Combinations of antigenically distinct viral particles as a universal influenza vaccine strategy
By incorporating wild-type and headless HA proteins or nucleic acids, the compositions induce a hybrid immune response that targets the conserved HA stalk domain, addressing the limitations of traditional vaccines and enhancing protection against diverse influenza strains.
Patent Information
- Application Number
- PCT/US2025/056180
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-11-19
- Filing Date
- 2025-11-19
- Publication Date
- 2026-05-28
AI Technical Summary
Traditional influenza vaccines primarily target the HA head domain, leading to limited protection against antigenically diverse strains due to immune pressure selecting for mutations, necessitating a need for more universal vaccines that elicit broader immune responses.
Compositions comprising wild-type and headless HA proteins or nucleic acids encoding them, which focus on inducing immune responses against the conserved HA stalk domain, enhancing protection against diverse influenza strains.
The combination of wild-type and headless HA proteins elicits a hybrid immune response, providing broad protection against both homosubtypic and heterosubtypic influenza strains, including drifted variants, by directing the immune response to more conserved epitopes.
Smart Images

Figure US2025056180_28052026_PF_FP_ABST
Abstract
Description
[0001] COMBINATIONS OF ANTIGENICALLY DISTINCT VIRAL PARTICLES AS A UNIVERSAL INFLUENZA VACCINE STRATEGY
[0002] CROSS-REFERENCE TO RELATED APPLICATIONS
[0003] This patent application claims the benefit of U.S. Provisional Application No. 63 / 722,500 filed on November 19, 2024, the entire contents of which are incorporated herein by reference.
[0004] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0005] This invention was made with government support under grant number 75N93019C00050 awarded by the National Institute of Allergy & Infectious Diseases (NIH / NIAID). The government has certain rights in this invention.
[0006] SEQUENCE LISTING
[0007] A Sequence Listing accompanies this application and is submitted as an XML file of the sequence listing named “2025-1 l-19_155554.00796_Sequence List. xml” which is 28,309 bytes in size and was created on November 19, 2025. The sequence listing is electronically submitted via Patent Center with the application and is incorporated herein by reference in its entirety.
[0008] BACKGROUND
[0009] For the global community, influenza virus infections pose a perennial and significant threat. Outside of relatively minor seasonal disease, these viruses can cause severe illnesses in humans, resulting in hundreds of thousands of deaths worldwide every year [1, 2], One member of the influenza virus family, influenza A virus (IAV), is responsible for a significant proportion of this disease. IAV comprises eight negative-sense, single-stranded genomic RNAs, encoding at least 11 viral proteins, in an enveloped viral particle that is efficiently transmitted via the respiratory route [3], Hemagglutinin (HA), the most abundant viral surface glycoprotein on the viral particle, is the primary target for protective antibodies and consists of globular head and stalk domains. The globular HA head domain is responsible for sialic acid receptor binding and the HA stalk further facilitates viral and cellular membranes fusion during infection [4], Annual vaccination with the seasonal influenza vaccines represents a crucial public health measure for limiting disease. Most antibodies elicited by the seasonal vaccine target the HA head domain and are thought to function primarily by preventing viral infection via impeding the HA-receptor binding [5-7], These neutralizing antibodies offer robust protection against viral infection [8], However, immune pressure selects for mutations in the globular HA head that permit escape from antibody neutralization [9, 10], Thus, traditional vaccine-induced immunity is mostly limited to the specific strains included in the vaccine formulation, and there is a need for more universal influenza vaccines that are capable of eliciting protection against more antigenically diverse strains.
[0010] SUMMARY
[0011] In a first aspect, the present invention provides compositions comprising or encoding (a) a wild-type hemagglutinin (HA) protein; and (b) a headless HA protein. In a first embodiment, the compositions comprise (a) a first influenza viral particle comprising a wild-type HA protein; and (b) a second influenza viral particle comprising a headless HA protein. The headless HA protein comprises a deletion of at least 275 amino acids comprising at least a portion of a head region of the HA protein, but has at least a transmembrane domain and a cytoplasmic domain of the HA protein, and the headless HA protein maintains the ability to trimerize in the virus particle. In a second embodiment, the compositions comprise (a) a nucleic acid encoding a wildtype HA protein or the reverse complement thereof; and (b) a nucleic acid encoding a headless HA protein or the reverse complement thereof.
[0012] In a second aspect, the present invention provides vaccine formulations comprising a composition described herein and a pharmaceutically acceptable carrier.
[0013] In a third aspect, the present invention provides methods for inducing an immune response in a subject. The methods comprise administering a composition or vaccine formulation described herein to the subject.
[0014] BRIEF DESCRIPTION OF THE DRAWINGS
[0015] FIG. 1 shows the design and generation of a contemporary H1N1 headless HA influenza virus. (A) The design of the headless HI / 19 HA construct. SP, signal peptide. FP, fusion peptide. TM, transmembrane domain. S326T327K328 and N404T405Q406F407T408 were replaced by GSG and GSGGSG linkers, respectively, to increase the relative contribution of the HA stalk to the immunogen surface. K395M, Y438D, N439L, and E447L mutants increased internal stabilization. White font on red / shaded background represents conserved residues; dots represent deletion mutations; boxed red font represents conservative mutants that have similar properties; white font represents nonconservative mutants. The sequences of wild-type (WT) HA protein (SEQ ID NO: 1) and the headless HA protein used in the Examples (SEQ ID NO: 2) are aligned. (B) Recognition of the headless HI / 19 HA construct in HEK-293T via flow cytometry. HEK-293T were transfected with WT HI / 19 HA or the headless HI / 19 HA plasmids, and after 24h, cells were collected and stained with HA stalk-directed mouse antibody 6F12 (1:50 dilution) and human antibody CR9114 (1:500 dilution). (C) Diagram of the approach to generate the headless HI / 19 virus. (D) Flow cytometry of the MDCK cell line stably expressing headless HI / 19 HA. (E) Staining of the cell line stably expressing the headless HI / 19 HA via immunofluorescence microscopy. Scale bar, 100 pm. Blue, nuclei; Green, HA Stalk. (F) HA protein level comparation between WT HI / 19 vaccine and normalized headless HI / 19 vaccine via ELISA. N=4 technical replicates. (G) NA protein level comparison between WT HI / 19 vaccine and normalized headless HI / 19 vaccine via ELISA. N=4 technical replicates. (H) NP protein level comparison between WT HI / 19 vaccine and normalized headless HI / 19 vaccine via ELISA. N=4 technical replicates. All experiments were performed 2 times and similar results were obtained. For all panels, FDR adjusted p-values were performed using Wilcoxon rank-sum exact tests. Data shown as mean ± SEM.
[0016] FIG. 2 shows the immunogenicity and protective efficacy of the headless HA HI / 19 vaccine in mice. (A) The design of the vaccination experiment with the headless HA HI / 19 vaccine. (B-E) Sera from the two groups, including headless HI / 19 and BSA, collected at 21 days post-vaccination, was used to detect antibody responses against whole HI / 19 virus (B), HI / 19 HA head (C), HA / 19 HA stalk (D), and HA / 19 NA (E) via ELISA. N=5 mice. (F) Hemagglutination inhibition assay (HAI) with sera from two groups of mice. HAI titers were calculated as the reciprocal of the last dilution of sera that inhibited hemagglutination. LOD=10. N=5 mice. (G) Microneutralization assay with sera from two groups of mice. Limit of detection (LOD)=1. N=5 mice. (H) Neuraminidase-inhibition (NAI) assay with sera from two groups of mice. NAI titer is calculated as the reciprocal of the lowest dilution of sera that inhibited at least 50% NA activity. N=5 mice. (I) Antibody dependent cellular cytotoxicity (ADCC) assay with sera from two groups of mice. N=5 mice. (J) Body weight of vaccinated mice from two groups was monitored until 14 days post infection. N=5 mice. (K) Survival of vaccinated mice from two groups was monitored until 14 days post infection. N=5 mice. All experiments were performed 2 times and similar results were obtained. For all panels, FDR adjusted p-values were performed using Wilcoxon rank-sum exact tests. *, p<0.05; **, p<0.001; ns, not significant. Data shown as mean ± SEM.
[0017] FIG. 3 shows the immunogenicity and protective efficacy of the headless HA+WT HI / 19 vaccine in mice. (A) Schematic of the vaccination regimen. (B-E) Sera from the three groups, including headless HA+WT HI / 19, headless HI / 19, and BSA, collected at 21 days postvaccination was used to detect antibody responses against whole HI / 19 virus (B), HI / 19 HA head (C), HV19 HA stalk (D), and HI / 19 NA (E) via ELISA. N=5 mice. (F) Hemagglutination inhibition assay (HAI) with sera from three groups. HAI titers were calculated as the reciprocal of the last dilution of sera that inhibited hemagglutination. LOD=10. N=5 mice. (G) Microneutralization assay with sera from three groups. LOD=1. N=5 mice. (H) Neuraminidaseinhibition (NAI) assay with sera from three groups collected at 21 days post-vaccination. NAI titer is calculated as the reciprocal of the lowest dilution of sera that inhibited at least 50% NA activity. N=5 mice. (I) Antibody dependent cellular cytotoxicity (ADCC) assay on virally infected cells with sera from three groups collected at 21 days post-vaccination. N=5 mice. (J) ADCC assay as in (I), but with target cells only expressing the HA protein. (K) Body weight of vaccinated mice from the three vaccines groups was monitored until 14 days post infection. N=5 mice. (L) Survival of vaccinated mice from three groups was monitored until 14 days post infection. N=5 mice. NT, not detected. All experiments were performed 2 times and similar results were obtained. For all panels, FDR adjusted p-values were performed using Wilcoxon rank-sum exact tests. *, p<0.05; **, p<0.001; ns, not significant. Data shown as mean ± SEM.
[0018] FIG. 4 shows the immunogenicity and protective efficacy of headless HA+WT HI / 19 vaccine in mice with pre-existing immunity. (A) Schematic of the vaccine regimen. (B-E) Immune sera was used to detect antibody responses against whole HI / 19 virus (B), HI / 19 HA head (C), HI / 19 HA stalk (D), and HI / 19 NA (E) via ELISA. N=5 mice. (F) Hemagglutination inhibition assay (HAI) with immune sera. HAI titers were calculated as the reciprocal of the last dilution of sera that inhibited hemagglutination. LOD=10. N=5 mice. (G) Microneutralization assay with immune sera. LOD=1. N=5 mice. (H) Neuraminidase-inhibition (NAI) assay with post-boost sera. NAI titer is calculated as the reciprocal of the lowest dilution of sera that inhibited at least 50% NA activity. N=5 mice. (I) Antibody dependent cellular cytotoxicity (ADCC) assay against infected cells with post-vaccination sera. N=5 mice. (J) ADCC assay as in (I), but target cells only express the viral HA protein. (K) Post-boost sera were used to detect antibody responses against whole A / California / 04 / 2009 virus via ELISA. N=5 mice. (L) Body weight of vaccinated mice with pre-existing immunity was monitored until 14 days post infection. N=5 mice. (M) Survival of vaccinated mice with pre-existing immunity was monitored until 14 days post infection. N=5 mice. NT, not detected. All experiments were performed 2 times and similar results were obtained. For all panels, FDR adjusted p-values were performed using Wilcoxon rank-sum exact tests. *, p<0.05; ns, not significant. Data shown as mean ± SEM.
[0019] FIG. 5 shows the immunogenicity and efficacy of the headless HA+WT HI / 19 vaccine in ferrets with pre-existing immunity. (A) Schematic of the vaccine regimen. Ferrets received one dose of WT HI / 19 vaccine or BSA to establish pre-existing immunity. After 28 days, headless HA+WT HI / 19 vaccine, WT HI / 19 vaccine, or BSA was applied as second dose. After another 28 days, ferrets were challenged with A / California / 04 / 2009 virus. All sera were collected 3 days before vaccination or virus challenge. (B-E) Naive sera collected before vaccination, pre-existing immunity sera collected after first dose, and post-vaccination sera were used to detect antibody responses against whole HI / 19 virus (B), HI / 19 HA head (C), HI / 19 HA stalk (D), and HI / 19 NA (E) via ELISA. N=4 ferrets. (F) Hemagglutination inhibition assay (HAI) with post-vaccination sera. HAI titers were calculated as the reciprocal of the last dilution of sera that inhibited hemagglutination. LOD=10. N=4 ferrets. (G) Microneutralization assay with post-vaccination sera. LOD= 1. N=4 ferrets. (H) Neuraminidase-inhibition (NAI) assay with post-vaccination sera. NAI titer is calculated as the reciprocal of the lowest dilution of sera that inhibited at least 50% NA activity. N=4 ferrets. (I) Post-vaccination sera were used to detect antibody responses against whole A / California / 04 / 2009 virus via ELISA. N=4 ferrets. (J) Body weight of vaccinated ferrets with pre-existing immunity was monitored until 14 days post infection. N=4 ferrets. (K) Viral RNA level in nasal swab samples after infection. Nasal swab samples collected at 3 days before infection, 2 days post-infection (DPI), 4 DPI, 7 DPI were analyzed for RT-qPCR. Viral NP gene was detected. (L) Viral plaque forming units were assessed in nasal swab samples after infection. Nasal swab samples collected at 3 days before infection, 2 days post-infection (DPI), 4 DPI, 7 DPI and dilutions plated to assess the amount of live virus at the indicated time points. For all panels, FDR adjusted p-values were performed using Wilcoxon rank-sum exact tests. Data shown as mean ± SEM. FTG. 6 shows sera ELISA results demonstrating mouse sera binding after H3 vaccination. Immune sera were used to detect antibody responses against whole H3 Wyoming virus (A) and WyM03 HA stalk, lacking the head domain (B). WT is the wild-type Wyoming virus and WT + HA is the wild-type Wyoming virus with the headless HA Wyoming viral particle.
[0020] FIG. 7 shows the immunogenicity of the headless HA+WT HI / 19 vaccine in mice with pre-existing immunity and is related to Figure 4. (A-D) A pre-immune / WT group was added to compare with the pre-immune / Headless+WT group. Immune sera were used to detect antibody responses against whole HI / 19 virus (A), HI / 19 HA head (B), HI / 19 HA stalk (C), and HI / 19 NA (D) via ELISA. N=5 mice. All experiments were performed 2 times and similar results were obtained. For all panels, FDR adjusted p-values were performed using Wilcoxon rank-sum exact tests. Data shown as mean ± SEM.
[0021] DETAILED DESCRIPTION
[0022] The present invention provides compositions comprising (a) a combination of influenza viral particles comprising a wild-type hemagglutinin (HA) protein and influenza viral particles comprising a headless HA protein, or (b) a combination of nucleic acid molecules encoding a wild-type HA protein and nucleic acid molecules encoding a headless HA protein. Vaccine formulations comprising these compositions and methods of using these compositions to induce an immune response in a subject are also provided.
[0023] Compositions:
[0024] In a first aspect, the present invention provides compositions comprising or encoding (a) a wild-type hemagglutinin (HA) protein; and (b) a headless HA protein.
[0025] Hemagglutinin (HA) is a glycoprotein found on the surface of influenza viral particles. The HA protein used with the present invention may be from any subtype of influenza virus including, without limitation, Hl through H18. Suitably, the HA protein may be an Hl, H2, H3, H5, of H7 subtype. The HA protein is a homotrimer where each monomer is a single polypeptide chain having an HA1 region and HA2 region. The HA2 region sits on top of the HA1 region, and the HA1 and HA2 regions are linked by disulfide bridges. The HA1 region comprises the “head domain” and the HA2 region comprises the “stalk domain”. Thus, the headless HA proteins described herein lack at least a portion of the HA1 region. The HA head domain binds to cells to mediate viral entry. It is also immunodominant in natural infection and is subject to antigenic drift.
[0026] As used herein, a “wild-type HA protein” is an HA protein that is in its natural, unmodified form. In contrast to the headless HA proteins described herein, a wild-type HA protein has the ability to promote viral entry into a cell. Specifically, a wild-type HA protein can bind to sialic acid-containing receptors on the surface of the cell and promote fusion of the viral membrane with the cell membrane. In the Examples, the inventors utilized the wild-type HA protein of SEQ ID NO: 1, which is from the influenza strain A / Hawaii / 70 / 2019 (HI / 19), and the wild-type HA of Wyoming / 03 (SEQ ID NO: 18) Another exemplary wild-type HA protein sequence is provided as SEQ ID NO: 3, which is from the influenza strain PR8. However, the sequences of other wild-type HA proteins are known in the art and may be used in place of these sequences. The wild-type HA proteins used herein may additionally include the wild-type HA proteins of Louisiana / 12 / 2024 (SEQ ID NO: 13), A / Shanghai / 02 / 2013 (SEQ ID NO: 14), Thailand / 8 / 2022 (SEQ ID NO: 15), A / Victoria / 4897 / 2022 (SEQ ID NO: 16). Furthermore, a wild-type HA protein from an influenza B strain may be used, including the wild-type HA protein of B / Austria / 1359417 / 2021 (SEQ ID NO: 17).
[0027] As used herein, a “headless HA protein” is an HA protein that lacks the globular head domain of HA. In some embodiments, the headless HA protein comprises a deletion of at least 275 amino acids comprising at least a portion of a head region of the HA protein. As shown in figure 1, the deletion of amino acids 50-325 (a 275 amino acid deletion) removed the majority of the head region of HA. Due to the heterogeneity of the HA proteins these exact amino acids altered and deleted to generate headless HA will be slightly different in the different HA proteins, but those of skill in the art with the knowledge of these proteins will be able to generate comparable headless HA derivatives for any HA variant. A second portion of amino acids corresponding to amino acid 410-436 of the wild-type HA was also deleted. There were substitutions of amino acids 326-328 to form a flexible linker region (GSG in Figure 1) which linked the first 49 amino acids to amino acids 329-403 of the wild-type HA and also comprised a mutation at amino acid position 395. This portion was also followed by a 6 amino acid linker (GSGGSG (SEQ ID NO: 19), which replaced the native sequence at amino acid positions 404- 409 with reference to the wild-type HA. The second deletion of amino acids corresponding to 410-436 of the wild-type HA was also deleted and allowed the linker to join the final section from amino acid 437-566 in the headless HA. This last portion of the headless HA contained three point mutations to aid in proper folding and for stability at amino acid positions 438, 439 and 447 relative to wild-type HA. The strategy for generating headless HA for any strain of influenza is discussed in more detail below, but the headless HA can have a deletion of at least 250, 260, 270, 275, 280, 285, 290, 295 or even more than 300 amino acids and the deletion may include two or more deletions within the protein. The HA sequences provided here include a signal peptide to aid in cell membrane or viral particle incorporation of the protein. The signal peptide is generally about 20 amino acids in length and is removed during the maturation and trafficking of the protein for membrane expression. The headless HA protein comprises at least a transmembrane domain and a cytoplasmic domain of the HA protein. The headless HA protein trimerizes when expressed in a membrane, such as in a cell or in the virus particle. Retention of the transmembrane domain and cytoplasmic domain may allow the headless HA to be expressed in a membrane-bound form and allow for proper folding of the stalk and cytoplasmic regions of HA. This membrane anchoring may preserve the native topology of HA and facilitates proper folding, trafficking, and surface presentation of the stalk domain. In contrast to soluble HA constructs lacking the transmembrane and cytoplasmic domains, membrane-bound headless HA proteins may more accurately mimic the structural context of HA on influenza virions, thereby enhancing the accessibility and immunogenicity of conserved stalk epitopes. The transmembrane domain may contribute to structural stability and supports trimerization by anchoring the stalk domain within the lipid bilayer, while the cytoplasmic domain may assist in intracellular transport and incorporation into virions. Accordingly, retention of these regions may improve antigenic fidelity, promote immune recognition, and enable the use of headless HA in virionbased or cell-surface vaccine platforms. Thus, the present disclosure details the generation of headless HA proteins that can be created and applied without being engineered for the purposes of solubility. In some embodiments, the headless HA protein comprises a deletion that removes at least part of the HA domain wherein the structure of the globular head domain is disrupted to the extent that immune responses are not dominated by antibodies that target the head domain. Because the HA head domain is immunodominant, the immune response to the HA protein is skewed in favor of epitopes within this domain. Thus, elimination of the head domain from the HA protein allows for the generation of HA proteins with altered immunogeni cities. For example, elimination of the head domain may generate HA proteins in which epitopes that are typically subdominant (i.e., epitopes that are not targeted or targeted to a lower degree during an immune response), such as the HA stalk domain, become immunodominant. The HA head domain is not highly conserved and is susceptible to antigenic drift. Thus, the use of headless HA proteins allows the immune response to be directed to more highly conserved epitopes.
[0028] As further used herein, a “headless HA protein” may refer to any HA protein in which the globular head domain is at least partially is deleted, and in which the remaining stalk domain is engineered to preserve trimeric structure and antigenicity. Native HA proteins typically exist as homotrimers. Proper folding, stability, and trimerization of HA, in this case the HA stalk, are important for antibody binding and the generation of immune protection against influenza viruses. In the absence of the head domain, trimerization may be preserved through the use of engineered linkers, trimerization domains, internal stabilizing mutations, fusion to multimerization scaffolds, or mutations within the HA2 region. For example, short glycine-rich linkers may be used to replace the deleted head region and maintain polypeptide continuity. In some embodiments, the linker may comprise a linker including Glycine and Serine residues and may be from three to ten amino acids in length, e.g., GGGGS (SEQ ID NO: 20). Stabilizing, internal mutations within the HA2 region have been shown to reduce splaying and enhance stalk folding and trimerization (Yassine et al., 2015; Zhu et al., 2025). As used herein, internal, stabilizing mutations refer to mutations that may promote stability, proper protein folding, and trimerization by increasing the stability of the inner core of the HA stalk. In some embodiments, any mutation that increases stability of the inner core of the HA stalk may be utilized. In some embodiments, the mutations comprise a Lysine to Methionine (L to M), a Tyrosine to Aspartic Acid (Y to D), Asparagine to Leucine (N to L), and Glutamic acid to Leucine (E to L) mutation as shown in Figure 1. In other embodiments, the mutations comprise K395M, Y438D, N439L, and E447L in A / Hawaii / 70 / 2019 (HI / 19) (Zhu et al., 2025). Replacing the positively charged, flexible lysine residue with methionine may reduce electrostatic interactions and promote tighter hydrophobic packing. Replacing a bulky tyrosine residue with aspartic acid may reduce steric hinderance. Replacing asparagine and glutamic acid with hydrophobic leucine may stabilize the core by promoting core packing and reducing unwanted flexibility. An internal salt bridge in the HA2 region may be replaced by a methionine-leucine hydrophobic pair, which may stabilize the trimeric structure of the stalk domain by providing a more isosteric and rigid core. Salt bridges can contribute to protein stability, but they can also introduce flexibility or conformational strain, especially in engineered proteins where native interactions are disrupted. Modifying the headless HA protein to be more stable may decrease fraying and increase immunogenicity.
[0029] Trimerization domains such as the T4 foldon or HIV-1 gp41 may be incorporated to promote and stabilize trimer formation. Additionally, fusion of the headless HA to nanoparticle scaffolds such as ferritin may further stabilize the trimeric conformation and may enhance immunogenicity. These design strategies may allow for the preservation of key stem epitopes, elicitation of broadly protective immune responses, and expression in various expression platforms. Accordingly, headless HA proteins may encompass a range of sequence variations in which the head domain is removed or replaced and the stalk domain is structurally optimized to maintain stabilization, trimerizations and antigenic integrity.
[0030] Examples of suitable headless HA proteins include those disclosed as SEQ ID NOs: 2 and 4-12. In SEQ ID NO: 5, referred to herein as “4G headless HA,” the HA1 sequence between residues Cys52 and Cys277 is replaced with a -GGGG- linker. In SEQ ID NOs: 6 and 7, referred to herein as mini headless HA and GCN4 headless HA, respectively, a majority of the HA1 sequence is replaced with a -GGGG- linker and a disulfide bond is introduced to stabilize the HA2 trimers. Mini headless HA does not include the trimerization motif (GCN4), whereas GCN4 headless HA does. In SEQ ID NO: 4, referred to herein as 6SS headless HA, the HA1 sequence is replaced with a -GSG- linker and a loop on the stalk is replaced with a -GSGGSG- (SEQ ID NO: 19) linker. Of these four headless HA designs, 6SS is the only headless HA that is thought to fold correctly based on the ability of the stalk-specific antibody 6F12 to bind to it. The headless HA proteins of SEQ ID NO: 4-7 are derived from the HA protein from the influenza strain PR8, whereas the headless HA protein that was utilized in the Examples (i.e., SEQ ID NO: 2) is derived from the influenza strain A / Hawaii / 70 / 2019 (HI / 19). The headless HA protein utilized in Example 2 (SEQ ID NO: 8) is a headless HA derived from the influenza strain Wyoming / 03 (H3). Thus, the present compositions and methods may provide protection against influenza strains of various HA types. Other suitable headless HA proteins disclosed herein include the H5 Louisana / 12 / 2024 (SEQ ID NO: 9), the H3 Thailand / 8 / 2022 (SEQ ID: NO 10), the Hl A / Victoria / 4897 / 2022 (SEQ ID NO: 11), and the H7 A / Shanghai / 02 / 2013 (SEQ ID NO: 12). Thus, in some embodiments, the headless HA protein is that of SEQ ID NO: 2. In some embodiments, the headless HA protein is SEQ ID NO: 8. In other embodiments, the headless HA protein is a polypeptide having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to at least one of SEQ ID NOs: 2, 4-12. However, those of skill in the art can design other headless HA proteins for use with the present invention, and these headless HA proteins may be derived from any wild-type HA protein known in the art. Examples of other headless HA proteins can be found in Luo et al. (Sci Transl Med 16(745):eadj468, 2024) and Hamele et al. (J Virol 98(10):e0116624, 2024), which are each hereby incorporated by reference in their entireties.
[0031] In a first embodiment, the compositions comprise (a) a first influenza viral particle comprising a wild-type HA protein; and (b) a second influenza viral particle comprising a headless HA protein. The first influenza virus particle comprising the wild-type HA is inactivated. Means of inactivating the virus are discussed in more detail below and are known in the art.
[0032] The influenza virus is a negative-sense, single-stranded RNA virus. Influenza viruses can be divided into four distinct types (influenza A, influenza B, influenza C, and influenza D) based on their nucleoproteins and the antigen determinants of their matrix proteins. Human influenza A and B viruses are responsible for the seasonal flu. Thus, the viral particles used with the present invention may be derived from either influenza A or influenza B. Influenza A viruses are categorized into subtypes based on the hemagglutinin and neuraminidase proteins expressed on the virus's surface. There are 18 different subtypes of hemagglutinin, which are referred to as Hl -Hl 8, and 11 different subtypes of neuraminidase, which are referred to as Nl-Nl 1. In the Examples, the inventors tested influenza viral particles of the H1N1 strain A / Hawaii / 70 / 2019 (HE19). Thus, in some embodiments, the influenza viral particles are derived from an H1N1 strain and, in specific embodiments, the H1N1 strain is A / Hawaii / 70 / 2019 (HI / 19).
[0033] The term “viral particle” is used herein to refer to the extracellular phase of a virus. An influenza viral particle consists of a nucleic acid core (i.e., the viral genome), an outer protein coating or capsid, and an outer envelope made of protein and phospholipid membrane derived from the host cell that produced the viral particle. The genome of influenza A and influenza B viruses are segmented into eight separate strands. In some embodiments, the viral particle is generated by engineering a Madin-Darby Canine Kidney (MDCK) cell line to stably express a headless HA protein derived from a wild-type HA protein. The genetic engineering of MDCK cell lines may be achieved by any method apparent to one with skill in the art, including a lentiviral vector system, which may be used to introduce a nucleic acid encoding a headless HA protein. Following successful expression of the headless HA protein in MDCK cells, influenza virus particles lacking the HA gene may be propagated in these engineered cells. The absence of the native HA gene in the viral genome prevents production of full-length HA, while the presence of the headless HA protein on the MDCK cell surface enables incorporation into budding virions. This strategy results in virus particles displaying headless HA antigens without generating infectious viral particles capable of normal replication. One way to generate the viral particles is detailed in Example 1, FIG. 1C.
[0034] In a second embodiment, the compositions comprise (a) a nucleic acid encoding a wildtype HA protein or the reverse complement thereof; and (b) a nucleic acid encoding a headless HA protein or the reverse complement thereof.
[0035] The present disclosure encompasses the use of various nucleic acid molecules, including but not limited to messenger RNA (mRNA), negative-sense RNA, complementary DNA (cDNA), plasmid DNA, and synthetic nucleic acid analogs, for encoding influenza viral particles. DNA or negative-sense RNA may be used to transcribe mRNA, and synthetic analogs may offer enhanced stability or delivery characteristics. The nucleic acid may be single-stranded or double-stranded, linear or circular, and may be chemically modified to improve expression, stability, or immunogenicity. mRNA represents the coding strand of a gene and may be directly translated by ribosomes into protein. As used herein, mRNA may be referred to as positive-sense RNA. A “reverse complement” of an RNA is an RNA that is complementary to an mRNA and read in the opposite direction. As used herein, the term “complementary” refers to the ability of a nucleic acid molecule to bind to (i.e., hybridize with) another nucleic acid molecule through the formation of hydrogen bonds between specific nucleotides (i.e., A with T or U and G with C), forming a double-stranded molecule. In the context of influenza virus, which has a negativesense single- stranded RNA genome, the viral genome itself is the reverse complement of the mRNA that encodes viral proteins. Therefore, inclusion of the reverse complement sequence allows for the generation of mRNA via reverse transcription, either in vitro or within a host cell, enabling antigen expression without the need to introduce the full viral genome.
[0036] A viral segment comprises more than just the reverse complement of an mRNA sequence. Influenza viruses possess a segmented genome, and each segment includes not only a coding sequence (in reverse complement form) but also essential non-coding regions. These regions typically contain conserved 5' and 3' untranslated regions (UTRs) that serve as critical packaging signals and regulatory elements for transcription and replication. Additionally, viral segments may include structural motifs necessary for encapsidation and interaction with viral or host proteins, such as the viral RNA-dependent RNA polymerase complex. These elements collectively enable the segment to be recognized, transcribed, and packaged efficiently, mimicking aspects of native viral replication. In the context of the disclosed vaccine technology, inclusion of such elements allows for effective expression of antigenic proteins without the need to reconstitute a complete infectious virus. Such elements may be encoded by nucleic acids in the viral particle and may be expressed in cell lines used to propagate the viral particles without inclusion in a final viral particle. Delivery vehicles, such as lipid nanoparticles or engineered viral-like particles, may be designed to incorporate these segments along with necessary polymerase components, thereby facilitating in vivo transcription and antigen presentation while maintaining safety.
[0037] In these embodiments, the compositions may further comprise a nanoparticle. A “nanoparticle” is an ultrafine particle that is 1-100 nm in diameter. In some embodiments, the nanoparticle is a “lipid nanoparticle,” i.e., a nanoparticle made of lipids. Lipid nanoparticles are commonly used to deliver drugs and other substances to target cells.
[0038] Further, in these embodiments, the first nucleic acid (i.e., the nucleic acid encoding the wild-type HA protein) may further encode a neuraminidase (NA) protein. “Neuraminidase” is a protein on the surface of influenza viruses that helps the virus spread and replicate. The NA protein used with the present invention may be of any subtype including, without limitation, N1 through N11. Neuraminidase (NA) is the second most abundant glycoprotein on the surface of virions and can evolve independently of HA, suggesting that anti -neuraminidase immunity may afford protection even when the HA protein is highly drifted.
[0039] In some embodiments, the virus or viral particle is inactivated. As used herein, the term “inactivated virus” refers to a virus that has been rendered non-infectious while retaining structural integrity and antigenicity sufficient to elicit an immune response. Inactivation is a critical step in the preparation of influenza vaccines, as it ensures safety by preventing replication, while preserving immunogenic epitopes such as hemagglutinin (HA) and neuraminidase (NA). Influenza virus particles may be inactivated using chemical, physical, or combined approaches known in the art. Chemical inactivation methods include treatment with formaldehyde (formalin), 0-propiolactone (BPL), or detergents such as Triton X-100 or sodium deoxycholate. Physical methods may involve heat treatment or ultraviolet (UV) irradiation. These processes disrupt viral replication machinery without significantly altering surface antigens.
[0040] In certain embodiments, the influenza viral particles are inactivated by treatment with formalin. For example, concentrated virus preparations may be treated with 0.02% formalin for 48 hours at 4 °C, then dialyzed using Slide-A-Lyzer cassettes (Thermo Fisher, #66370). This approach preserves HA and NA antigenicity while eliminating infectivity. Following inactivation, the viral protein content may be quantified using a bicinchoninic acid (BCA) assay, such as the Pierce Rapid Gold BCA Protein Assay Kit (Thermo Fisher, #A53226), to standardize vaccine formulation. The choice of inactivation method may depend on the desired vaccine format, regulatory requirements, and manufacturing considerations.
[0041] The terms “protein”, “polypeptide”, and “peptide” are used interchangeably herein to refer to a polymer of amino acids. A “protein” typically comprises a polymer of naturally occurring amino acids (e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine).
[0042] Vaccine Formulations:
[0043] In a second aspect, the present invention provides vaccine formulations comprising a composition described herein and a pharmaceutically acceptable carrier.
[0044] Pharmaceutically acceptable carriers are known in the art and include, but are not limited to, diluents (e.g., Tris-HCl, acetate, phosphate), preservatives (e.g., Thimerosal, benzyl alcohol, parabens), solubilizing agents (e.g., glycerol, polyethylene glycerol), emulsifiers, liposomes, and nanoparticles. Pharmaceutically acceptable carriers may be aqueous or non-aqueous solutions, suspensions, or emulsions. Examples of nonaqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include isotonic solutions, alcoholic / aqueous solutions, emulsions, or suspensions, including saline and buffered media.
[0045] The vaccine formulations of the present invention may further include additives such as albumin or gelatin to prevent absorption to surfaces, detergents (e g., Tween 20, Tween 80, Pluronic F68, bile acid salts), antioxidants (e.g., ascorbic acid, sodium metabisulfite), bulking substances or tonicity modifiers (e.g., lactose, mannitol). Components of the compositions may be covalently attached to polymers (e.g., polyethylene glycol), complexed with metal ions, or incorporated into or onto particulate preparations of polymeric compounds (e.g., polylactic acid, polyglycolic acid, hydrogels, etc.) or onto liposomes, microemulsions, micelles, milamellar or multilamellar vesicles, erythrocyte ghosts, or spheroplasts. The compositions may also be formulated in lipophilic depots (e.g., fatty acids, waxes, oils) for controlled or sustained release.
[0046] The vaccine formulations may also include adjuvants to increase their immunogenicity. Suitable adjuvants include, without limitation, mineral salt adjuvants, gel-based adjuvants, carbohydrate adjuvants, cytokines, or other immunostimulatory molecules. Exemplary mineral salt adjuvants include aluminum adjuvants, salts of calcium (e.g., calcium phosphate), iron, and zirconium. Exemplary gel-based adjuvants include aluminum gel-based adjuvants and acemannan. Exemplary carbohydrate adjuvants include inulin-derived adjuvants (e.g., gamma inulin, algammulin) and polysaccharides based on glucose and mannose (e.g., glucans, dextrans, lentinans, glucomannans, galactomannans). Exemplary cytokines include IFN-y, granulocytemacrophage colony stimulating factor (GM-CSF), IL-2, and IL-12. Suitable adjuvants also include any FDA-approved adjuvants for influenza vaccine usage including, without limitation, aluminum salt (alum) and the squalene oil-in-water emulsion systems MF59 (Wadman 2005 (Novartis)) and AS03 (GlaxoSmithKline).
[0047] In some embodiments, the vaccine formulations include a concentration of viral particles of at least 106pfu / mL, at least 107pfu / mL, at least 108pfu / mL, at least 109pfu / mL, at least IO10pfu / mL, or at least 1011pfu / mL.
[0048] Methods:
[0049] In a third aspect, the present invention provides methods for inducing an immune response in a subject. The methods comprise administering a composition or vaccine formulation described herein to the subject.
[0050] An “immune response” is the reaction of the body to the presence of a foreign substance (i.e., an antigen). The immune response induced by the present methods may comprise a humoral immune response, a cell-mediated immune response, or both a humoral and cell-mediated immune response. The immune response of a subject to a vaccine may be evaluated indirectly, e.g., through measurement of antibody titers or lymphocyte proliferation assays, or directly, e.g., by monitoring signs and symptoms after challenge with the corresponding pathogen. The protective immunity conferred by the present methods may be evaluated by measuring a reduction in clinical signs, e.g., the mortality, morbidity, temperature, physical condition, or overall health of the subject.
[0051] In the Examples, the inventors demonstrate that their combination vaccines induce a broad “hybrid” immune response directed against the HA-head, HA-stalk, and NA proteins in both naive and pre-immune mice and ferrets responding to both Hl and H3 HA types. Thus, in some embodiments, the methods generate a protective immune response against HA-head (i.e., the head portion of an HA protein), HA-stalk (i.e., the stalk portion of an HA protein), and neuraminidase (NA). The generation of this hybrid immune response provides an advantage over traditional HA-containing vaccine technologies because the immune response generally focuses on the globular head domain. Thus, a more comprehensive immune response can be achieved by utilizing both a wild-type HA and a headless HA as described above.
[0052] The inventors also demonstrate that their combination vaccines provide protection against a heterologous influenza virus. Thus, in some embodiments, the immune response induced by the method provides protection against a heterologous virus. As used herein, the term “heterologous virus” refers to a virus that is not identical to a reference virus, including both drifted homosubtypic or heterosubtypic viruses. For example, a heterologous influenza virus may differ from the reference strain in its hemagglutinin (HA) or neuraminidase (NA) subtype (heterosubtypic) or may represent a drifted variant within the same subtype (homosubtypic drift variant). Protection against such heterologous strains indicates that the immune response elicited by the vaccine is not limited to a single matched strain, but rather encompasses broader antigenic diversity. This breadth of protection may be particularly advantageous in the context of influenza, where antigenic drift and shift frequently lead to the emergence of novel strains that may not be effectively targeted by strain-specific vaccines. Thus, the disclosed compositions and methods may enhance the robustness and durability of protection.
[0053] In preferred embodiments, the methods comprise administering a therapeutically effective amount of a composition or vaccine formulation described to the subject. As used herein, the term “therapeutically effective amount” refers to an amount of a composition or vaccine formulation that is sufficient to induce an immune response in a subject receiving the composition or vaccine formulation. In some embodiments, the methods prevent or reduce the symptoms of influenza in the subject. The symptoms of influenza are well-known in the art and include, without limitation, headaches, chest discomfort, cough, sore throat, fever, aches, chills, fatigue, weakness, sneezing, and stuffy nose.
[0054] As used herein, the terms “administering” and “administration” refer to any method of providing a pharmaceutical preparation to a subject. Suitable routes of administration include, without limitation, intramuscular, intradermal, intranasal, oral, topical, parenteral, intravenous, subcutaneous, intrathecal, transcutaneous, nasopharyngeal, and transmucosal routes. In some embodiments, the composition is administered intramuscularly. The compositions can be administered as a single dose or in multiple doses. For example, the compositions may be administered two or more times separated by 4 hours, 6 hours, 8 hours, 12 hours, a day, two days, three days, four days, one week, two weeks, or by three or more weeks.
[0055] The “subject” to which the present methods are applied may any vertebrate. Suitable vertebrates include, but are not limited to, humans, cows, horses, sheep, pigs, goats, rabbits, dogs, cats, bats, mice, and rats. In certain embodiments, the methods may be performed on lab animals (e.g., mice and rats) for research purposes. In other embodiments, the methods are used to treat commercially important farm animals (e.g., cows, horses, pigs, rabbits, goats, sheep, and chickens) or companion animals (e.g., cats and dogs). In preferred embodiments, the subject is a human.
[0056] The present disclosure is not limited to the specific details of construction, arrangement of components, or method steps set forth herein. The compositions and methods disclosed herein are capable of being made, practiced, used, carried out and / or formed in various ways that will be apparent to one of skill in the art in light of the disclosure that follows. The phraseology and terminology used herein is for the purpose of description only and should not be regarded as limiting to the scope of the claims. Ordinal indicators, such as first, second, and third, as used in the description and the claims to refer to various structures or method steps, are not meant to be construed to indicate any specific structures or steps, or any particular order or configuration to such structures or steps. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples or exemplary language (e.g., “such as”) provided herein, is intended merely to facilitate the disclosure and does not imply any limitation on the scope of the disclosure unless otherwise claimed. No language in the specification, and no structures shown in the drawings, should be construed as indicating that any non-claimed element is essential to the practice of the disclosed subject matter. The use herein of the terms “including,” “comprising,” or “having,” and variations thereof, is meant to encompass the elements listed thereafter and equivalents thereof, as well as additional elements. Embodiments recited as “including,” “comprising,” or “having” certain elements are also contemplated as “consisting essentially of’ and “consisting of’ those certain elements.
[0057] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if a concentration range is stated as 1% to 50%, it is intended that values such as 2% to 40%, 10% to 30%, or 1% to 3%, etc., are expressly enumerated in this specification. These are only examples of what is specifically intended, and all possible combinations of numerical values between and including the lowest value and the highest value enumerated are to be considered to be expressly stated in this disclosure. Use of the word “about” to describe a particular recited amount or range of amounts is meant to indicate that values very near to the recited amount are included in that amount, such as values that could or naturally would be accounted for due to manufacturing tolerances, instrument and human error in forming measurements, and the like. All percentages referring to amounts are by weight unless indicated otherwise.
[0058] No admission is made that any reference, including any non-patent or patent document cited in this specification, constitutes prior art. In particular, it will be understood that, unless otherwise stated, reference to any document herein does not constitute an admission that any of these documents forms part of the common general knowledge in the art in the United States or in any other country. Any discussion of the references states what their authors assert, and the applicant reserves the right to challenge the accuracy and pertinence of any of the documents cited herein. All references cited herein are fully incorporated by reference unless explicitly indicated otherwise. The present disclosure shall control in the event there are any disparities between any definitions and / or descriptions found in the cited references.
[0059] The following examples are meant only to be illustrative and are not meant as limitations on the scope of the invention or of the appended claims. EXAMPLES
[0060] One approach for developing a more universal influenza vaccine is to elicit strong responses against canonically immunosubdominant epitopes in the surface exposed viral glycoproteins. While standard vaccines typically induce strong responses primarily against mutable epitopes in the hemagglutinin (HA) head domain, there are generally limited or variable responses directed against epitopes in the relatively more conserved HA stalk domain or neuraminidase (NA) proteins. Here we describe a vaccine approach that utilizes a combination of wildtype (WT) influenza virus particles along with virus particles engineered to display a trimerized HA stalk in place of the full-length HA protein to elicit both responses simultaneously. After initially generating the “headless” HA-containing viral particles in the A / Hawaii / 70 / 2019 (HI / 19) genetic background and demonstrating the ability to elicit protective immune responses directed against the HA-stalk and NA, we co-formulated those virions with unmodified WT viral particles. The combination vaccine elicited “hybrid” and protective responses directed against the HA-head, HA-stalk, and NA proteins in both naive and pre- immune mice and ferrets. Collectively, our results highlight a potentially generalizable method combining viral particles with differential antigenic compositions to elicit broader responses that may lead to more durable protection from influenza disease post-vaccination.
[0061] Improving the protection afforded by influenza vaccines is of high importance for human health. In this study we produced influenza viral particles that lack the classical immunodominant epitopes typically present in the head domain of the hemagglutinin protein. Vaccination with these modified virions allowed strong immune responses to develop against other protective viral epitopes outside of the hemagglutinin head domain. We also showed that co-formulation of our engineered viral particles with unmodified virions allowed a “hybrid” vaccine response against all major viral epitopes of interest; this vaccine regimen also allowed better control of infection in a ferret model of viral challenge. These data together suggest this approach has potential to serve as an improved next-generation, influenza virus vaccine.
[0062] For the global community, influenza virus infections pose a perennial and significant threat. Outside of relatively minor seasonal disease, these viruses can cause severe illnesses in humans, resulting in hundreds of thousands of deaths worldwide every year [1, 2], One member of the influenza virus family, influenza A virus (IAV), is responsible for a significant proportion of this disease. IAV comprises eight negative-sense, single-stranded genomic RNAs, encoding at least 11 viral proteins, in an enveloped viral particle that is efficiently transmitted via the respiratory route [3], Hemagglutinin (HA), the most abundant viral surface glycoprotein on the viral particle, is the primary target for protective antibodies and consists of globular head and stalk domains. The globular HA head domain is responsible for sialic acid receptor binding and the HA stalk further facilitates viral and cellular membranes fusion during infection [4], Annual vaccination with the seasonal influenza vaccines represents a crucial public health measure for limiting disease. Most antibodies elicited by the seasonal vaccine target the HA head domain and are thought to function primarily by preventing viral infection via impeding the HA-receptor binding [5-7], These neutralizing antibodies offer robust protection against viral infection [8], However, immune pressure selects for mutations in the globular HA head that permit escape from antibody neutralization [9, 10], Thus, traditional vaccine-induced immunity is mostly limited to the specific strains included in the vaccine formulation.
[0063] Given this limitation, there is much interest in developing more universal influenza vaccines capable of eliciting protection against more antigenically diverse strains. Other viral glycoprotein domains that could theoretically be targeted to achieve this goal include the HA stalk domain. Structurally positioned just below the HA head domain, the HA stalk domain is generally more conserved from strain to strain, likely due to stringent structural constraints and generally reduced immune pressure [11, 12], Although stalk-directed antibodies are limited in their ability to directly neutralize virions, some studies demonstrated the monoclonal antibodies targeting specific epitopes in HA stalk showing broadly neutralizing activity [13, 14], In addition, recognition of the HA stalk can elicit potent antibody-dependent cellular cytotoxicity (ADCC) and confer protection during viral infection [15, 16], The magnitude of HA stalk- directed antibody responses induced by traditional vaccines is typically low, however, and the optimal approach for raising these antibodies remains an open question. Numerous experimental approaches have been previously reported, such as rationally designed peptides, recombinant HA stalk proteins, self-assembling nanoparticles, chimeric HAs, virus-like particles, and glycosylated HA [17-30], In addition to the HA stalk, the neuraminidase (NA) protein, the second most abundant glycoprotein, is another attractive antigen for generating more protective / durable immune responses. Studies have demonstrated that NA-directed antibody responses provide good protection efficacy in animal models [31-36], and NA is also generally more conserved than the HA head domain. Outside of selecting the antigens / epitopes of interest that will serve as the basis for more universal protection from influenza disease, the modality of their production and delivery also remains an open question. As influenza viral particles harbor the full complement of viral structural proteins and are immunogenic without additional adjuvating compounds, nextgeneration vaccine strategies centered on influenza virus particles have garnered some interest. Previous studies have reported fully replication-competent influenza viruses presenting chimeric or mutant HAs to induce conserved, stalk-directed antibodies [37-42], typically after a prime / boost regimen. Additionally, our laboratory has designed influenza virus particles based on a laboratory-adapted strain A / Puerto Rico / 8 / 34 (PR8) strain that either completely lack an HA protein
[0043] or harbor a trimerized, headless HA stalk antigen to elicit immune responses primarily against the NA or NA and HA-stalk, respectively (Hamele et al., in review). Absent the normally immunodominant HA head domain, these virus particle-based vaccines have been found to be effective at eliciting immune responses to non-head protective epitopes
[0043] ,
[0064] While our previous work has shown that vaccination with a headless HA-containing viral particle can elicit strong stalk-directed responses and provide protection from disease, the “bestcase” scenario would be for a vaccine to simultaneously elicit HA-head directed responses as well. Furthermore, all of our previous work has been done in a laboratory adapted strain, preventing an understanding of the potential adaptability of this approach to other, clinically relevant, viral strains. To address these two major concerns, we designed an HA stalk protein derived from a contemporary H1N1 virus strain, A / Hawaii / 70 / 2019 (HI / 19) and incorporated it onto the surface of an authentic HI / 19 virus particle. Following vaccination with the headless HA particle vaccine, we again observed that high-magnitude and protective HA stalk and NA- directed antibody responses were elicited. We next co-formulated this headless HA viral particle with an unmodified WT HI / 19 viral particle to produce a combination vaccine with multiple HA protein configurations. Vaccination of mice and ferrets with the combination vaccine elicited high, and functionally protective, levels of HA stalk-directed and HA-head antibodies, as well as NA antibodies. Importantly, we found that these vaccine responses could be elicited in both naive and pre-immune animals. Thus, combinations of engineered viral particles do not appear to compete when co-administered and could potentially be used to elicit the specific types of immune responses predicted to provide more protection from influenza disease, regardless of influenza infection history. Results:
[0065] Generation of an HI / 19 based, headless HA viral particle vaccine
[0066] To develop our vaccine, we initially designed a headless HA antigen in the background of the contemporary Hl HA derived from the H1N1 strain A / Hawaii / 70 / 2019. Based on previous research
[0022] , the HA1 region and the membrane distal HA1 and HA2 regions in HI / 19 HA were deleted or truncated. Next, we introduced a glycine-rich linker and internal mutations to enhance stalk folding and stabilization (Fig 1A). To assess antigenicity, the plasmid encoding the headless HI / 19 HA was transfected into HEK-293T cells and the ability of the modified protein to be bound by well characterized monoclonal antibodies [13, 44] was evaluated using flow cytometry. Compared to wildtype (WT) HI / 19 HA, the headless HI / 19 HA protein exhibited similar affinity to HA stalk-directed mouse antibody 6F12 and human antibody CR9114, suggesting correct expression and folding in mammalian cells (Fig IB).
[0067] To produce headless HA antigen containing virus particles (Fig 1C), we first needed to generate an MDCK cell line stably expressing the headless HI / 19 HA protein. A lentivirus-based approach was used to introduce the gene, and expression of the HI / 19 protein was confirmed via flow cytometry and immunofluorescence assay (Fig ID and E). Next, we modified the reverse genetics system for WT HI / 19 so that the HA coding region in segment four of the viral genome was replaced with a GGGGS (SEQ ID NO: 20) linker. This HA deletion virus was then rescued in HEK-293T cells by introducing the eight vRNA encoding plasmids along with an HA protein expression plasmid; this “first-round” virus was then propagated on a previously established HA (PR8) MDCK cell line
[0043] , To produce the headless HA HI / 19 viral particles themselves, the HA deletion virus was used to infect the headless HA MDCK cell line at a high MOI and the progeny virions were collected from the supernatant. Viral particles were then purified from the supernatant by ultracentrifugation and inactivated. Because the WT HI / 19 virus was replication competent, we simply infected unmodified MDCK cells to collect viral particles and inactivated them as the wild-type (WT) viral particles. After normalizing vaccines based on HA-stalk antibody binding in an ELISA assay, we measured the NA and nucleoprotein (NP) content. While NA levels were indistinguishable between the two viruses, NP levels were higher in the WT virus suggesting the glycoprotein density on the headless HA viral particles was lower than WT virions (Fig 1F-H).
[0068] The headless HA HI / 19 vaccine is immunogenic and provides protection from challenge in naive mice
[0069] To understand the immunogenicity of the headless HA viral particles, naive mice were vaccinated with a single dose of the headless HI / 19 vaccine or the control protein BSA (Fig 2A). We first measured reactivity to the whole, WT HI / 19 viral particles and observed a strong response uniquely in the viral vaccine group (Fig 2B). To better understand the composition of that response, we next performed ELIS As with purified HI / 19 HA head, HA stalk, and NA proteins. As expected, no measurable response against the HI / 19 HA head domain was detected (Fig 2C). We did detect however, a response that was significantly above background for both the HA stalk and NA protein (Fig 2D and E).
[0070] To assess the functionality of the viral glycoprotein-reactive antibodies, we first measured hemagglutinin inhibition (HAI) and microneutralization, as these are the standard assays used to benchmark a protective immune response. Unsurprisingly, because these activities are mediated predominantly by HA head-reactive antibodies, we did not detect any signal above background (Fig 2F and G). A NA inhibition (NAI) assay demonstrated activity in headless HA HI / 19 post-vaccination sera as expected due to the presence of NA on the viral particles (Fig 2H). Finally, we tested for antibody-dependent cellular cytotoxicity (ADCC) activity, as this is a known activity of HA stalk-directed antibodies [15, 16] and found that sera from the headless HI / 19 group showed significant ADCC activity (Fig 21). Thus, at least some of the sera antibodies that can bind the viral glycoproteins have functional activity. To understand if the types of immune responses elicited by the headless HA viral vaccine could protect from a lethal challenge, vaccinated animals were challenged with the homologous HI / 19 strain. Despite no measurable head-directed antibodies, we observed complete protection from body weight loss and mortality in headless HI / 19 group, while all mice in BSA group succumbed to infection (Fig 2J and K)
[0071] Combination of headless HA and WT HI / 19 vaccines elicit hybrid responses
[0072] Although the headless HA HI / 19 vaccine had demonstrated protective efficacy, we next wanted to understand if we could devise a vaccine formulation that would also elicit a HA-head directed response without compromising the HA-stalk and NA directed responses we previously observed. Previous work has shown that, at least with purified protein antigens, physical attachment of the head and stalk domain are required for the immunodominance phenomenon
[0045] , We therefore hypothesized that if we were to co-formulate WT viral particles with our headless HA viral particles, we could potentially elicit a hybrid response wherein strong responses to the HA stalk, HA head, and NA proteins would be raised post-vaccination.
[0073] As a first test of this hypothesis, we mixed the headless HA viral particles and WT viral particles 1 : 1 (based on HA content), and vaccinated mice with either the combination headless HA+WT HI / 19 vaccine, headless HI / 19 vaccine alone, or control BSA protein (Fig 3A). ELIS As using post-vaccination sera revealed that levels of antibodies reactive against whole HI / 19 virus were significantly increased in headless HA+WT HI / 19 group compared to the headless HI / 19 group (Fig 3B). Subsequent ELISAs against individual proteins / domains of the glycoproteins revealed that compared to headless HE19 group, the headless HA+WT HI / 19 group displayed similar levels of HA stalk and NA-directed antibodies while adding an HA head directed response (Fig 3C-E). Functional antibody assays demonstrated that HAI and viral neutralization activity were uniquely detectable in the combination headless HA+WT HI / 19 vaccine group (Fig 3F and G), while sera ADCC and NAI levels in the headless HA+WT HI / 19 group were similar to those found in the headless HI / 19-only group (Fig 3H and I). To ensure that HA-stalk binding antibodies were mediating at least some of the observed ADCC, we repeated the assay with target cells that only express the HA protein and observed similar results (Fig 3J). To assess the protection afforded by these vaccines, the vaccinated mice were challenged with the homologous vaccine strain (HI / 19), using a higher dose than used in the previous experiments. While mice in the headless HA+WT HI / 19 and headless HI / 19 groups both survived, mice in headless HI / 19 group experienced significant body weight loss (Fig 3K and L). These results indicate that the headless HA+WT HI / 19 vaccine can elicit “hybrid” HA head, stalk, and NA-directed responses that provide improved protection from high-dose challenge.
[0074] Headless HA+WT HI / 19 vaccine enhances antibody responses against conserved viral epitopes in mice with pre-existing immunity
[0075] Given that most humans over the age of one have pre-existing immunity to influenza virus elicited by natural infections or seasonal vaccines, we sought to evaluate the efficacy of our headless HA+WT HI / 19 vaccine in mice with pre-existing immunity. To establish pre-existing immunity, mice received one administration of inactivated WT HI / 19 viral particles. Animals were then vaccinated with either BSA or the combination headless HA+WT HI / 19 vaccine (Fig 4A). Antibody levels in post-vaccination sera were then analyzed via ELISA. As expected, antibody responses to WT viral particles were improved post-vaccination, even in pre-immune animals (Fig 4B). Partially deconvoluting that aggregate reactivity, we found that antibodies against the HA head, HA stalk, and NA were all enhanced in the headless HA+WT HI / 19 group (Fig 4C-E). Notably, HA stalk-directed antibody responses were successfully induced by the headless HA+WT HI / 19 vaccine (Fig 4D). Compared with WT HI / 19 group, headless HA+WT HI / 19 group still showed a better HA stalk-directed antibody responses (Fig 7).
[0076] Assays to define antibody functionality demonstrated that HAI, neutralization, and NAI were all improved after vaccination of pre-immune animals (Fig 4F-H), and the ADCC activity was significantly increased from the headless HA+WT HI / 19 vaccine, against both infected and HA-only expressing cells (Fig 41 and J). Finally, to understand if the antibodies elicited by this vaccine scheme had the potential to recognize antigenically distinct viruses, we performed ELISAs against the heterologous, but homosubtypic, A / California / 04 / 2009 virus. We observed significantly increased antibody binding in pre-immune animals that had been vaccinated with the headless HA+WT vaccine, demonstrating the potential of induced antibodies in broadly viral recognition (Fig 4K). We next challenged mice with a lethal dose of A / Califomia / 04 / 2009 virus, and while the control animals all succumbed to infection, the established pre-existing immunity occluded our ability to measure the effects of our vaccine, as animals from both groups were completely protected from weight loss and mortality (Fig 4L and M).
[0077] The headless HA+WT HI / 19 vaccine enhances antibody responses in ferrets with preexisting immunity, providing protection against heterologous virus infection.
[0078] While the headless HA+WT HI / 19 combination vaccine was effective in eliciting differential antibody profdes in mice, we were ultimately unable to demonstrate improved protection in pre-immune animals after heterologous challenge. We therefore decided to evaluate the performance of our vaccine in the ferret model, which is generally considered to better model human vaccine responses and clinical disease [46, 47], We therefore administered WT HI / 19 viral particles to animals to establish pre-existing immunity and then vaccinated with either B SA, the headless HA+WT HI / 19 vaccine, or WT HI / 19 viral particles to mimic administration of existing vaccines (Fig 5A).
[0079] We next conducted experiments using ferret sera that was collected (1) prior to any viral exposure, (2) post-establishment of pre-existing immunity, or (3) post-vaccination. ELISAs demonstrated that all ferrets exhibited low baseline immunity against the HI / 19 virus and that the initial dose of WT HI / 19 vaccine established similar levels of pre-existing immunity across all of the groups (Fig 5B-E). Following vaccination, the headless HA+WT HI / 19 and the WT-only group displayed similarly increased levels of antibodies against the HI / 19 viral particles, the HA head, and the NA protein (Fig 5B-E). The headless HA+WT HI / 19 group, however, uniquely showed a substantial HA stalk-directed antibody response (Fig 5D). HAI, neutralization, and NAI activities in the post-vaccination sera showed that both the headless HA+WT HI / 19 and WT only vaccines were both effective in improving pre-immune sera activities, as expected from the ELISA analysis (Fig 5F-H). Due to a lack of ferret-specific reagents, however, we were unable to measure ADCC activity. Thus, similar to what was observed in mice, the headless HA+WT HI / 19 vaccine can simultaneously induce responses to classic immunodominant epitopes along with responses to subdominant epitopes in ferrets, at least to the extent in which we can measure them.
[0080] Next, we wanted to understand whether the increased breadth of antibodies would provide increased protection to heterologous virus challenge. We measured sera binding to WT A / California / 04 / 2009 viral particles and found both the headless HA+WT HI / 19 and WT HI / 19- only groups displayed significantly improved antibody reactivity compared to the pre-immune only animals. Although we observed a slight trend towards higher reactivity in the headless HA+WT group, it was not statistically significant (Fig 51). Despite similar overall reactivity, we challenged the animals with the heterologous A / Califomia / 04 / 2009 virus. While the BSA-only control group lost -10% of their pre-infection body weight, the three other groups showed reduced body weight loss of similar magnitudes, demonstrating some degree of protection from clinical disease mediated by pre-existing immunity (Fig 5J). Analysis of viral RNA load in nasal / oral swab samples collected at 2- and 4-days post-infection, however, revealed differences in the ability of the animals to control viral replication. Notably, the headless HA+WT HI / 19 group had a significantly decreased viral titer compared to both the Pre-immune / BSA group or Pre-immune / WT group (Fig 5K), suggesting that the antibody profile with a strong HA stalk- directed component elicited by the combination headless HA+WT HI / 19 vaccine provides additional advantages during infection.
[0081] Discussion:
[0082] There is high interest in the development of more durable and universally protective influenza vaccines. One promising approach is to simultaneously elicit immune responses to multiple viral glycoprotein epitopes. Many experimental vaccine approaches attempt to elicit responses targeting more conserved viral epitopes (e.g., in the HA stalk) often at the expense of responses targeting protective, but evolutionary flexible, epitopes (e.g., classical antigenic sites in the HA head). In this study, we demonstrated that an approach of mixing virions that display different antigenic properties can simultaneously elicit a “hybrid” antibody response that recognizes epitopes in the HA head, stalk, and NA. Due to the lack of antigenic competition between the different viral particles, this approach may represent a practical path forward to add additional immune responses to current vaccine approaches instead of replacing them.
[0083] HA stalk-directed antibodies are generally less potent than HA head-directed antibodies due to their weak neutralizing activity [5, 48, 49], These antibodies, however, can mediate effects via other mechanisms, such as ADCC [15, 16], Indeed, we noted uniquely enhanced ADCC activity in our headless HA+WT HI / 19 vaccine group. Granulocytes, such as natural killer cells and neutrophils, expressing FcyRIII, can target infected cells by recognizing the Fc domain of specific IgG subtypes and trigger apoptosis in infected cells
[0050] , This nonneutralizing antiviral function is appreciated to provide protection against different viral infections [51-54], Although antibodies against multiple viral proteins, such as HA stalk, NA and NP, have all been reported to induce ADCC activity[15, 55, 56], the enhanced HA stalk-directed antibodies elicited by our headless HA+WT HI / 19 vaccine may dominate the enhanced ADCC activity. Besides ADCC activity, antibody-dependent cell-mediated phagocytosis (ADCP), complement-dependent cytotoxicity (CDC), and steric inhibition of proteins in viral replication are also important mechanism for non-neutralizing antibodies [57, 58], Whether these activities were modulated by the headless HA+WT HI / 19 vaccine is an interesting question. In addition to causing infected cell death, crosslinked effector cells can secrete antiviral proteins, such as IFNy, TNFa, and MIPla, creating an antiviral environment [59, 60], A combination of these two activities likely explains why we observed the lowest viral RNA load in ferrets vaccinated with headless HA+WT HI / 19 vaccine, yet similar overall viral neutralization ability compared to Pre- immune / WT HI / 19 group.
[0084] Despite the success of our vaccine in eliciting an antibody response that recognizes more viral protein epitopes, our study has limitations and some important outstanding questions. First, we did not test the protection mediated by our vaccine against non-HINl viruses. While we predict that our H1N1 -based vaccine would provide some recognition of at least other group 1 HA viruses, the amount of recognition and whether it provides any meaningful protection remain unclear. Additionally, in our experimental mouse and ferret models, we observed either similar or modestly improved protection from challenge despite significantly improved HA stalk- directed responses when HA head-directed responses were present. Whether the magnitude of the HA stalk-directed responses needs to be further enhanced, or if other challenge models that more closely mimic human immune responses need to be used, remains unclear. Further, we did not test the levels of antibodies that recognize other viral proteins or CD8+ T-cell responses. It is possible these responses could be induced by this vaccine regimen and may contribute to protection. Finally, it will be also important to implement the headless HA+WT vaccine approach to other clinically relevant strains, including H3N2 and influenza B viruses, to investigate if this technology is broadly applicable in generating vaccines for diverse influenza viruses.
[0085] In conclusion, our combination virion-based vaccine in the background of a contemporary H1N1 strain increased levels of antibodies recognizing the relatively conserved HA stalk while maintaining HA head-directed antibody responses compared to a WT viral particle-based approach. We could observe these responses in both naive and pre-immune mice and ferrets, and the vaccine improved protection and / or mediated more rapid viral clearance depending on the experimental model used. Future work using these or similar approaches may represent a way to improve the breadth and / or durability of influenza vaccines, using similar vaccine manufacturing, formulation, and distribution methods as current seasonal vaccines.
[0086] Materials and Methods:
[0087] Cell lines
[0088] HEK-293T and MDCK cells were both obtained from American Type Culture Collection (ATCC). HEK-293T cells were cultured with DMEM supplemented with 5% FBS, I xGlutamax, and 1% Penicillin / Streptomycin. MDCK cells were cultured in MEM supplemented with 5% FBS, 20mM HEPES, 0.15% sodium bicarbonate and I xGlutamax. HA (PR8) MDCK cell line was described in a previous study
[0043] , To generate the headless HI / 19 HA MDCK cell line, the headless HI / 19 HA sequence was designed based on previous study
[0022] , Briefly, the head HA1 region, membrane distal HA1 and HA2 regions in HI / 19 HA were deleted or truncated and the headless HI / 19 fragment was further synthesized at IDT and cloned into lentivirus vector pLex. The lentivirus expressing the headless HE19 HA was transduced into WT MDCK cells. After 6 pg / ml puromycin selection and sorting using fluorescence activated cell sorting (FACS), the polyclonal headless HI / 19 HA MDCK cells were further diluted in a 96-well plate and single cell clone was expanded and verified with CR9114 antibody. All cells were cultured at 37°C in incubator with 5% CO2.
[0089] Headless HI / 19 HA virus generation and vaccine preparation
[0090] A bicistronic pDZ rescue plasmid system from the HI / 19 strain background was used to rescue the HA negative HI / 19 virus. Firstly, the middle coding region of segment 4 HA pDZ was replaced with a GGGGS linker sequence to generate segment 4 HAps-GGGGS-HAps pDZ. A similar strategy was described in previous study
[0043] , Next, 0.5 pg HAps-GGGGS-HAps pDZ, 0.5 pg pLex-HA and 0.5 pg of the other seven viral segments in pDZ were co-transfected into HEK-293T cells. After 48 h, the supernatant was collected and inoculated into HA (PR8) MDCK cell line. A single plaque was expanded to create a plaque-purified HA negative HI / 19 virus.
[0091] To generate the headless HI / 19 vaccine, HA-negative HI / 19 virus was propagated in HA (PR8) MDCK cells with post-infection media (Opti-MEM with 0.35% BSA, 0.01% FBS, 1 pg / ml TPCK). The supernatant was collected 72 hpi and further inoculated into headless HI / 19 MDCK cells with 5 MOI. After a 1 h incubation, the infected headless HI / 19 MDCK cells were washed with PBS and post-infection media (Opti-MEM with 0.35% BSA, 0.01% FBS, 1 pg / ml TPCK) was added. The supernatant containing headless HI / 19 HA virus was collected 48 hpi. For WT HI / 19 virus, it was propagated in regular MDCK cells. Headless HI / 19 HA virus and WT HI / 19 virus were further concentrated using a 30% (w / v) sucrose cushion via ultracentrifugation. Concentrated virus was inactivated with 0.02% formalin for 48 hours at 4°C and dialyzed using Slide-A-Lyzer cassettes (Thermo Fisher, #66370). For vaccine formulation, inactivated virus was quantified using Pierce Rapid Gold BCA Protein Assay Kit (Thermo Fisher, #A53226). After normalization of the two vaccines by HA stalk levels, 2 pg WT HI / 19 virus or 3.6 pg normalized headless HI / 19 virus was diluted in 5 Opl pharmaceutical-grade PBS (Corning, 21-040-CV) along with 50 pl AddaVax (InvivoGen, vac-adx-10) and further vaccinated intramuscularly in the left hind leg of mouse. For ferret experiment, 5 pg WT HI / 19 virus or 9 pg normalized headless HI / 19 virus was administered intramuscularly. Normalized inactivated virus was mixed with an equal value of AddaVax (Invivogen, #vac-adx-10) to generate vaccine for vaccination.
[0092] Experimental model and study participant details For all mouse experiments, six-week-old C57BL / 6 female mice were used. The BSA group was vaccinated with 2 pg BSA, the WT HI / 19 group was vaccinated with 2 pg WT HI / 19 virus and then the headless HI / 19 HA group was vaccinated with normalized 3.6 pg headless HI / 19 HA virus. The headless HA+WT HI / 19 group was vaccinated with 2 pg WT HI / 19 virus and normalized 3.6 pg headless HI / 19 HA virus. To establish pre-existing immunity, 2 pg BSA or 2 pg WT HI / 19 virus was used and then the normalized vaccine was given 21 days after. Sera was collected at indicated time point. All virus challenges were conducted 21 days postvaccination. Following anesthesia with 80 pl ketamine-xylazine mixture, all mice were intranasally infected with 40 pL virus. For A / Hawaii / 70 / 2019 strain, 15000 PFU or 150000 PFU was used. For A / California / 04 / 2009 strain, 100000 PFU was used. After infection, mice were weighed daily for 14 days. 25% body weight loss was treated as a humane endpoint.
[0093] For the ferret model, six-month-old male ferrets were used. To establish pre-existing immunity, 5 pg BSA or 5 pg WT HI / 19 virus were administered intramuscularly. After 28 days, 5 pg BSA, 5 pg WT HI / 19 virus, or 5 pg WT plus normalized 9 pg headless HI / 19 HA virus was applied for vaccination. After an additional 28 days, ferrets were challenged with A / California / 07 / 2009 strain (1000000 PFU). Ferrets were weighed daily for 14 days. Sera and nasal swab samples were collected at the indicated time points.
[0094] Flow cytometry
[0095] HEK-293T cells were transfected with pLex-mCherry, pLex-PR8 HA, or pLex-Headless HI / 19 HA using Lipofectamine™ 2000 transfection reagent (Thermo Fisher, #11668019). After 24h cells were trypsinized and washed with PBS containing 1% BSA. The suspension samples were incubated with 6F12 (1 :50 dilution) or CR9114 (1 : 500 dilution) antibody for Ih at room temperature. After two washes with PBS, secondary antibody goat anti-mouse Alexa Fluor 488 (#A32723) or goat anti-human Alexa Fluor 488 (#A-11013) (1 :2000 dilution) was used. After 0.5h incubation, the samples were washed twice with PBS and then analyzed via FACSCanto II machine. All samples were analyzed with FlowJo software.
[0096] Immunofluorescence assay
[0097] MDCK cells or headless HI / 19 HA MDCK cells in 24-well plate were fixed with 4% paraformaldehyde for 15 min and then washed with PBS for three times. Next, samples were incubated in 0.1% saponin for 20 min for permeabilization and 5% BSA in 0.1% saponin was added for 3 h blocking. The cells were then stained with primary antibody CR9114 (1 :500 dilution) overnight at 4°C. After three PBS washes, the cells were then incubated with secondary antibody goat anti-human Alexa Fluor 488 (1 :2000 dilution) via a 1 h incubation and then stained with Hoechst 33342 (Invitrogen, H3570) for 5 min. After another three washes, the samples were imaged via ZOE Fluorescent Cell Imager (Bio-Rad, 1450031).
[0098] ELISA
[0099] To compare viral protein levels in normalized headless HI / 19 HA virus, 0.1 pg / we 11 BSA, 0.1 pg / well WT HI / 19 virus, and 0.18 pg / ell normalized headless HI / 19 HA virus were used to coat ImmunoGrade 96-well plates (BrandTech, #781722) with a carbonate buffer overnight. After three washes with PBS, coated plates were blocked with PBS containing 1% BSA overnight at 4°C. Then 0.5 pg / ml anti-HA stalk antibody CR9114 (PABL-593), anti-NA antibody (GTX125974), or anti-NP antibody (GTX125989) was gradient diluted and incubated with coated plates overnight. After three washes with PBS, coated plates were incubated with goat anti-rabbit HRP-conjugated antibody (Invitrogen, #31460) or goat anti-human HRP- conjugated antibody (Invitrogen, #31410) for 1 h. After three washes with PBS, coated plates were incubated with 1-Step TMB ELISA Substrate Solutions (Fisher Scientific, PI34028). After 5-10 min incubation, IM sulfuric acid was added to stop the reaction and plates were read at absorbance 450 nm.
[0100] To evaluate antibody response in sera, in-house recombinant HI / 19 HA head protein and HI / 19 HA stalk protein were used. Briefly, HI / 19 HA head and HA stalk were fused to a T4 fibrin foldon with His tag to construct expression plasmids. The expression plasmids were transfected into Expi293F cells (Gibco, A14527) and supernatant containing protein was collected after 72 h. Soluble HA head and HA stalk proteins were purified and quantified via BCA assay (Thermo Scientific, A53226). Recombinant HI / 19 NA were purchased from Native Antigen (REC31885). WT HI / 19 virus or Cal / 09 virus was propagated in eggs and concentrated via ultracentrifuge. 0.1 pg / well HI / 19 HA head protein, 0.2 pg / well HI / 19 HA stalk protein, 0.1 pg / well HI / 19 NA protein, or 0.1 pg / well whole virus was coated in ImmunoGrade 96-well plates (BrandTech, #781722). After three washes with PBS, coated plates were blocked with PBS containing 1% BSA overnight at 4°C. Sera samples were serially diluted with PBS containing 1% BSA and incubated in coated plates overnight at 4°C. ELISA signal was then developed in the same process described above.
[0101] ADCC assay ADCC assays were conducted with Mouse FcyRIV ADCC Bioassay Kit (Promega #M1215). Following the manufacturer’s instruction, MDCK cells plated in a 96-well plate were infected with HI / 19 virus (5 MOI). The supernatant was removed 20 hpi and serially diluted sera was added. After a 30 min incubation, effector cells were added. After another 6 h incubation, luciferase activity was tested with Bio-Gio Reagent via a plate reader. For HA based ADCC assay, HEK-293T cells were seeded in 96-well plate and the next day cells were transfected with 0.4 pg pLex-HA. After 30 h, the supernatant was removed, and the following steps were the same as described above.
[0102] Microneutralization assay
[0103] Sera samples were treated with receptor-destroying enzyme (RDE) (Denka Seiken 370013) for 16 h at 37°C then and inactivated for 1 h at 56°C. Serially diluted sera samples were incubated with 1000 PFU HI / 19 virus in 96-well plate for 1 h at 37°C. 15000 MDCK cells were further seeded into the plate and after 20 h culture the plate was fixed with 4% PFA for 10 min. Next, the cells were stained with CR9114 antibody (0.5 pg / ml) for 4 h and goat anti-human HRP-conjugated antibody for 1 h. Finally, 1-Step TMB ELISA Substrate Solutions was added for 5 min incubation and IM sulfuric acid was added to stop the reaction. Plates were read at absorbance 450 nm.
[0104] HAI assay
[0105] Sera samples were treated with RDE as described above. Serially diluted sera samples were mixed with an equal volume of diluted HI / 19 virus (2 HA units) in a v-bottom plate and incubated for 15 min. Chicken blood (1 :40 dilution) was further added, and after a 1 h incubation at 4°C, the results were recorded. HAI titers were calculated based on the highest sera dilution showing HAI.
[0106] NAI assay
[0107] Sera samples were treated with RDE as described above. Fetuin (Sigma F3385) was diluted to 25 pg / mL with buffer (KPL coating buffer 50-84-10) and 2.5 pg / well fetuin was coated in ImmunoGrade 96-well plate (BrandTech, #781722). After 24 h, coated plates were washed with PBS-T for three times. Serially diluted sera samples and 0.2 pg recombinant NA (Sino Biological, 40785-V08B-100) were mixed in coated plate. After 18 h incubation at 37°C, coated plates were washed with PBS-T three times. Next, 0.1 pg / well peanut agglutinin-HRPO (Sigma A8327) was added. After 2 h incubation, coated plates were washed with PBST three times. 1-Step TMB ELISA Substrate Solutions (Fisher Scientific, PI34028) was added, and after 10 min incubation, IM sulfuric acid was added to stop the reaction. Plates were read at absorbance 450 nm. NAI titers were calculated based on the highest sera dilution showing over 50% inhibition.
[0108] RT-qPCR
[0109] Nasal wash samples from infected ferrets were collected. To evaluate viral replication, viral RNA in nasal wash samples was extracted with QIAamp Viral RNA Kits (QIAGEN, 52906). Taqman probe (forward primer: CCTGGAACTGAGAAGCAGATAC (SEQ ID NO: 21), reverse primer: GAATGTAGGCTGCACACTGA (SEQ ID NO: 22), Probe: / 56- FAM / AGGACCAGG / ZENAGTGGAGGAAATACCA / 3IABkFQ / (SEQ ID NO: 23)) targeting viral NP gene were synthesized by IDT. A taqman probe targeting eukaryotic 18S rRNA (Thermo, 4319413E) was the endogenous control. One-step RT-qPCR was conducted with EXPRESS One-Step Superscript qRT-PCR kit (Invitrogen, 11781200) via Applied Biosystems QuantStudio 3 Real-Time PCR System.
[0110] Statistical analysis
[0111] All statistical data were shown with Prism 9 (GraphPad Software). Data shown as mean ± SEM. Error bars represent SEM. The statistical analysis was performed using SAS 9.4 (SAS Institute). Wilcoxon rank-sum with Bonferroni correction was conducted to compare groups results and false discovery rate (FDR) adjusted p-values are presented, p < 0.05, *; ns, not significant. Unless otherwise indicated, all experiments were performed 2 times and similar results were obtained.
[0112] References:
[0113] 1. Taubenberger JK, Morens DM. Influenza: the once and future pandemic. Public Health Rep. 2010; 125 Suppl 3(Suppl 3): 16-26.
[0114] 2. Paget J, Spreeuwenberg P, Charu V, Taylor RJ, luliano AD, Bresee J, et al. Global mortality associated with seasonal influenza epidemics: New burden estimates and predictors from the GLaMOR Proj ect. J Glob Health. 2019;9(2):020421. doi:
[0115] 10.7189 / jogh.09.020421.
[0116] 3. Palese P, Shaw M. Fields virology. Orthomyxoviridae: The Viruses and Their Replication, 5th edn, Philadelphia, PA: Lippincott Williams & Wilkins, Wolters Kluwer Business. 2007: 1647-89. 4. Skehel JJ, Wiley DC. Receptor binding and membrane fusion in virus entry: the influenza hemagglutinin. Annu Rev Biochem. 2000;69:531-69. doi:
[0117] 10.1146 / annurev. biochem.69.1.531.
[0118] 5. Sanchez -de Prada L, Sanz-Munoz I, de Lejarazu RO, Eiros JM, Garcia-Sastre A, Aydillo T. Immunodominance hierarchy after seasonal influenza vaccination. Emerg Microbes Infect. 2022;l l(l):2670-9. doi: 10.1080 / 22221751.2022.2135460.
[0119] 6. Schmidt AG, Xu H, Khan AR, O'Donnell T, Khurana S, King LR, et al. Preconfiguration of the antigen-binding site during affinity maturation of a broadly neutralizing influenza virus antibody. Proc Natl Acad Sci U S A. 2013; 110(l):264-9. Epub 20121121. doi: 10.1073 / pnas.1218256109.
[0120] 7. Altman MO, Angeletti D, Yewdell JW. Antibody Immunodominance: The Key to Understanding Influenza Virus Antigenic Drift. Viral Immunol. 2018;31(2): 142-9. Epub 20180122. doi: 10.1089 / vim.2017.0129.
[0121] 8. Belongia EA, Skowronski DM, McLean HQ, Chambers C, Sundaram ME, De Serres G. Repeated annual influenza vaccination and vaccine effectiveness: review of evidence. Expert Rev Vaccines. 2017; 16(7): 1-14. Epub 20170609. doi: 10.1080 / 14760584.2017.1334554.
[0122] 9. Kirkpatrick E, Qiu X, Wilson PC, Bahl J, Krammer F. The influenza virus hemagglutinin head evolves faster than the stalk domain. Sci Rep. 2018;8(l):10432. Epub 20180711. doi: 10.1038 / s41598-018-28706-l.
[0123] 10. Wu NC, Wilson IA. A Perspective on the Structural and Functional Constraints for Immune Evasion: Insights from Influenza Virus. J Mol Biol. 2017;429(17):2694-709. Epub 20170623. doi: 10.1016 / j.jmb.2017.06.015.
[0124] 11. Wu NC, Thompson AJ, Lee JM, Su W, Arlian BM, Xie J, et al. Different genetic barriers for resistance to HA stem antibodies in influenza H3 and Hl viruses. Science. 2020;368(6497): 1335-40. doi: 10.1126 / science.aaz5143.
[0125] 12. Aydillo T, Escalera A, Strohmeier S, Aslam S, Sanchez-Cespedes J, Ayllon J, et al. Pre-existing Hemagglutinin Stalk Antibodies Correlate with Protection of Lower Respiratory Symptoms in Flu-Infected Transplant Patients. Cell Rep Med. 2020;l(8): 100130. Epub 20201103. doi: 10.1016 / j.xcrm.2020.100130. 13. Dreyfus C, Laursen NS, Kwaks T, Zuijdgeest D, Khayat R, Ekiert DC, et al. Highly conserved protective epitopes on influenza B viruses. Science. 2012;337(6100): 1343-8. Epub 20120809. doi: 10.1126 / science.1222908.
[0126] 14. Guthmiller JJ, Han J, Utset HA, Li L, Lan LY, Henry C, et al. Broadly neutralizing antibodies target a haemagglutinin anchor epitope. Nature. 2022;602(7896):314-20. Epub 20211223. doi: 10.1038 / s41586-021-04356-8.
[0127] 15. DiLillo DJ, Tan GS, Palese P, Ravetch JV. Broadly neutralizing hemagglutinin stalk-specific antibodies require FcgammaR interactions for protection against influenza virus in vivo. Nat Med. 2014;20(2): 143-51. Epub 20140112. doi: 10.1038 / nm.3443.
[0128] 16. DiLillo DJ, Palese P, Wilson PC, Ravetch JV. Broadly neutralizing anti-influenza antibodies require Fc receptor engagement for in vivo protection. J Clin Invest. 2016;126(2):605- 10. Epub 20160105. doi: 10.1172 / JCI84428.
[0129] 17. Steel J, Lowen AC, Wang TT, Yondola M, Gao Q, Haye K, et al. Influenza virus vaccine based on the conserved hemagglutinin stalk domain. mBio. 2010; 1(1 ). Epub 20100518. doi: 10.1128 / mBio.00018-10.
[0130] 18. Sagawa H, Ohshima A, Kato I, Okuno Y, Isegawa Y. The immunological activity of a deletion mutant of influenza virus haemagglutinin lacking the globular region. J Gen Virol. 1996;77 ( Pt 7): 1483-7. Epub 1996 / 07 / 01. doi: 10.1099 / 0022-1317-77-7-1483.
[0131] 19. Impagliazzo A, Milder F, Kuipers H, Wagner MV, Zhu X, Hoffman RM, et al. A stable trimeric influenza hemagglutinin stem as a broadly protective immunogen. Science. 2015;349(6254):1301-6. Epub 2015 / 08 / 26. doi: 10.1126 / science. aac7263.
[0132] 20. Schneemann A, Speir JA, Tan GS, Khayat R, Ekiert DC, Matsuoka Y, et al. A virus-like particle that elicits cross-reactive antibodies to the conserved stem of influenza virus hemagglutinin. J Virol. 2012;86(21):l 1686-97. Epub 20120815. doi: 10.1128 / JVI.01694-12.
[0133] 21. Kanekiyo M, Wei CJ, Yassine HM, McTamney PM, Boyington JC, Whittle JR, et al. Self-assembling influenza nanoparticle vaccines elicit broadly neutralizing H1N1 antibodies. Nature. 2013;499(7456): 102-6. Epub 2013 / 05 / 24. doi: 10.1038 / nature 12202.
[0134] 22. Yassine HM, Boyington JC, McTamney PM, Wei CJ, Kanekiyo M, Kong WP, et al. Hemagglutinin-stem nanoparticles generate heterosubtypic influenza protection. Nat Med. 2015;21(9): 1065-70. Epub 20150824. doi: 10.1038 / nm.3927. 23. Eggink D, Goff PH, Palese P. Guiding the immune response against influenza virus hemagglutinin toward the conserved stalk domain by hyperglycosylation of the globular head domain. J Virol. 2014;88( l):699-704. Epub 20131023. doi: 10.1128 / JVI.02608-13.
[0135] 24. Bajic G, Maron MJ, Adachi Y, Onodera T, McCarthy KR, McGee CE, et al. Influenza Antigen Engineering Focuses Immune Responses to a Subdominant but Broadly Protective Viral Epitope. Cell Host Microbe. 2019;25(6):827-35 e6. Epub 20190516. doi: 10.1016 / j.chom.2019.04.003.
[0136] 25. Hai R, Krammer F, Tan GS, Pica N, Eggink D, Maamary J, et al. Influenza viruses expressing chimeric hemagglutinins: globular head and stalk domains derived from different subtypes. J Virol. 2012;86(10):5774-81. Epub 2012 / 03 / 09. doi: 10.1128 / JVI.00137-12.
[0137] 26. Krammer F, Pica N, Hai R, Margine I, Palese P. Chimeric hemagglutinin influenza virus vaccine constructs elicit broadly protective stalk-specific antibodies. J Virol. 2013;87(12):6542-50. Epub 2013 / 04 / 12. doi: 10.1128 / JVI.00641-13.
[0138] 27. Margine I, Krammer F, Hai R, Heaton NS, Tan GS, Andrews SA, et al. Hemagglutinin stalk-based universal vaccine constructs protect against group 2 influenza A viruses. J Virol. 2013;87(19): 10435-46. Epub 2013 / 08 / 02. doi: 10.1128 / JVI.01715-13.
[0139] 28. Zeng D, Xin J, Yang K, Guo S, Wang Q, Gao Y, et al. A Hemagglutinin Stem Vaccine Designed Rationally by AlphaFold2 Confers Broad Protection against Influenza B Infection. Viruses. 2022; 14(6). Epub 20220614. doi: 10.3390 / vl4061305.
[0140] 29. Lu Y, Welsh JP, Swartz JR. Production and stabilization of the trimeric influenza hemagglutinin stem domain for potentially broadly protective influenza vaccines. Proc Natl Acad Sci U S A. 2014;l 1 l(l):125-30. Epub 20131216. doi: 10.1073 / pnas.l308701110. .
[0141] 30. Wang TT, Tan GS, Hai R, Pica N, Ngai L, Ekiert DC, et al. Vaccination with a synthetic peptide from the influenza virus hemagglutinin provides protection against distinct viral subtypes. Proc Natl Acad Sci U S A. 2010; 107(44):18979-84. Epub 20101018. doi:
[0142] 10.1073 / pnas.1013387107.
[0143] 31. Skarlupka AL, Bebin-Blackwell AG, Sumner SF, Ross TM. Universal Influenza Virus Neuraminidase Vaccine Elicits Protective Immune Responses against Human Seasonal and Pre-pandemic Strains. J Virol. 2021;95(17):e0075921. Epub 20210810. doi: 10.1128 / JVI.00759- 21. 32. Job ER, Ysenbaert T, Smet A, Christopoulou I, Strugnell T, Oloo EO, et al. Broadened immunity against influenza by vaccination with computationally designed influenza virus N1 neuraminidase constructs. NPJ Vaccines. 2018;3 :55. Epub 20181129. doi: 10.1038 / s41541-018-0093-l.
[0144] 33. Luo Z, Girton AW, Heaton BE, Heaton NS. Engineered influenza virions reveal the contributions of non-hemagglutinin structural proteins to vaccine mediated protection. J Virol. 2021. Epub 20210303. doi: 10.1128 / JVI.02021-20.
[0145] 34. Easterbrook JD, Schwartzman LM, Gao J, Kash JC, Morens DM, Couzens L, et al. Protection against a lethal H5N1 influenza challenge by intranasal immunization with viruslike particles containing 2009 pandemic H1N1 neuraminidase in mice. Virology. 2012;432(l):39-44. Epub 20120622. doi: 10.1016 / j.virol.2012.06.003.
[0146] 35. Walz L, Kays SK, Zimmer G, von Messling V. Neuraminidase-Inhibiting Antibody Titers Correlate with Protection from Heterologous Influenza Virus Strains of the Same Neuraminidase Subtype. J Virol. 2018;92(17). Epub 20180816. doi: 10.1128 / JVI.01006- 18.
[0147] 36. Kim KH, Lee YT, Park S, Jung YJ, Lee Y, Ko EJ, et al. Neuraminidase expressing virus-like particle vaccine provides effective cross protection against influenza virus. Virology. 2019;535:179-88. Epub 20190708. doi: 10.1016 / j.virol.2019.07.008.
[0148] 37. Choi A, Bouzya B, Cortes Franco KD, Stadlbauer D, Rajabhathor A, Rouxel RN, et al. Chimeric Hemagglutinin-Based Influenza Virus Vaccines Induce Protective Stalk-Specific Humoral Immunity and Cellular Responses in Mice. Immunohorizons. 2019;3(4): 133-48. doi: 10.4049 / immunohorizons. 1900022.
[0149] 38. Folschweiller N, Vanden Abeele C, Chu L, Van Damme P, Garcia-Sastre A, Krammer F, et al. Reactogenicity, safety, and immunogenicity of chimeric haemagglutinin influenza split-virion vaccines, adjuvanted with AS01 or AS03 or non-adjuvanted: a phase 1-2 randomised controlled trial. Lancet Infect Dis. 2022. Epub 20220421. doi: 10.1016 / S1473- 3099(22)00024-X.
[0150] 39. Nachbagauer R, Kinzler D, Choi A, Hirsh A, Beaulieu E, Lecrenier N, et al. A chimeric haemagglutinin-based influenza split virion vaccine adjuvanted with AS03 induces protective stalk-reactive antibodies in mice. NPJ Vaccines. 2016; 1. Epub 20160922. doi: 10.1038 / npjvaccines.2016.15. 40. Nachbagauer R, Liu WC, Choi A, Wohlbold TJ, Atlas T, Rajendran M, et al. A universal influenza virus vaccine candidate confers protection against pandemic H1N1 infection in preclinical ferret studies. NPJ Vaccines. 2017;2:26. Epub 20170914. doi: 10.1038 / s41541 - 017-0026-4.
[0151] 41. Broecker F, Liu STH, Suntronwong N, Sun W, Bailey MJ, Nachbagauer R, et al. A mosaic hemagglutinin-based influenza virus vaccine candidate protects mice from challenge with divergent H3N2 strains. NPJ Vaccines. 2019;4:31. Epub 20190719. doi: 10.1038 / s41541- 019-0126-4.
[0152] 42. Liu Y, Strohmeier S, Gonzalez-Dominguez I, Tan J, Simon V, Krammer F, et al. Mosaic Hemagglutinin-Based Whole Inactivated Virus Vaccines Induce Broad Protection Against Influenza B Virus Challenge in Mice. Front Immunol. 2021;12:746447. Epub 20210916. doi: 10.3389 / fimmu.2021.746447.
[0153] 43. Luo Z, Girton AW, Heaton BE, Heaton NS. Engineered influenza virions reveal the contributions of non-hemagglutinin structural proteins to vaccine mediated protection. J Virol. 2021;95(10). Epub 20210303. doi: 10.1128 / JVI.02021-20. .
[0154] 44. Tan GS, Krammer F, Eggink D, Kongchanagul A, Moran TM, Palese P. A pan- H1 anti -hemagglutinin monoclonal antibody with potent broad-spectrum efficacy in vivo. J Virol. 2012;86(l l):6179-88. Epub 20120404. doi: 10.1128 / JVI.00469-12.
[0155] 45. Angeletti D, Kosik I, Santos JJS, Yewdell WT, Boudreau CM, Mallajosyula VVA, et al. Outflanking immunodominance to target subdominant broadly neutralizing epitopes. Proc Natl Acad Sci U S A. 2019;116(27): 13474-9. Epub 20190618. doi:
[0156] 10.1073 / pnas.1816300116.
[0157] 46. Belser JA, Barclay W, Barr I, Fouchier RAM, Matsuyama R, Nishiura H, et al. Ferrets as Models for Influenza Virus Transmission Studies and Pandemic Risk Assessments. Emerg Infect Dis. 2018;24(6):965-71. doi: 10.3201 / eid2406.172114.
[0158] 47. Belser JA, Eckert AM, Huynh T, Gary JM, Ritter JM, Tumpey TM, et al. A Guide for the Use of the Ferret Model for Influenza Virus Infection. Am J Pathol. 2020; 190(1): 11-24. Epub 20191023. doi: 10.1016 / j .ajpath.2019.09.017.
[0159] 48. Sutton TC, Lamirande EW, Bock KW, Moore IN, Koudstaal W, Rehman M, et al. In Vitro Neutralization Is Not Predictive of Prophylactic Efficacy of Broadly Neutralizing Monoclonal Antibodies CR6261 and CR9114 against Lethal H2 Influenza Virus Challenge in Mice. J Virol. 2017;91(24). Epub 20171130. doi: 10.1128 / JVI.01603-17.
[0160] 49. Tete SM, Krammer F, Lartey S, Bredholt G, Wood J, Skrede S, et al. Dissecting the hemagglutinin head and stalk-specific IgG antibody response in healthcare workers following pandemic H1N1 vaccination. NPJ Vaccines. 2016; 1 : 16001-. Epub 20160728. doi:
[0161] 10.1038 / npj vaccines.2016.1.
[0162] 50. Bruhns P. Properties of mouse and human IgG receptors and their contribution to disease models. Blood. 2012; 119(24): 5640-9. Epub 20120425. doi: 10.1182 / blood-2012-01 - 380121.
[0163] 51. Ackerman ME, Mikhailova A, Brown EP, Dowell KG, Walker BD, Bailey- Kellogg C, et al. Poly functional HIV-Specific Antibody Responses Are Associated with Spontaneous HIV Control. PLoS Pathog. 2016;12(l):el005315. Epub 20160108. doi: 10.1371 / journal.ppat.l005315.
[0164] 52. Vogt MR, Dowd KA, Engle M, Tesh RB, Johnson S, Pierson TC, et al. Poorly neutralizing cross-reactive antibodies against the fusion loop of West Nile virus envelope protein protect in vivo via Fcgamma receptor and complement-dependent effector mechanisms. J Virol. 2011;85(22): 11567-80. Epub 20110914. doi: 10.1128 / JVI.05859-11.
[0165] 53. Yu Y, Wang M, Zhang X, Li S, Lu Q, Zeng H, et al. Antibody-dependent cellular cytotoxicity response to SARS-CoV-2 in COVID-19 patients. Signal Transduct Target Ther. 2021;6(l):346. Epub 20210924. doi: 10.1038 / s41392-021-00759-1.
[0166] 54. Bailey MJ, Duehr J, Dulin H, Broecker F, Brown JA, Arumemi FO, et al. Human antibodies targeting Zika virus NS1 provide protection against disease in a mouse model. Nat Commun. 2018;9(l):4560. Epub 20181101. doi: 10.1038 / s41467-018-07008-0.
[0167] 55. Carragher DM, Kaminski DA, Moquin A, Hartson L, Randall TD. A novel role for non-neutralizing antibodies against nucleoprotein in facilitating resistance to influenza virus. J Immunol. 2008;181(6):4168-76. doi: 10.4049 / jimmunol. l81.6.4168.
[0168] 56. Vanderven HA, Ana-Sosa-Batiz F, Jegaskanda S, Rockman S, Laurie K, Barr I, et al. What Lies Beneath: Antibody Dependent Natural Killer Cell Activation by Antibodies to Internal Influenza Virus Proteins. EBioMedicine. 2016;8:277-90. Epub 20160428. doi: 10.1016 / j.ebiom.2016.04.029. 57. Huber VC, Lynch JM, Bucher DJ, Le J, Metzger DW Fc receptor-mediated phagocytosis makes a significant contribution to clearance of influenza virus infections. J Immunol. 2001 ; 166(12):7381-8. doi: 10.4049 / jimmunol. l66.12.7381.
[0169] 58. Schmaljohn AL. Protective antiviral antibodies that lack neutralizing activity: precedents and evolution of concepts. Curr HIV Res. 2013; 11(5):345-53. doi: 10.2174 / 1570162x113116660057.
[0170] 59. De Maria A, Bozzano F, Cantoni C, Moretta L. Revisiting human natural killer cell subset function revealed cytolytic CD56(dim)CD16+ NK cells as rapid producers of abundant IFN-gamma on activation. Proc Natl Acad Sci U S A. 2011 ; 108(2):728-32. Epub 20101227. doi: 10.1073 / pnas.l012356108.
[0171] 60. Caligiuri MA. Human natural killer cells. Blood. 2008; 112(3):461-9. doi: 10.1182 / blood-2007-09-077438.
[0172] Example 2
[0173] The following example shows successful immune responses generated from an H3 influenza virus and headless H3 viral particles.
[0174] Mice were vaccinated with the wild-type Wyoming virus or a mixture of the wild-type virus with the headless HA viral particle. Sera were taken from the immunized mice and used in sera ELISA reactions to assess immune responses against the whole Wyoming virus (Figure 6A) and the WyM03 HA stalk (Figure 6B). Sera from mice immunized with the whole virus or the WT + HA mixture demonstrated strong immunogenicity towards the whole Wyoming virus. Sera from mice immunized with the WT + HL HA mixture showed strong immunogenicity to the WyM03 stalk, while sera from mice immunized with just the WT Wyoming virus showed weaker immunogenicity to the stalk.
[0175] This result demonstrates that a headless HA engineered from an H3 influenza strain is capable of generating immune responses similar to those of headless HA engineered from an Hl influenza strain. Furthermore, this result agrees with prior results obtained using an Hl influenza strain, as the mixture of WT + HL HA provides an enhanced immune response capable of recognizing not only the head domain, but also the HA stalk. Thus, the methods and compositions discussed herein are not limited to Hl influenza.
Claims
CLAIMSWhat is claimed:
1. A composition comprising: a) a first influenza viral particle comprising a wild-type hemagglutinin (HA) protein; and b) a second influenza viral particle comprising a headless HA protein, wherein the headless HA protein comprises a deletion of at least 275 amino acids comprising at least a portion of a head region of the HA protein, wherein the headless HA protein comprises at least a transmembrane domain and a cytoplasmic domain of the HA protein, and wherein the headless HA protein trimerizes in the virus particle.
2. The composition of claim 1, wherein the first influenza viral particle and / or the second influenza viral particle are inactivated.
3. The composition of claim 2, wherein the viral particle is inactivated by treatment with 0.02% formalin for 48 hours.
4. A composition comprising: a) a first nucleic acid encoding a wild-type HA protein; and b) a second nucleic acid encoding a headless HA protein, wherein the headless HA protein comprises a deletion of at least 275 amino acids comprising at least a portion of a head region of the HA protein, wherein the headless HA protein comprises at least a transmembrane domain and a cytoplasmic domain of the HA protein, and wherein the headless HA protein trimerizes when expressed.
5. The composition of claim 4, further comprising a lipid nanoparticle.
6. The composition of claim 4, wherein the nucleic acid is an mRNA or reverse complement to the mRNA.
7. The composition of any one of claims 4-6, wherein the first nucleic acid further encodes a first neuraminidase (NA) protein.
8. The composition of any one of claims 4-7, wherein the second nucleic acid further encodes a second neuraminidase (NA) protein.
9. The composition of any one of the preceding claims, wherein the wild-type HA protein and / or the headless HA protein are from an H1N1 strain, an H5N1 strain or an H3N2 strain.
10. The composition of any one of the preceding claims, wherein the headless HA protein is selected from the group consisting of at least one of SEQ ID NO: 2, or 4-12, and a sequence with at least 90% identity to at least one of SEQ ID NO: 2 or 4-12.
11. The composition of any one of the preceding claims, wherein the wild-type HA protein is selected from the group consisting of SEQ ID NO: 1, 3, or 13-18.
12. The composition of any one of the preceding claims, wherein the wild-type HA is from an influenza virus strain selected from the group consisting of A / Hawaii / 70 / 2019 (SEQ ID NO: 1), PR8 (SEQ ID NO: 3), Wyoming / 03 (SEQ ID NO: 18), Louisiana / 12 / 2024 (SEQ ID NO: 13), Thailand / 8 / 2022 (SEQ ID NO: 15), A / Victoria / 4897 / 2022 (SEQ ID NO: 16), and A / Shanghai / 02 / 2013 (SEQ ID NO: 14).
13. A vaccine formulation comprising the composition of any one of the preceding claims and a pharmaceutically acceptable carrier.
14. A method for inducing an immune response in a subject, the method comprising: administering the composition of any one of claims 1-12 or the vaccine formulation of claim 13 to the subject to induce an immune response.
15. The method of claim 14, wherein the method generates an immune response against HA- head, HA-stalk, and NA.
16. The method of claim 14 or 15, wherein the immune response is cross-reactive with a heterologous influenza virus.
17. The method of any one of claims 14-16, wherein the composition is administered nasally, orally, or via injection.
18. The method of claim 17, wherein the injection is an intramuscular injection.
19. The method of any one of claims 14-18, wherein the subject is selected from the group consisting of humans, poultry, bovine or swine.