A deletion mutant of rice lhcb5 gene and application thereof

By designing a specific editing target in the 3'UTR region of the rice LHCB5 gene and constructing a CRISPR/Cas9 vector to achieve a 40bp deletion mutant, the technical gap in regulating rice disease resistance was filled, and significant improvement in disease resistance and stability of agronomic traits were achieved, making it suitable for rice disease resistance breeding.

CN122104712APending Publication Date: 2026-05-29CHINA NAT RICE RES INST
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
CHINA NAT RICE RES INST
Filing Date
2026-04-29
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

In existing technologies, the potential of the 3'UTR region of the rice LHCB5 gene in regulating disease resistance has not been fully explored, making it difficult to obtain stable genetic germplasm with significant disease resistance and no adverse agronomic traits. Traditional chemical control methods are prone to causing resistance and environmental pollution.

Method used

By designing specific editing targets in the 3'UTR region of the rice LHCB5 gene and constructing gene editing vectors such as CRISPR/Cas9, homozygous deletion of 40bp mutants was achieved, ensuring gene expression stability and enhanced disease resistance without altering the coding region sequence, and exogenous gene components could be eliminated through separation in progeny.

Benefits of technology

The obtained LHCB5 gene 3'UTR deletion mutant significantly enhanced resistance to rice blast and bacterial blight without affecting agronomic traits. It has high biosafety and is suitable for large-scale breeding, reducing disease control costs and environmental pressure.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104712A_ABST
    Figure CN122104712A_ABST
Patent Text Reader

Abstract

The application discloses a deletion mutant of a rice LHCB5 gene and application thereof, and belongs to the field of gene editing. Through gene editing system, the 3'UTR region of the rice LHCB5 gene is precisely edited, and a 40bp homozygous deletion mutant of +16 to +55bp downstream of the termination codon TAA is obtained. The mutant can be stably inherited, and the growth phenotype is not significantly different from that of the wild type. Meanwhile, the resistance to rice blast and bacterial leaf blight is significantly improved, and the length of the disease spot is significantly reduced. The application first discloses the disease resistance regulation function of the 3'UTR of the LHCB5 gene, and realizes the improvement of the disease resistance through the editing of the non-coding region. No exogenous transgene residue is left, and the safety and agronomic trait risks brought by transgene and coding region editing are avoided. The obtained mutant can be directly used for the breeding of rice broad-spectrum disease resistance, and has important application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene editing, specifically relating to a deletion mutant of the rice LHCB5 gene and its applications. Background Technology

[0002] Rice is one of the world's most important food crops, and its yield and quality are directly related to food security and sustainable agricultural development. However, rice production has long been severely threatened by a variety of major diseases. Among them, rice blast caused by Magnaphalthe oryzae and bacterial blight caused by Xanthomonas oryzae pv. oryzae are the most serious fungal and bacterial diseases, causing huge economic losses every year. Meanwhile, with simplified planting becoming the mainstream technology in rice production, the difficulty of disease control has further increased. Traditional chemical control methods easily induce pathogen resistance, cause soil pollution, and pesticide residues. Therefore, breeding disease-resistant rice varieties is the most economical, safe, and effective way to control these diseases. With the rapid development of gene editing technology, precision editing technologies such as CRISPR / Cas9 have become the core means of rice disease resistance breeding, providing an efficient and convenient technical path for improving rice resistance.

[0003] The light-harvesting pigment chlorophyll a / b binding protein gene (LHCB5) is an important component of the plant photosynthetic system. Recent studies have confirmed that it not only participates in photosynthesis but also plays a crucial role in regulating rice disease resistance. A study by Zhang Zhengguang's team at Nanjing Agricultural University found that LHCB5 can positively regulate rice blast resistance by inducing reactive oxygen species bursts through photo-induced phosphorylation (Liu M, Zhang S, Hu J, et al. Phosphorylation-guarded light-harvesting complex II contributes to broad-spectrum blast resistance in rice[J]. Proceedings of the National Academy of Sciences, 2019, 116(35):201905123.DOI:10.1073 / pnas.1905123116.). Overexpression of this gene in plants via transgenic methods can enhance rice's resistance to rice blast fungus. Further research has shown that OsLIKE1 kinase-mediated LHCB5 phosphorylation is the core mechanism regulating rice blast resistance, clarifying the application of OsLIKE1 protein and its mediated LHCB5 phosphorylation pathway in rice disease resistance (Liu J, Su L, Wang W, et al. Light-induced OsLIKE1 phosphorylation enhances rice resistance against blast disease[J]. Nature Communications, 2026.DOI:10.1038 / s41467-025-67504-y.).

[0004] The 3' Untranslated Region (3'UTR), a key region for post-transcriptional regulation, is located downstream of the coding region. It does not encode proteins but contains various cis-acting elements (such as light-responsive and hormone-responsive elements). It can influence gene expression levels by regulating mRNA stability, translation efficiency, and RNA secondary structure, thereby regulating plant growth, development, and stress responses. Editing the 3'UTR region can upregulate gene expression without altering the coding sequence or introducing new genomic fragments, offering a safer and more precise strategy for crop trait improvement. Wang et al. selected the low-temperature tolerance gene OsLTT7 (OsLTT7) and the dwarfing gene OsSBI (OsSBI) in rice, and the salt-tolerance gene AtTPPD (Trehalose-6-Phosphate Phosphatase D) in Arabidopsis thaliana for their research. They used gene editing technology to delete the negatively regulated 3'UTR region, thus enabling the OsLTT7 3'... utr OsSBI3' utr and AtTPPD3' utr The abundance of target proteins was increased in the mutant. OsLTT73' utr OsSBI3' utr and AtTPPD3' utr The plants exhibited traits of low-temperature tolerance, dwarfing, and salt tolerance (Wang H, Zhang D, Chen M, et al. Genome editing of 3′ UTR-embedded inhibitory region enables generation of gene knock-up alleles in plants[J]. Plant Communications, 2024,5(3):100745.DOI:10.1016 / j.xplc.2023.100745.). In the existing technology, research and patents related to disease resistance in rice LHCB5 have focused on coding region function and protein phosphorylation pathways, and have not yet explored the disease resistance regulatory potential of the 3′UTR region to obtain stable genetic germplasm with significant disease resistance and no adverse agronomic traits.

[0005] Therefore, exploring the disease resistance regulatory potential of the 3′UTR of the rice LHCB5 gene and obtaining precisely edited rice germplasm with significant disease resistance and stable agronomic traits is of great significance for meeting the needs of large-scale disease resistance breeding of rice. Summary of the Invention

[0006] To address the problems existing in the prior art, this invention explores the disease resistance function of the 3'UTR region of the LHCB5 gene, and clarifies that the 40bp deletion mutant of the 3'UTR exhibits significant disease resistance without any adverse agronomic traits. The exogenous transgenic components used for gene editing in the obtained material can be removed through segregation in the offspring. The resulting LHCB5 gene 3'UTR region edited material ultimately contains no exogenous transgenic components and can be directly applied to rice disease resistance breeding.

[0007] On one hand, this invention provides a 3′UTR deletion mutant of the rice LHCB5 gene. The mutant involves a deletion in the 3′UTR region of the rice LHCB5 gene. Compared to the nucleotide sequence of the rice LHCB5 gene 3′UTR, the deleted segment is 35-48 bp lower than the nucleotide sequence from 12th to 60th bp relative to the sequence described in SEQ ID NO. 7. The accession number of the LHCB5 gene is LOC_Os01g05900. This deletion allows the 3′UTR region of the rice LHCB5 gene to possess disease resistance regulatory functions.

[0008] Preferably, a deletion of 38-42 bp occurs between the 15th and 58th bp of the nucleotide sequence described in SEQ ID NO.7.

[0009] More specifically, the nucleotide sequence of the 3'UTR of the mutant is as shown in SEQ ID NO.8.

[0010] On the one hand, the present invention provides a disease-resistant rice germplasm, comprising the aforementioned rice mutant.

[0011] On the one hand, the present invention provides the application of the rice mutant or the rice disease-resistant germplasm in rice disease-resistant breeding.

[0012] Specifically, the disease resistance refers to resistance to rice blast.

[0013] Specifically, the disease resistance refers to resistance to bacterial blight.

[0014] On one hand, the present invention provides a method for constructing the aforementioned rice mutant, comprising the following steps:

[0015] (1) Design specific editing targets for the 3'UTR region of the rice LHCB5 gene;

[0016] (2) Construct a gene editing vector targeting the 3'UTR of the LHCB5 gene;

[0017] (3) Transform the editing vector into rice and screen to obtain homozygous deletion mutants of the 3'UTR region of the LHCB5 gene.

[0018] Specifically, the gene editing vector is selected from CRISPR / Cas9, CRISPR / Cas12a, CRISPR / Cas12i, CRISPR / Cas12j or PE editing vector.

[0019] Specifically, the rice is rice TP309. Preferably, the mutant is a homozygous deletion of 40 bp downstream of the stop codon TAA from +16 to +55 bp. More preferably, the nucleotide sequence of the 3'UTR of the mutant is shown in SEQ ID NO.8.

[0020] Furthermore, this includes identifying the resistance of the obtained rice mutants to rice blast and bacterial blight.

[0021] Compared with existing technologies, this invention has the following advantages: This invention is the first to discover and confirm that the 3'UTR region of the rice LHCB5 gene has a disease resistance regulatory function, and identifies a key 40bp deletion segment, filling the gap in the application of disease resistance in the non-coding region of this gene; it uses precise 3'UTR editing, without changing the coding region sequence or introducing exogenous functional genes, and the edited material can be isolated and degenerated through progeny, resulting in high biosafety; the obtained deletion mutants grow normally, with no deterioration in agronomic traits, and significantly enhance broad-spectrum resistance to rice blast and bacterial blight, with stable disease resistance; the editing method used in this invention is simple, has a clear target, and is genetically stable, and can be quickly applied to the creation of disease-resistant rice germplasm and large-scale breeding, reducing disease control costs and environmental pressure. Attached Figure Description

[0022] Figure 1 The LHCB5 gene 3'UTR region target design and obtained LHCB5 3’UTR -L1 mutant diagram.

[0023] Figure 2 It is LHCB5 3’UTR -Schematic diagram of L1 molecule verification results.

[0024] Figure 3 It is wild-type rice TP309 and LHCB5 3’UTR -L1 mutant growth phenotype comparison diagram.

[0025] Figure 4 It is wild-type rice TP309 and LHCB5 3’UTR -Schematic diagram of rice blast resistance phenotype and detection results of L1 plants. Wherein A is a schematic diagram of rice blast in vitro inoculation phenotype results, and B is a schematic diagram of rice blast in vivo inoculation phenotype results.

[0026] Figure 5 It is wild-type rice TP309 and LHCB5 3’UTR-Schematic diagram of bacterial blight resistance phenotype and detection results of L1 plants.

[0027] Figure 6 It is wild-type rice TP309 and LHCB5 3’UTR - The expression level of LHCB5 in L1 plants after inoculation with rice blast fungus for 48 hpi. Detailed Implementation

[0028] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as a result of the description. However, these embodiments are merely illustrative and do not constitute any limitation on the scope of protection defined by the claims of the present invention.

[0029] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that the upper and lower limits of the range and each intermediate value between them are specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, are also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0030] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0031] Example 1: Design of LHCB5 gene 3'UTR knockout vector

[0032] The complete genome sequence of the rice LHCB5 gene (LOC_Os01g05900), including the 3'UTR, was downloaded. The location of the stop codon TAA was determined, and the specific range of the 3'UTR was identified (the 3'UTR sequence of the LHCB5 gene is shown in SEQ ID NO.7). Regional knockout of the 3'UTR region of the LHCB5 gene was performed using the CRISPR / Cas9 system. T0 generation mutant materials were successfully obtained through genetic transformation, and stable deletion mutant materials were obtained through further passage.

[0033] 1. Construction of a multi-target knockout vector for the 3'UTR region of the LHCB5 gene

[0034] The construction process references patent CN105112435A (Construction and application of plant multi-gene knockout vector, publication date: 2015.12.02).

[0035] (1) Target design: Based on the 3′UTR sequence of the LHCB5 gene (as shown in SEQ ID NO.7), three 18-20bp specific sequences evenly distributed in the genome sequence of the target gene were selected through the target sequence design website (CRISPR-GE (CRISPR Genome Editing)). The 3′ end of these sequences contains the NGG motif and the GC content is between 40% and 70%.

[0036] (2) Primer design: The DNA single strand containing NGG is usually called the forward target sequence (g++), and the opposite strand is called the reverse target sequence (g--). Add GGCA to the front of the forward target sequence and add AAAC to the front of the reverse target sequence to synthesize primers (Table 1).

[0037] Table 1. Primer names and sequences for LHCB5 gene 3'UTR triple mutation vector design

[0038] .

[0039] (3) Vector construction: The intermediate vector SK-gRNA (derived from patent CN105112435A, publication date: 2015.12.02) was digested with AarI to form a vector with sticky ends. The synthesized primers g++ and g-- were mixed in equal amounts and annealed to form double strands. The annealed product and the intermediate vector were ligated using T4 ligase. After genetic transformation with E. coli DH5α, the intermediate vectors SK-gRNA-3UTR01, SK-gRNA-3UTR02 and SK-gRNA-3UTR03 were obtained. The final pC1300-Ubi:Cas9 vector was digested with KpnI and BamHI. Using three isoskeletal enzymes (BamHI & BglII, XbaI & NheI, XhoI & SalI) on the SK-gRNA vector, three SK-gRNAs were assembled in one step. After transformation and screening with *E. coli* DH5α, and verification of vector correctness by Sanger sequencing, pC1300-Ubi:Cas9-gRNA was successfully constructed. 3UTR01 -g 3UTR02 -g 3UTR03 Carrier.

[0040] (4) Genetic transformation and mutant screening: The constructed vector was transformed into the rice TP309 recipient variety using the Agrobacterium tumefaciens transformation method with EHA105. Based on the upstream and downstream sequences of the 3'UTR deletion region of the LHCB5 gene, specific detection primers were designed, and PCR amplification was performed on the genomic DNA of the test plants. The results were identified by agarose gel electrophoresis and Sanger sequencing. After subculturing, the T0 generation heterozygous plants yielded the T1 mutant LHCB53'UTR-L1, which has a homozygous deletion in the 3'UTR of the LHCB5 gene. The target site was designed and the obtained LHCB5 mutant was further investigated. 3’UTR A schematic diagram of the -L1 mutant is shown below. Figure 1 As shown.

[0041] Sequencing confirmed that LHCB5 3’UTR -L1 has a 40bp deletion at positions +16 to +55bp downstream of TAA. After editing, LHCB5 3’UTR The nucleotide sequence of the 3'UTR of -L1 is shown in SEQ ID NO.8. Figure 2 As shown, the deleted sequence is accurate and error-free, and the deletion mutation can be stably inherited to the T1-T3 generations.

[0042] L HCB5 gene 3′ UTR sequence (SEQ ID NO.7):ACATCTCGCCGCCGGCGACGCTGGCTGGCCTCAAGTTAATTTTAATCTTACCCGGGAAGAAGAAGGGAGGAGTTTGAGAAGGGTGGAAGAATGTGTTAAATGTACGTGTAAATTATCGT CGAGTTGGGAGATGAATTTGAAAACCTGTTCATTCTGATCTTCTGATAGGAAGGACCAAGTGTTTGGATTTGTGGCTGAGAAATATTTGCTACCTGAGTAAATTGTCTCGAAGTGGTTTTCATC.

[0043] LHCB53'UTR-L1 plant 3'UTR sequence (SEQ ID NO.8): ACATCTCGCCGCCGGGAAGAAGAAGGGAGGAGTTTGAGAAGGGTGGAAGAATGTGTTAAATGTACGTGTAAATTATCGTCGAGTTGGGAGATGAATTTGAAAACCTGTTCATTCTGATCTTCTGATAGGAAGGACCAAGTGTTTGGATTTGTGGCTGAGAAATATTTGCTACCTGAGTAAATTGTCTCGAAGTGGTTTTCATC.

[0044] Example 2, LHCB5 3’UTR -L1 plant phenotypic observation

[0045] Throughout the growth cycle, the growth differences between the mutant and the wild type were observed and statistically analyzed. The results are as follows: Figure 3 As shown, the growth of the mutant (T2 generation homozygous line) was not significantly different from that of the wild type, and no adverse phenotype was produced, indicating that the 40bp deletion mutation does not affect the normal growth and development of rice.

[0046] Example 3, LHCB5 3’UTR -L1 plant rice blast resistance identification

[0047] Using wild-type rice TP309 (the same recipient variety) as a control, the effect on LHCB5 was investigated. 3’UTR -L1 mutants (T2 generation homozygous lines) were used to identify rice blast resistance, with 3 biological replicates for each treatment.

[0048] Rice blast resistance identification by inoculation with detached rice leaves using a puncture technique: Select uniformly grown rice seedling leaves, cut leaf segments of appropriate length, and gently puncture the leaves at equal intervals, creating three epidermal wounds on each leaf. Then, place the leaves in a petri dish, allowing them to float on the surface of a 6-benzylaminopurine aqueous solution. Inoculate the rice blast pathogen RB22 onto a tomato-oat sporulation plate, collect spores, prepare a spore suspension, and drop the suspension onto the punctured areas of the leaves. After inoculation, incubate under dark, humid conditions first, then transfer to natural light conditions. Observe the leaf lesions and measure their length.

[0049] Rice blast resistance identification by spray inoculation during the rice seedling stage: Uniformly growing rice seedlings were selected and sealed in a roll of transparent PVC film. A suspension of RB22 spores of the rice blast pathogen was prepared. The spore suspension was transferred to a spray bottle, and the nozzle was pointed upwards towards the seedlings, allowing the droplets to fall evenly onto the rice leaves. After inoculation, the seedlings were covered with a damp plastic wrap to maintain moisture. After inoculation, the seedlings were kept in the dark for one day, then transferred to natural light conditions for cultivation. Leaf lesions were observed, and the length of the lesions was measured.

[0050] Seven days after inoculation by puncturing detached leaves, the length of lesions was measured, and the severity of disease was assessed by the length of the lesion extension. Results showed that the wild-type control TP309 developed typical extended lesions with an average length of approximately 55 mm; while LHCB5… 3’UTR -L1 strain lesions were significantly restricted, with an average length of only about 22 mm, which was about 60% less than the control, and the difference was statistically significant. Figure 4 (As shown in Figure A). Rice seedlings were inoculated with rice blast fungus using a spray method. The severity of the disease was assessed by the proportion of lesions to the leaf area. Control seedlings of TP309 showed severe disease, with approximately 50% lesions, and extensive yellowing and necrosis of the leaves. LHCB5 3’UTR- The L1 strain had only about 10% lesions, indicating significantly improved disease resistance. Figure 4 (As shown in Figure B). The combined results of the two inoculation methods indicate that LHCB5... 3’UTR The L1 mutant line significantly enhanced the resistance of rice to rice blast.

[0051] Example 4, LHCB5 3’UTR - Identification of bacterial leaf blight resistance in L1 plants

[0052] Field resistance identification of rice bacterial blight: The leaf cutting inoculation method was adopted. Leaves of rice seedlings with uniform growth in the field were selected, the tips of the leaves were cut off with sterile scissors, and the cut ends were immersed in bacterial blight pathogen PXO99A bacterial solution. After inoculation, the plants were cultured under natural conditions for two weeks. The expansion of leaf lesions was observed and the length of the lesions was measured.

[0053] Rice bacterial blight pathogens were artificially inoculated using the leaf-cutting method, and lesion length was measured in the late stage of disease to assess resistance levels. The wild-type control TP309 exhibited typical bacterial blight symptoms, with lesions rapidly expanding along the veins to form large, whitish lesions, with an average lesion length of approximately 53 mm. In contrast, lesion expansion in the LHCB53′UTR–L1 line was significantly inhibited, with an average lesion length of approximately 33 mm, a reduction of about 38% compared to the control, a statistically significant difference. Figure 5 This indicates that LHCB5... 3’UTR -L1 plants showed enhanced resistance to bacterial blight.

[0054] In summary, LHCB5 3’UTR -L1 plants, while maintaining normal growth phenotype and without obvious agronomic trait defects, simultaneously enhanced resistance to rice blast and bacterial blight, achieving a balance between improved disease resistance and normal growth and development, demonstrating good potential for broad-spectrum disease resistance breeding.

[0055] Example 5: Detection of gene expression levels after infection by rice blast pathogen

[0056] Plant materials and inoculation treatment: Wild-type TP309 and LHCB5 plants grown to the four-leaf stage were selected. 3’UTR The experiment was conducted using L1 mutant seedlings. A spray inoculation method was used, with a suspension of RB22 strain evenly sprayed onto the leaf surface of the plant. The MOCK (control) group was sprayed with an equal volume of sterile water. All treated plants were incubated in a 25°C incubator. Leaf samples were collected 48 hours (48 hpi) after inoculation, rapidly frozen in liquid nitrogen, and stored at -80°C for later use.

[0057] qRT-PCR analysis: Total RNA was extracted from rice leaves using the FastPure Universal Plant Total RNA Isolation Kit (Catalog No. RC411-01, Vazyme). Following the kit instructions, cDNA was reverse transcribed using the HiScript IV All-in-One Ultra RT SuperMix for qPCR (Catalog No. R431-01, Vazyme). Real-time quantitative PCR (qRT-PCR) was performed on a Bio-Rad CFX96 Touch qPCR instrument. The reaction system used was 2×ChamQBlue Universal SYBR qPCR Master Mix premix (Catalog No. Q312-02, Vazyme). The rice Actin gene was used as an internal control. -ΔΔCt The relative expression level of the target gene is calculated using this method.

[0058] To investigate the response pattern of LHCB5 in the early stage of pathogen infection, this study examined the relationship between TP309 and LHCB5 48 hpi after inoculation. 3’UTR -L1 strain expression level of LHCB5. The results showed ( Figure 6 In TP309, the expression level of the RB22 gene was significantly downregulated after infection compared to the MOCK treatment, reaching only about 40% of that in the MOCK group (P = 0.002), indicating that this gene is strongly suppressed by the pathogen in the wild-type background. In stark contrast, LHCB5... 3’UTR -In the L1 strain, gene expression levels remained stable after RB22 infection, with a slight upregulation compared to the MOCK treatment group (P = 0.006, paired t-test). This phenomenon indicates that LHCB5... 3’UTR The L1 strain can effectively resist the inhibitory effect of pathogens on the transcription of the LHCB5 gene, and maintain its expression level during infection. This may be an important molecular mechanism by which this mutant enhances disease resistance.

[0059] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A rice LHCB5 gene 3′UTR deletion mutant, characterized in that, The mutant is a deletion in the 3'UTR region of the rice LHCB5 gene. Compared with the nucleotide sequence of the 3'UTR of the rice LHCB5 gene, the deleted segment is 35-48 bp between the 12th and 60th bp of the nucleotide sequence described in SEQ ID NO.

7. The accession number of the LHCB5 gene is LOC_Os01g05900.

2. The mutant according to claim 1, characterized in that, A deletion of 38-42 bp occurs between 15 and 58 bp relative to the nucleotide sequence described in SEQ ID NO.

7.

3. The mutant according to claim 2, characterized in that, The nucleotide sequence of the 3'UTR of the mutant is shown in SEQ ID NO.

8.

4. A disease-resistant rice germplasm, characterized in that, It includes the mutant described in any one of claims 1-3.

5. The application of the mutants described in any one of claims 1-3 or the rice disease-resistant germplasm described in claim 4 in rice disease-resistant breeding.

6. The application according to claim 5, characterized in that, The disease resistance mentioned refers to resistance to rice blast.

7. The application according to claim 5, characterized in that, The disease resistance mentioned refers to resistance to bacterial blight.

8. A method for constructing the mutant according to any one of claims 1-3, characterized in that, Includes the following steps: (1) Design specific editing targets for the 3'UTR region of the rice LHCB5 gene; (2) Construct a gene editing vector targeting the 3'UTR of the LHCB5 gene; (3) Transform the editing vector into rice and screen to obtain homozygous deletion mutants of the 3'UTR region of the LHCB5 gene.

9. The method according to claim 8, characterized in that, The gene editing vector is selected from CRISPR / Cas9, CRISPR / Cas12a, CRISPR / Cas12i, CRISPR / Cas12j or PE editing vector.

10. The method according to claim 8, characterized in that, The rice variety is TP309; the method further includes identifying the resistance of the obtained rice mutant to rice blast and / or bacterial blight.

Citation Information

Patent Citations

  • Application of light harvesting pigment chlorophyll a / b combined protein LHCB5 in plant breeding

    CN102229954A

  • Establishment and application of plant multi-gene knockout vector

    CN105112435A

  • Applications of rice light-harvesting pigment chlorophyll a / b binding protein Lhcb5 in magnaporthe oryzae resistance

    CN108410879A

  • Rice receptor-like kinase OsLIKE1 and application thereof in resistance of magnaporthe oryzae

    CN118581117A

  • Generation of plants with improved pathogen resistance

    US20090222942A1