Its half-maximal effective concentration (EC50) for binding H1 subtype hemagglutinin is [not specified in the original text]. 50The antibody concentration (H1N1) is 0.01377 μg / mL, exhibiting high antigen recognition specificity and sensitivity. It provides a high-performance antibody tool for the qualitative or quantitative detection of influenza A (H1N1) virus, effectively improving the specificity, reliability, accuracy, and precision of immunoassay for H1N1 virus, and playing a crucial role in the diagnosis and treatment of influenza virus infection. Using the antibody of this invention as the detection antibody, an enzyme-linked immunosorbent assay (ELISA) system was constructed for the quantitative detection of hemagglutinin content in biological samples. The detection limit can reach the pg level, making it suitable for the high-specificity and high-sensitivity detection of low concentrations of virus in biological samples.
[0048] Optionally, both the light chain variable region and the heavy chain variable region include four frame regions (FRs), which are arranged alternately with three core parameters (CDRs) to form the variable region. The amino acid sequence of the antibody light chain variable region (VL) is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region (VH) is shown in SEQ ID NO.6.
[0049] Optionally, the antibody further includes a light chain constant region (CL) and a heavy chain constant region (CH), where CL and VL constitute the light chain (FL), and CH and VH constitute the heavy chain (FH). The constant regions of the antibody are typically available through public searches, such as searching for mouse IgG gamma C reign to obtain CH and searching for mouse IgG Kappa Creign to obtain CL using the IMGT online database (www.imgt.org).
[0050] Specifically, the amino acid sequence of the antibody light chain is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.5.
[0051] Optionally, the antibody is a full-length antibody (with a typical Y-shaped molecular structure) or the antigen-binding region of the full-length antibody; the antigen-binding region refers to a polypeptide that substantially retains the same biological function or activity as the full-length antibody. Specifically, the antigen-binding region includes the CDR region as described above, and more preferably has the variable region as described above, thereby retaining an intact antigen recognition and binding site, capable of binding to the same antigen as the full-length antibody, especially to the same epitope. Optionally, the antigen-binding region is selected from at least one of Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv, and sc(Fv)2. These antigen-binding regions can be obtained using conventional techniques in the art.
[0052] Another embodiment of the present invention provides a nucleic acid molecule, a recombinant vector containing the nucleic acid molecule, or a host cell containing the nucleic acid molecule, wherein the nucleic acid molecule is used to encode an antibody against hemagglutinin of influenza A H1N1 virus as described above.
[0053] Nucleic acid molecules can be in the form of DNA (such as cDNA, genomic DNA, or synthetic DNA) or RNA (such as mRNA or synthetic RNA). DNA can be single-stranded or double-stranded, and can be a coding strand or a non-coding strand.
[0054] The sequence of a nucleic acid molecule can be derived from the antibody AA sequence using conventional methods such as codon coding rules. The full-length sequence of a nucleic acid molecule or a fragment thereof can usually be obtained using PCR amplification, recombination, or artificial synthesis. The obtained nucleic acid molecule is inserted into an expression vector, then introduced into host cells, and cultured under specific conditions to express and obtain the antibody.
[0055] For example, the nucleic acid sequence of the antibody light chain variable region is as shown in the sequence of bases 1-321 of SEQ ID NO.10 or a complementary sequence, and the nucleic acid sequence of the heavy chain variable region is as shown in the sequence of bases 1-354 of SEQ ID NO.11 or a complementary sequence.
[0056] For example, the nucleic acid sequence of the antibody light chain is as shown in SEQ ID NO.10 or a complementary sequence thereto, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.11 or a complementary sequence thereto.
[0057] Those skilled in the art will understand that, due to the degeneracy of the genetic code, nucleic acid molecules other than those in the above examples can also encode the antibodies of the present invention. Therefore, the nucleic acid molecules in the above examples should not be regarded as limiting the scope of protection of the present invention.
[0058] The original vector used to construct the recombinant vector can be any vector conventional in the art, as long as it can contain the nucleic acid molecule. Typical vectors include plasmids (such as pBR322, pUC series, pET series, pGEX series), viral vectors, bacteriophages (such as λgt4λB, λ-Charon, λΔz1, and M13), viscera, and mini-chromosomes. The vector can be a cloning vector (i.e., used to transfer nucleic acid molecules into a host and multiply them in host cells) or an expression vector (i.e., containing the necessary genetic elements to allow the nucleic acid molecule inserted into the vector to be expressed in the host cell). The nucleic acid molecules of the present invention can be inserted into suitable vectors to form cloning vectors or expression vectors carrying the nucleic acid molecules. This is well known in the art and will not be described in detail here.
[0059] The nucleic acid molecules encoding the antibodies FL and FH of this invention can be inserted into two vectors, which can be introduced into the same or different host cells. When the heavy and light chains are expressed in different host cells, each chain can be isolated from the host cell expressing it, and the isolated heavy and light chains can be mixed and incubated under suitable conditions to form antibodies. In other embodiments, the nucleic acid molecules encoding antibodies FL and FH can also be cloned into a single vector, with each nucleic acid sequence ligated downstream of a suitable promoter; for example, each nucleic acid sequence encoding the heavy and light chains can be operatively ligated to different promoters, or the nucleic acid sequences encoding the heavy and light chains can be operatively ligated to a single promoter, such that both the heavy and light chains can be expressed by the same promoter. The choice of expression vector / promoter depends on the type of host cell used to produce the antibodies.
[0060] Recombinant vector transfection or transformation into host cells is performed using conventional techniques. When the host is a prokaryote such as *E. coli*, competent cells capable of absorbing DNA are harvested after the exponential growth phase and treated with CaCl2 or MgCl2; alternatively, microinjection, electroporation, or liposome packaging can be used. When the host is a eukaryote, the following DNA transfection methods can be used to achieve gene delivery: calcium phosphate coprecipitation, microinjection, electroporation, liposome packaging, or particle bombardment.
[0061] The host cell can be a prokaryotic or eukaryotic cell. Examples of prokaryotic host cells that can be used in this invention include, but are not limited to, *Escherichia coli* (e.g., DH5α, JM109, BL21, W3110), *Bacillus* spp. (e.g., *Bacillus subtilis*, *Bacillus thuringiensis*), *Enterobacterium* strains (e.g., *Salmonella typhimurium*, *Serratia marcescens*), and *Pseudomonas* spp. Examples of eukaryotic host cells that can be used for transformation include, but are not limited to, yeast, insect cells, and animal cells, such as Drosophila S2 or Sf9 cells, mammalian CHO, CHO DG44, CHO-S, COS-7, 293 series cells, HepG2, Huh7, 3T3, RIN, MDCK, and HEK293 cell lines. After obtaining host cells transfected or transformed with the recombinant vector described above, they can be cultured under suitable conditions to express antibodies, which can then be isolated to obtain purified antibodies.
[0062] In a preferred embodiment, the recombinant vector is the eukaryotic expression vector pcDNA3.1, and the host cell is human kidney epithelial cells (293F cells).
[0063] Another embodiment of the present invention provides the application of the antibody against hemagglutinin of influenza A H1N1 virus as described above in the preparation of an influenza A H1N1 virus detection kit.
[0064] The advantages of the antibody against hemagglutinin of influenza A H1N1 virus in the preparation of influenza A H1N1 virus detection kit are the same as the advantages of the antibody against hemagglutinin of influenza A H1N1 virus over the prior art, as described above, and will not be repeated here.
[0065] This invention also provides a detection kit for influenza A (H1N1) virus, the detection kit comprising the antibody against hemagglutinin of influenza A (H1N1) virus as described above.
[0066] It should be noted that the antibodies of the present invention can be used alone or combined with or conjugated with detection markers to form antibody-drug conjugates. In some embodiments, the antibodies of the present invention are used as antigen-binding antibodies, which specifically recognize and bind to the hemagglutinin antigen of influenza A H1N1 virus in the sample to be tested. Qualitative or quantitative detection of influenza A H1N1 virus is then achieved by generating a recognizable signal change through the detection marker linked to it. In other embodiments, the antibody against influenza A H1N1 virus hemagglutinin is not labeled (as a primary antibody or capture antibody), but the detection marker is conjugated to a secondary antibody (as a detection antibody) or other molecules that can bind to the primary antibody. For example, if the antibody against influenza A H1N1 virus hemagglutinin is a murine IgG antibody, then the secondary antibody can be an anti-mouse IgG antibody. Thus, the secondary antibody conjugated with the detection marker specifically binds to the antibody of the present invention, generating a recognizable signal change, thereby achieving qualitative or quantitative detection of influenza A H1N1 virus.
[0067] The detection markers described above for generating identifiable signal changes include, but are not limited to: biotin, fluorescent dyes (such as umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazineamine fluorescein, dansyl chloride), fluorescent proteins (such as isophycocyanin, phycoerythrin, PerCP and phycocyanin), enzymes (such as alkaline phosphatase, acid phosphatase, β-galactosidase, glucose oxidase, horseradish peroxidase, acetylcholinesterase, avidin), colloidal gold, colored magnetic beads, latex particles, radionuclides, detection antibodies or combinations thereof.
[0068] The detection methods described above include, but are not limited to, enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunospot assay (ELISPOT), immunohistochemistry (IHC), immunofluorescence assay (IF), Western blotting (WB), and flow cytometry (FC). Samples to be tested include, but are not limited to, serum, plasma, urine, cell culture medium, and tissue homogenate.
[0069] Optionally, the detection kit is an enzyme-linked immunosorbent assay (ELISA) kit, and the detection kit further includes a detection label-modified secondary antibody, wherein the secondary antibody is an anti-mouse IgG antibody and the secondary antibody is used to bind to an antibody against hemagglutinin of influenza A H1N1 virus.
[0070] The present invention will be further illustrated below with reference to specific embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual (Fourth Edition)* published by Cold Spring Harbor Laboratory, or generally under the conditions recommended by the manufacturer.
[0071] Example 1: Preparation of murine monoclonal antibody against hemagglutinin of influenza A (H1N1) virus
[0072] In antibody development, it is necessary to ensure the stability and consistency of the hemagglutinin (HA) antigen for reliable antibody screening and evaluation. However, certain parts of the HA protein may be prone to denaturation or degradation, thus affecting the screening effect of the antibody. Therefore, this invention employs DNA immunization technology, using the HA nucleic acid sequence as the antigen for immunization. After immunizing mice with HA nucleic acid, immune-enhanced B lymphocytes are isolated from the spleen, and antigen-specific B lymphocytes are selected and cultured. Then, RNA is extracted from the antigen-specific B lymphocytes and reverse transcribed into cDNA. Finally, naturally paired antibody heavy chain variable region (VH) and light chain variable region (VL) genes are obtained by PCR amplification, loaded into expression vectors respectively, and the light chain and heavy chain expression vectors are co-transfected into host cells. After culture and purification, a murine monoclonal antibody against HA, 2B2, is obtained.
[0073] The antibody sequencing was performed by Kinkai Biotechnology Co., Ltd. The amino acid (AA) and nucleic acid (DNA) sequences of the antibody are shown in Table 1. In the table, LCDR1-3 represent the light chain complementarity-determining regions CDR1-3 and HCDR1-3 represent the heavy chain complementarity-determining regions CDR1-3, respectively.
[0074] Table 1. Sequence information of monoclonal antibodies and immunogens in this embodiment.
[0075]
[0076]
[0077] This embodiment specifically includes the following steps:
[0078] 1.1 Preparation of recombinant plasmids and recombinant proteins containing the H1 subtype hemagglutinin (HA-H1) gene
[0079] This embodiment uses the gene sequence corresponding to the D18-Q528 amino acid fragment of hemagglutinin (HA-H1) from the H1N1 influenza virus (A / New Caledonia / 20 / 1999(H1N1), NCBI accession number AAP34324.1) as an immunogen, and designs a mutation from R to S at position 343 of this sequence. The R343S mutation can enhance the pathogenicity of the influenza virus, facilitate faster viral replication and spread within the host, and affect the virus's sensitivity to existing antiviral drugs. This change may lead to a decrease in the efficacy of existing drugs against the mutated virus, increasing the difficulty of treatment. The amino acid sequence of HA-H1 (D18-Q528 R343S) is shown in SEQ ID NO. 12.
[0080] A 6×his tag was added to the C-terminus of the HA-H1 (D18-Q528 R343S) gene sequence, and the aforementioned gene fragment was synthesized into the eukaryotic expression vector pCDNA3.1 using a whole-gene synthesis method to obtain a recombinant plasmid. 1 μL of the recombinant plasmid was added to 20 μL of DH5α competent cells, incubated on ice for 30 min, followed by heat shock for 90 s. Then, 500 μL of antibiotic-free LB medium was added, and the cells were incubated at 37°C and 220 rpm for 45 min. 100 μL of the incubated bacterial solution was spread onto an ampicillin-resistant plate, and single colonies were picked and cultured overnight in LB medium for 16 h. Plasmid extraction was performed using a low endotoxin plasmid extraction kit (purchased from Tiangen Biotech, catalog number DP123) to obtain a recombinant plasmid containing the HA-H1 gene.
[0081] Expression and purification of recombinant HA-H1 (D18-Q528 R343S) protein: The above recombinant plasmid was transiently transfected into 293F cells to obtain a transiently transfected cell line expressing recombinant HA-H1 (D18-Q528 R343S) protein. The transfected cell lines were seeded into 100 mL of CD05 medium (purchased from OPMI, catalog number 81075-001) and cultured on a constant temperature shaker at 125 rpm / min, 37°C, 95% humidity, and 8% CO2. After 6 days of culture, the cell culture was removed, centrifuged, and the supernatant was collected and purified using a His-tagged affinity purification column. The purified protein was subjected to SDS-PAGE electrophoresis, and the results are shown below. Figure 1 As shown, the purity of the purified protein was 95%. This purified protein was subsequently used to detect the original protein.
[0082] 1.2 In vivo delivery of recombinant DNA plasmids in mice
[0083] Gold powder (purchased from AlphaAesar, catalog number 039817.03), spermidine (Sigma S0266), and recombinant DNA plasmid containing HA-H1 (D18-Q528 R343S) were mixed at a mass ratio of 500:250:1. After mixing, 200 μL of 2.5M calcium chloride was added, and the mixture was mixed again and allowed to stand for 5 min. The supernatant was then removed by centrifugation. The mixture was washed five times with 1 mL of anhydrous ethanol, and finally resuspended in 2.5 mL of anhydrous ethanol. The anhydrous ethanol suspension of the mixture was transferred to a tubing, which was placed on a bullet preparation apparatus and allowed to stand for 10 min. The anhydrous ethanol was removed from the tubing, and the tubing was dried completely by rotating it with N2. The gene gun was connected to the helium cylinder regulator through a helium tubing, and the gas pressure was adjusted to a suitable level for immunizing mice at approximately 1-2 MPa. After correctly mounting the bullet onto the magazine, the magazine was correctly mounted onto the gene gun. The gene gun was triggered on the shaved abdominal skin, and the chamber was moved to the next bullet position. Each mouse received six non-overlapping gene gun injections. Two weeks later, a DNA booster immunization was administered, with the same immunization method, for a total of three booster immunizations. Ten days after the final booster immunization, immune serum was collected, and serum titer was determined using ELISA with recombinant HA-H1 (D18-Q528 R343S) protein as the detection source. The spleens of mice with the highest serum titers were selected.
[0084] The above-mentioned immune serum titer was determined by indirect ELISA, as follows: 1) Coating HA-H1: 1 mg / mL recombinant HA-H1 (D18-Q528 R343S) protein solution was diluted with carbonate buffer (0.05 M, pH 9.6), and then coated at 100 μL / well in a polystyrene 96-well microplate, with a coating concentration of 1 μg / mL, and incubated overnight at 4℃; 2) Blocking: The well plate incubated overnight at 4℃ was removed, and 300 μL / well of washing buffer (PBS containing 0.05% (v / v) Tween-20) was added to wash three times. Then, 300 μL / well of blocking buffer (PBS containing 1% BSA, 0.5% gelatin, and 5% sucrose) was added, and the plate was blocked at 37℃ for 2 h. Wash the plate three times with washing buffer; 3) Serial dilution and addition of serum to be tested: Dilute mouse immune serum with antibody diluent (PBS containing 1% BSA), starting at 1:1000, and perform three-fold dilutions for a total of 8 gradients. The dilution ratio can be adjusted according to the actual situation; Add 100 μL of serum diluent to 96-well microplates and incubate at 37°C for 1 h; then wash the plate three times with washing buffer; 4) Secondary antibody incubation: Add horseradish peroxidase-labeled goat anti-mouse IgG (purchased from Jackson) diluted 1:10000 with antibody diluent. Immunoresearch, catalog number 115-035-071), 100 μL / well, incubate at 37℃ for 50 min, then wash the plate three times with washing buffer; 5) Terminate the reaction and develop color: Add 100 μL / well of TMB for color development, incubate at 37℃ in the dark for 10 min, then add 100 μL / well of 0.5 M oxalic acid solution to terminate the reaction, measure the absorbance at 450 nm and 630 nm, using pre-immunized mouse serum as a negative control, and measure the absorbance (OD). 450 -OD 630 The titer of immune serum is determined by a ratio of ≥2.1 to the control value.
[0085] Figure 2 The titers of mouse serum after three immunizations with recombinant DNA plasmids are shown. M01-M05 are mouse numbers, NC represents mouse negative serum, and Blank represents the antibody diluent used to dilute the serum. The titer of the immune serum can reach up to 1:1,000,000.
[0086] 1.3 Screening of specific B lymphocytes secreting anti-HA-H1 antibodies
[0087] Splenic cell isolation and enrichment: Mouse spleens were placed in a 70 μm cell sieve in RPMI 1640 basal medium containing 100 U / mL penicillin and 100 μg / mL streptomycin. The spleen cells were ground into single cells using a grinding rod and then suspended in culture medium in a culture dish after passing through the cell sieve. Large cell clumps and tissue membranes were filtered out from the resulting cell suspension. After centrifugation at 400g for 5 min, the supernatant was discarded, and the spleen cells were retained. CD138+B cells were enriched using the PanB cell enrichment kit (Mittentech, catalog number 130-095-813) and the CD138+B cell enrichment kit (Mittentech, catalog number 130-092-263).
[0088] B cell sorting: Biotin labeling was performed on recombinant HA-H1 (D18-Q528 R343S) protein. The steps were as follows: 50 mg of Biotin-PEG4-NHS (purchased from Aladdin, catalog number B122233) was added to 1 mL of DMSO (purchased from Sigma, catalog number 276855), vortexed for 2 min to dissolve, and prepared a Biotin-PEG4-NHS stock solution (concentration approximately 8 mM). At a biotin:HA-H1 protein molar ratio of 20:1, the required biotin solution was added to 100 μL of the HA-H1 protein solution to be labeled, mixed thoroughly, and briefly centrifuged. The mixture was then reacted at 37°C in the dark for 30 min. After the reaction was complete, 200 μL of PBS was added, mixed well, and transferred to an ultrafiltration tube. The mixture was centrifuged at 4°C and 12000g for 2-5 min. This step was repeated 5 times to remove free biotin and other interfering components. After the final centrifugation, the residual droplets in the ultrafiltration column were mixed, and the ultrafiltration column was inverted and placed in a new outer tube. The column was then centrifuged at 4°C and 1000g for 2 min, and the liquid collected was the biotin-labeled HA-H1 protein solution. The biotin-labeled recombinant HA-H1 (D18-Q528 R343S) protein was mixed thoroughly with avidin magnetic beads (purchased from BEAVER 22308), and incubated at room temperature by rotation for 60 min. The supernatant was removed by magnetic separation for 1 min, and the mixture was washed once for use as a sorting agent. CD138+B cells and recombinant HA-H1 (D18-Q528 R343S) protein-conjugated magnetic beads were resuspended separately with PE fluorescent secondary antibody (purchased from Jackson Immunoresearch, catalog number 115-115-164). The two components were then used to generate droplets using a DAP droplet generation system, and the generated droplets were incubated at 37°C and 5% CO2 for 60 min. After observing distinct positive droplets under a fluorescence microscope, PE+ signal droplets were sorted using the DAP CSP system. The sorted droplets were stored in an RNase Inhibitor (Thermo, catalog number 10777019) at -80°C.
[0089] 1.4 Single-cell antibody gene amplification and sequencing
[0090] Sequencing of the mouse monoclonal antibody gene: Antigen-positive B cells were collected, lysed, and RNA was extracted and reverse transcribed into cDNA. The variable region genes (VH and VL) of the mouse monoclonal antibody light and heavy chains were amplified from the cDNA of the corresponding positive clones using RT-PCR, and their sequences were determined by sequencing. The upstream primer for PCR amplification consisted of the vector homologous arm sequence and the antibody signal peptide sequence, while the downstream primer consisted of the vector homologous arm sequence and the antibody constant region sequence. The underlined sequence indicates the vector homologous arm sequence. Specifically:
[0091] The nucleotide sequences of the upstream primer (F) and downstream primer (R) for heavy chain variable region (VH) PCR are as follows:
[0092] VH-F: tatagggagacccaagctg atggagaccgacaccctgctgctgtgggtgctgctg (see SEQ IDNO.13);
[0093] VH-R: gagctcggtaccaagctt tcacttgccgggggagtggctcag (see SEQ ID NO. 14);
[0094] The nucleotide sequences of the upstream primer (F) and downstream primer (R) for light chain variable region (VL) PCR are as follows:
[0095] VL-F: tatagggagacccaagctg atggagaccgacacc (see SEQ ID NO. 15);
[0096] VL-R: tatagggagacccaagctg tcagcactcgttcctgttgaaggacttcac (see SEQ ID NO. 16).
[0097] The signal peptide used for antibody expression in mice is usually “METDTLLLWVLLLWVPGSTG (the encoding gene can be ATGGAGACCGACACCCTGCTGCTGTGGGTGCTGCTGCTGTGGGTCCCTGGCTCCACAGG C)”. Of course, those skilled in the art can replace the signal peptide with other signals after obtaining the antibody sequence to express the antibody. Therefore, the signal peptide sequence is not shown in the antibody sequences in Table 1 of the embodiments of the present invention.
[0098] The antibody variable region DNA fragment containing the signal peptide, amplified by PCR, was double-digested with EcoR1 and Xho1 restriction endonucleases. Additionally, the pcDNA3.1 vector carrying the light chain constant region (CL) and heavy chain constant region (CH) genes was double-digested with EcoR1 and Xho1 restriction endonucleases. Then, the antibody variable region genes were ligated upstream of the constant region of the pcDNA3.1 vector using homologous recombination. After analysis, the correct recombinant plasmids pcDNA3.1 encoding the antibody light and heavy chains were obtained. The antibody constant region sequence is highly conserved. The CL and CH genes can be obtained by searching the IMGT online database (www.imgt.org). For example, searching for mouse IgG gamma C reign yields CH, and searching for mouse IgG Kappa Creign yields CL.
[0099] 1.5 Recombinant Monoclonal Antibody Expression
[0100] The successfully constructed expression vector pcDNA3.1 containing both the light chain (FL) and heavy chain (FH) genes was transiently transfected into 293F cells to obtain a transiently transfected cell line capable of expressing recombinant monoclonal antibodies. The transfected cell line was seeded into 100 mL LCD05 medium (purchased from OPMA, catalog number 81075-001) and cultured on a constant-temperature shaker at 125 rpm / min, 37°C, 95% humidity, and 8% CO2. Six days post-transfection, the cell culture was harvested, centrifuged, and the supernatant was collected for affinity purification with protein A (purchased from Tiandi Renhe, catalog number SA023100) to obtain purified antibody 2B2.
[0101] The purified antibody 2B2 was subjected to SDS-PAGE electrophoresis (reduction and non-reduction electrophoresis), and the results are as follows: Figure 3 As shown, the test results indicate that the purity of the purified antibody is 95%.
[0102] Example 2: Detection of the titer of monoclonal antibody 2B2 against H1 subtype hemagglutinin
[0103] The titer of the 2B2 recombinant monoclonal antibody was determined using an indirect ELISA method. The specific method was the same as the immune serum titer determination method in Example 1, except that in this example, step 3) used antibody instead of serum. The initial working antibody concentration was 1 μg / mL, and it was continuously down-diluted 3-fold using antibody diluent (PBS containing 1% BSA), for a total of 8 gradients, with 100 μL added to each well of the microplate. 100 μL of antibody diluent was added to each well of the NC control.
[0104] Measured value (OD) 450 -OD 630 Plot an antibody titer curve with antibody concentration on the x-axis and antibody concentration on the y-axis; results are shown below. Figure 4 The results showed that monoclonal antibody 2B2 can specifically bind to HA-H1, and even extremely low antibody concentrations are sufficient to effectively recognize the antigen HA-H1 (D18-Q528 R343S). The antibody binds to the EC of H1 subtype hemagglutinin. 50 The value was 0.01377 μg / mL, indicating high antigen recognition specificity and sensitivity.
[0105] Example 3: Sensitivity analysis of monoclonal antibody 2B2 for detecting H1 subtype hemagglutinin
[0106] The sensitivity of the 2B2 recombinant monoclonal antibody to detect the hemagglutinin H1 subtype was determined by indirect ELISA, which included the following steps: 1) Coating HA-H1: Take 1 mg / mL of recombinant HA-H1 (D18-Q528 R343S) protein solution and serially dilute it with carbonate buffer (0.05M, pH 9.6), starting with 1 μg / mL, and perform three-fold dilutions for a total of 8 gradients. 1) After dilution, each gradient was coated at 100 μL / well in a polystyrene 96-well microplate and incubated overnight at 4°C; 2) Blocking: After incubation overnight at 4°C, the plates were washed three times with 300 μL / well of washing buffer (PBS containing 0.05% (v / v) Tween-20), followed by 300 μL / well of blocking buffer (PBS containing 1% BSA, 0.5% gelatin, and 5% sucrose) and incubated at 37°C for 2 hours, then washed three times with washing buffer; 3) Antibody dilution and loading: The monoclonal antibody 2B2 was diluted to 1 μg / mL using antibody dilution buffer, and 100 μL / well of the diluted antibody was added to the blocked 96-well microplate and incubated at 37°C for 1 hour. h; then wash the plate three times with washing buffer; 4) Secondary antibody incubation: add 100 μL / well of horseradish peroxidase-labeled goat anti-mouse IgG (purchased from Jackson Immunoresearch, catalog number 115-035-071) diluted 1:10000 with antibody dilution buffer, incubate at 37℃ for 50 min, then wash the plate three times with washing buffer; 5) Termination of reaction and color development: add 100 μL / well of TMB for color development, incubate at 37℃ in the dark for 10 min, then add 100 μL / well of 0.5 M oxalic acid solution to terminate the reaction, measure the absorbance at 450 nm and 630 nm, using blank antibody dilution buffer as a blank control, and measure the absorbance at 450 nm and 630 nm. 450 -OD 630 The minimum antigen content that monoclonal antibody 2B2 can detect is determined by a ratio of ≥2.1 to the control value.
[0107] Measured value (OD) 450 -OD 630 Plot a sensitivity curve with antigen concentration on the x-axis and antigen concentration on the y-axis; the results are shown in [Figure number missing]. Figure 5As shown in the graph, the antibody 2B2 of this invention, as a detection antibody, can detect hemagglutinin H1 subtypes at the pg level, and has good application prospects in the field of qualitative and quantitative analysis of influenza A H1N1 virus.
[0108] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. An antibody against hemagglutinin of influenza A (H1N1) virus, characterized in that, It includes a light chain variable region and a heavy chain variable region. The amino acid sequence of CDR1 on the light chain variable region is "DHINNW", the amino acid sequence of CDR2 is "GAT", and the amino acid sequence of CDR3 is "QQYWSTPFT". The amino acid sequence of CDR1 on the heavy chain variable region is "GFSLANYG", the amino acid sequence of CDR2 is "VWAAGDT", and the amino acid sequence of CDR3 is "AKTGTRGGYFDV".
2. The antibody against hemagglutinin of influenza A (H1N1) virus according to claim 1, characterized in that, The amino acid sequence of the antibody light chain variable region is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.
6.
3. The antibody against hemagglutinin of influenza A (H1N1) virus according to claim 2, characterized in that, The amino acid sequence of the antibody light chain is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.
5.
4. The antibody against hemagglutinin of influenza A (H1N1) virus according to claim 1, characterized in that, The antibody is a full-length antibody or the antigen-binding region of the full-length antibody; the antigen-binding region is selected from Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv or sc(Fv)2.
5. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes an antibody against hemagglutinin of influenza A (H1N1) virus as described in any one of claims 1-4.
6. The nucleic acid molecule according to claim 5, characterized in that, The nucleic acid sequence of the antibody light chain variable region is as shown in the sequence of bases 1-321 of SEQ ID NO.10 or its complementary sequence, and the nucleic acid sequence of the heavy chain variable region is as shown in the sequence of bases 1-354 of SEQ ID NO.11 or its complementary sequence.
7. The nucleic acid molecule according to claim 6, characterized in that, The nucleic acid sequence of the antibody light chain is shown in SEQ ID NO. 10 or is complementary to it, and the nucleic acid sequence of the heavy chain is shown in SEQ ID NO. 11 or is complementary to it.
8. The use of the antibody against hemagglutinin of influenza A (H1N1) virus as described in any one of claims 1-4 in the preparation of an influenza A (H1N1) virus detection kit.
9. A test kit for detecting H1N1 influenza virus, characterized in that, The test kit includes an antibody against hemagglutinin of influenza A (H1N1) virus as described in any one of claims 1-4.
10. The H1N1 influenza virus detection kit according to claim 9, characterized in that, The detection kit is an enzyme-linked immunosorbent assay (ELISA) kit, which also includes a detection label-modified secondary antibody, wherein the secondary antibody is an anti-mouse IgG antibody and is used to bind to an antibody against hemagglutinin of influenza A H1N1 virus.