New use of m6a modification gene GAS6 and its receptor MERTK in rheumatoid arthritis
By identifying and regulating the m6A-modified gene GAS6 and its receptor MERTK, the phagocytic defects and persistent inflammation of synovial cells in RA were addressed, providing new treatment and detection methods and achieving effective regulation of synovial cell proliferation and inflammation.
Patent Information
- Application Number
- CN202610332891.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-18
- Publication Date
- 2026-05-29
AI Technical Summary
In rheumatoid arthritis (RA), defects in the phagocytic function of synovial cells lead to persistent inflammation and joint destruction. Existing treatments have failed to effectively prevent the breakdown of inflammation, and the role of RNA N6-methyladenosine (m6A) modification remains unclear.
By integrating differential gene expression analysis, m6A methylome analysis, and functional experiments, the role of the m6A-modified gene GAS6 in RA was revealed. It was found that GAS6 and its receptor MERTK are significantly upregulated in RA, promoting synovial cell proliferation and inflammatory response. By knocking down GAS6 or inhibiting its expression, the MERTK/AXL pathway was regulated, reducing the production of pro-inflammatory cytokines and enhancing IL-10 secretion.
Agents that inhibit or interfere with the expression of the m6A-modified gene GAS6 can serve as targeted therapies for rheumatoid arthritis, reducing the pathogenic phenotype of synovial cells, decreasing inflammatory responses, and providing potential biomarkers and therapeutic targets.
Smart Images

Figure CN122104894A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular target research technology for rheumatic and immune diseases, specifically involving a novel application of the m6A-modified gene GAS6 and its receptor MERTK in rheumatoid arthritis. Background Technology
[0002] Rheumatoid arthritis (RA) is a systemic autoimmune disease characterized by persistent inflammation of the synovium and progressive destruction of articular cartilage and bone. Despite the availability of antirheumatic drugs that alter disease progression, less than half of patients achieve sustained remission. This treatment gap reflects the complexity and heterogeneity of RA: genetic risk sites, environmental triggers, and immune dysregulation intertwine to lead to chronic synovial inflammation. Autoantibody formation and activation of the innate immune system are initiating factors, but the mechanisms underlying persistent inflammation and joint destruction remain not fully understood.
[0003] Fibroblast-like synovial cells (FLS) are located at the core of synovial injury. Their response to inflammatory signals undergoes significant metabolic reprogramming, transforming them from quiescent matrix-producing cells into highly proliferative, aggressive cells capable of secreting degradative enzymes and pro-inflammatory cytokines. Synovial macrophages also adopt an activating phenotype and work together to create a microenvironment that recruits leukocytes and maintains the inflammatory cascade. However, the upstream signals that shape FLS and macrophage behavior and prevent inflammatory breakdown remain poorly understood.
[0004] Phagocytosis, the process by which phagocytes clear apoptotic cells, is crucial for tissue homeostasis. Failure to clear apoptotic cells leads to secondary necrosis, releasing intracellular contents and further exacerbating inflammation. The TAM receptor tyrosine kinase family (Tyro3, AXL, MERTK) mediates phagocytosis and exerts anti-inflammatory effects by inducing cytokine-inhibiting signaling proteins. Literature reports that mice lacking all three receptors develop acute autoimmune responses, while mice lacking AXL or MERTK exhibit more severe antibody-mediated arthritis and increased cytokine production, with Tyro3 deficiency providing partial protection. In RA patients, AXL and MERTK are expressed differently in synovial macrophages: AXL is upregulated under pro-inflammatory stimuli, while MERTK labels alternatively activated anti-inflammatory macrophages. In experimental arthritis, blocking MERTK disrupts phagocytosis, leading to the accumulation of apoptotic cells and a surge in inflammatory mediators.
[0005] Epitranscriptomics has emerged as a novel dimension of immune regulation. N6-methyladenosine (m6A) is the most abundant internal modification in mammalian messenger RNA. It is installed by methyltransferases such as METTL3 and METTL14, removed by demethylases (FTO and ALKBH5), and decoded by a group of reading proteins. m6A regulates RNA splicing, export, translation, and stability. Dysregulation of m6A has been associated with malignancies and autoimmune diseases. In rheumatoid arthritis (RA), METTL3 expression is increased in synovial tissue and peripheral blood mononuclear cells; this methyltransferase enhances the NF-κB signaling pathway and the production of inflammatory cytokines, while its silencing attenuates pro-inflammatory responses. METTL14 expression is positively correlated with C-reactive protein and rheumatoid factor and is associated with joint tenderness, suggesting that m6A writing factors may influence disease activity. Studies using RA models have begun to map m6A function to specific cell types. In fibroblast-like synovial cells, METTL3 promotes cell proliferation, migration, and the secretion of IL-6 and matrix metalloproteinases; knockdown of METTL3 leads to the opposite effect. In contrast, the demethylase ALKBH5 is upregulated in RA-FLS and promotes its proliferation and invasion; silencing ALKBH5 inhibits these pathogenic behaviors. Decreased levels of the demethylases FTO, ALKBH5, and the reading protein YTHDF2 in peripheral blood are associated with higher disease activity and may be risk factors for RA. In macrophages, METTL14 promotes polarization towards a pro-inflammatory M1 phenotype via the MAPK pathway, and its expression is positively correlated with tumor necrosis factor α and CD68⁺CD86⁺ markers. Despite these advances, little is known about how m6A modification is intertwined with phagocytosis.
[0006] The transcripts of GAS6 and MERTK contain a common m6A motif and may be subject to m6A-dependent regulation, but direct evidence linking epitranscriptomic modifications to phagocytic defects in RA remains lacking. Given the crucial role of the GAS6 / MERTK axis in suppressing synovial inflammation and the broad influence of m6A on immune cell function, m6A modifications may finely regulate phagocytic mechanisms. Therefore, exploring this intersection could reveal novel mechanisms underlying defective apoptotic cell clearance and persistent inflammation in RA, making it a worthy subject of investigation. Summary of the Invention
[0007] Given that rheumatoid arthritis (RA) remains a painful autoimmune disease, and the role of RNA N6-methyladenosine (m6A) modification remains unclear, this invention elucidates the role of m6A-modified GAS6 in RA by integrating differential gene expression analysis, m6A methylome analysis, and a series of functional experiments.
[0008] This invention collects synovial tissue samples from RA patients and healthy controls (HC) for m6A sequencing and RNA sequencing analysis. Peripheral blood mononuclear cells (PBMCs) are isolated from RA patients and HC. The mRNA expression of GAS6 and MERTK is quantitatively analyzed by qRT-PCR, and inflammatory cytokines (IL-1β, IL-6, IL-10, and TGF-β1) are detected by ELISA. GAS6 and MERTK are knocked down in RA-FLS cells using siRNA interference. Cell viability is assessed using the CCK-8 assay, apoptosis is assessed by flow cytometry, and cell migration rate is assessed by cell scratch assay. Protein localization and expression are detected by immunofluorescence and Western blot.
[0009] The results showed that multi-omics integration analysis of synovial tissue and peripheral blood mononuclear cells from RA patients revealed co-dysregulation of transcriptomics and epitranscriptomics, highlighting 323 genes with both differential expression and m6A modification. These genes were enriched in processes such as phagocytosis, Th17 differentiation, and cellular senescence. Among these genes, GAS6 showed the most significant m6A hypermethylation and upregulation, and was validated as a key effector molecule interacting with the MERTK / AXL receptor. In RA patients, the expression of GAS6 and MERTK was elevated in the blood and significantly correlated with clinical disease activity indicators. Functional experiments showed that GAS6 and MERTK synergistically promote the malignant phenotype of RA fibroblast-like synovial cells, enhancing their proliferation, migration, inflammatory cytokine secretion, and anti-apoptotic capabilities.
[0010] This invention experimentally demonstrates that m6A modification acts as a key epigenetic switch regulating the pathological process of rheumatoid arthritis (RA). By mediating the abnormal activation of the GAS6 / MERTK signaling axis, it promotes synovial cell proliferation and inflammatory responses, thereby driving disease progression. Simultaneously, the m6A-modified gene GAS6 drives phagocytosis through the MERTK / AXL pathway. GAS6 knockdown significantly reduces the expression of MERTK, TGF-β1, and ERK, inhibits synovial cell proliferation and the production of pro-inflammatory cytokines, while increasing IL-10 secretion. This, in turn, inhibits the pathogenic phenotype of RA-FLS by activating the MERTK / ERK / TGF-β1 signaling pathway. Therefore, preparations that inhibit or interfere with the expression of the m6A-modified gene GAS6 can serve as targeted therapies for rheumatoid arthritis. Furthermore, preparations capable of detecting the expression level of the m6A-modified gene GAS6 can also serve as targeted diagnostic agents for rheumatoid arthritis.
[0011] This invention combines differential gene expression analysis of RA synovial tissue with m6A sequencing of peripheral blood mononuclear cells to identify genes exhibiting both differential expression and differential methylation. This method revealed a group of m6A-modified transcripts enriched in phagocytosis and signaling pathways, with GAS6 emerging as the most prominent candidate gene for methylation. GAS6 and its receptor MERTK were significantly upregulated in RA samples, and their expression was positively correlated with indicators of clinical disease activity. Functional experiments in primary RA-FLS showed that knockdown of GAS6 or MERTK reduced cell viability, migration, and secretion of pro-inflammatory cytokines, while restoration of GAS6-MERTK signaling enhanced these pathogenic phenotypes. These findings outline an epitranscriptomics-phagocytosis axis, where m6A modification enhances GAS6-MERTK signaling and maintains synovial inflammation. Therefore, this invention identifies GAS6 and MERTK as potential biomarkers and therapeutic targets and highlights the importance of integrating epitranscriptomics in understanding the pathogenesis of RA.
[0012] m6A modification enhanced the expression of the apoptosis-clearing ligand GAS6 and drove pathogenic activation of rheumatoid arthritis synovial fibroblasts (RA-FLS). A comprehensive analysis of m6A-modified mRNA and differentially expressed genes in RA synovium revealed 323 overlapping genes enriched in the apoptosis-clearing and PI3K-Akt / TGF-β pathways. GAS6 exhibited the highest m6A score and showed the strongest predicted interaction with its receptors MERTK and AXL. Clinical transcriptome datasets and synovial samples confirmed that GAS6 and MERTK were significantly upregulated in RA, and their expression was correlated with joint inflammation and disease severity. Functional experiments showed that GAS6 / MERTK promotes FLS proliferation, migration, and inflammatory cytokine secretion, while knockdown of GAS6 and MERTK inhibited FLS bioactivity, reduced pro-inflammatory mediators, and induced apoptosis. Overall, these findings support the idea that m6A-driven GAS6 promotes synovial hyperplasia and chronic inflammation in FLS by enhancing the MERTK / AXL-dependent apoptosis clearance signaling pathway.
[0013] The idea that synovial fibroblasts (FLS) are core effector cells in rheumatoid arthritis (RA) is widely accepted. Proliferating FLS form invasive synovial granulation tissue and secrete cytokines, chemokines, and matrix metalloproteinases, exhibiting tumor-like behavior characterized by enhanced proliferation, anti-apoptotic capacity, and stronger migration and invasion. Targeted therapies for FLS are under clinical investigation, and the regulation of Janus kinase / signal transducer and transcriptional activator pathways, MAPK, NF-κB, Notch, and IL-1 receptor-associated kinase 4 (IL-1 kinase 4) highlights the importance of these cells as therapeutic targets. FLS from different joints exhibit unique transcriptomic signatures, indicating that hand FLS are particularly invasive, producing more IL-6, GM-CSF, and matrix metalloproteinases than hip or knee FLS. Furthermore, the exosome circFTO released by RA-FLS inhibits chondrocyte proliferation and promotes apoptosis through m6A-dependent SOX9 inhibition, highlighting the impact of FLS on other joint cells. These findings, along with reviews emphasizing the regulation of RNA splicing, stability, and translation by m6A writing, removal, and reading factors, provide context for identifying GAS6 as an m6A-modified apoptosis clearance gene. Intersection analysis further expands this framework, demonstrating that apoptosis clearance-related genes in RA are extensively modified with m6A, and that GAS6 is located at the intersection of epigenetic modification and apoptosis clearance signaling pathways. While previous work has focused on general m6A regulators such as METTL3, METTL14, and YTHDC1, this invention reveals how m6A, when labeled with specific ligands, enhances FLS activation and links two major pathogenic mechanisms: FLS proliferation and apoptosis clearance defects.
[0014] This invention identifies GAS6 as the most significant m6A-modifying gene and investigates the role of the GAS6 / TAM receptor system in regulating the inflammatory response in rheumatoid arthritis (RA). Serum levels of soluble Tyro3 are elevated in RA and are associated with white blood cell count, rheumatoid factor, and bone destruction, while soluble MerTK levels are decreased and not associated with disease activity. Experimental studies showed that Axl and MerTK deficiency increased the severity of antibody-induced arthritis and cytokine production, while Tyro3 deficiency improved disease severity. Another study indicated that MerTK has a protective effect: Pros1 stimulation of MerTK reduces the secretion of inflammatory cytokines, while MerTK inhibition exacerbates arthritis. Data showed that GAS6 and MerTK expression was significantly increased in RA FLS, consistent with these observations, but m6A analysis indicated that the upregulation was not only due to transcriptional induction but also to enhanced mRNA stability. In this context, it is noteworthy that the soluble TAM receptor generated from ADAM10 / 17 cleavage acts as a decoy; ADAM-17 is abundantly expressed in RA FLS, promoting monocyte adhesion and cytokine production. Therefore, the balance between membrane-bound and soluble receptors may determine whether GAS6 induces protective or pathogenic effects.
[0015] GAS6 significantly affects TGF-β1 expression and cell migration. GAS6 treatment increases TGF-β1 levels and promotes FLS migration, consistent with the role of TGF-β in synovial granulation and tissue fibrosis. MERTK knockdown reduces FLS bioactivity, increases apoptosis, and upregulates pro-apoptotic molecules. Cysteine 3B increases GAS6 production and MerTK expression, enhances resolving factor D1 levels, and promotes macrophage apoptotic clearance; its administration can reduce arthritis severity. Conversely, ADAM-17-mediated TAM receptor cleavage to generate a soluble form may disrupt apoptotic clearance signaling. Data suggest that FLS-specific inhibition of MERTK may suppress pathogenic signaling without compromising beneficial MerTK-dependent apoptotic clearance in macrophages, but cell-specific targeting will be crucial. Attached Figure Description
[0016] Figure 1 Transcriptomic characteristics of RA synovial tissue.
[0017] (A) PCA analysis showed a clear separation of gene expression profiles between the RA group and the control group. (B) Heatmap showed clustering of 1123 DEGs between the RA and control groups. (C) Volcano plot highlighted genes that were significantly upregulated (n=454) and downregulated (n=669). (D) GO biological process enrichment analysis showed that DEGs are involved in processes such as extracellular matrix organization and mitosis. (E) GO cellular component analysis showed enrichment in regions containing collagen matrix and centromere chromosomes. (F) GO molecular function analysis revealed the role of glycosaminoglycan binding and extracellular structural components. (G) KEGG pathway analysis showed that DEGs were enriched in important pathways.
[0018] Figure 2 Intersection analysis of m6A-modified genes and differentially expressed mRNAs in RA PBMCs.
[0019] (A) Volcano plot showing significant high and low methylation peaks of m6A in RA PBMCs compared to healthy controls. (B) Volcano plot showing upregulated and downregulated genes of differentially expressed mRNAs in RA PBMCs. (C) Heatmap showing significant expression patterns of DEGs between RA patients and controls. (D) Venn plot showing the intersection of m6A-modifying genes and DEGs, identifying 323 common genes with changes in both m6A and expression. (E) Bar chart summarizing the number of overlapping genes identified through intersection analysis. (F) GO enrichment analysis showing that overlapping genes are mainly enriched in immune-related biological processes. (G) KEGG pathway analysis revealing that overlapping genes are involved in key pathways related to the pathogenesis of RA.
[0020] Figure 3 The m6A-modified gene GAS6 promotes phagocytosis through the MERTK / AXL signaling pathway.
[0021] (A) Intersection analysis identified five co-upregulated genes and five co-downregulated genes from the m6A-seq and mRNA-seq datasets, respectively. (B) The GSE181614 dataset was used to validate the significant upregulation of GAS6 in RA samples. (C) KEGG pathway mapping showed that GAS6 is involved in the phagocytic pathway and regulates the clearance of apoptotic cells. (D) PPI network analysis showed strong interactions between GAS6 and its phagocytic partners AXL, MERTK, and TYRO3.
[0022] Figure 4 To validate the experimental and clinical relevance of GAS6 and MERTK in RA patients.
[0023] (A) qRT-PCR detection of GAS6 and MERTK expression in RA and HC groups, ***P<0.001. (B) ELISA detection of IL-10, IL-1β, IL-6, and TGF-β1 expression in RA and HC groups, ***P<0.001. (C) Correlation analysis of GAS6 and MERTK with clinical indicators and inflammatory cytokines, including ESR, CRP, RF, CCP, DAS28, IL-10, IL-1β, IL-6, and TGF-β. (D) ROC curve analysis of the predictive value of GAS6 and MERTK for DAS28 in RA patients.
[0024] Figure 5 GAS6 promotes the proliferation of RA-FLS, the production of inflammatory cytokines, and gene expression.
[0025] (A) CCK-8 assay to evaluate the effect of GAS6 on the proliferation of RA-FLS and normal FLS, ***P<0.001. (B) ELISA to quantify the secretion of IL-6, IL-1β, TGF-β1 and IL-10, ***P<0.001. (C) qRT-PCR to determine the mRNA expression of GAS6, MERTK, TGF-β1, ERK1 and ERK2, **P<0.01, ***P<0.001. (D) Western blot to detect the expression of GAS6, MERTK, TGF-β1 and ERK proteins in RA-FLS, 1: FLS, 2: RA-FLS, 3: RA-FLS+siRNA-GAS6-NC, 4: RA-FLS+siRNA-GAS6, *P<0.05, **P<0.01, ***P<0.001.
[0026] Figure 6 GAS6 regulates TGF-β1 expression and promotes RA-FLS migration.
[0027] (A) Immunofluorescence staining was used to detect the expression of GAS6 and TGF-β1 in each group: 1: FLS, 2: RA-FLS, 3: RA-FLS+siRNA-GAS6-NC, 4: RA-FLS+siRNA-GAS6, ***P<0.001. (B) Scratching wound assay was used to assess the effect of GAS6 knockdown on RA-FLS migration ability, ***P<0.001.
[0028] Figure 7 MERTK regulates the proliferation and inflammatory signaling of RA-FLS.
[0029] (A) CCK-8 assay to evaluate cell proliferation of RA-FLS and normal FLS, ***P<0.001. (B) ELISA to quantify IL-10, IL-1β, IL-6 and TGF-β1 in culture supernatant, ***P<0.001. (C) qRT-PCR to determine mRNA expression of MERTK, FAK, CRK, DOCK1, AXL and Rac1, *P<0.05, **P<0.01, ***P<0.001. (D) Western blot to detect the expression of MERTK and its downstream signaling molecules, 1: FLS, 2: RA-FLS, 3: RA-FLS+siRNA-MERTK-NC, 4: RA-FLS+siRNA-METRK, *P<0.05, **P<0.01, ***P<0.001.
[0030] Figure 8 MERTK knockdown upregulates reversal protein and promotes apoptosis in RA-FLS.
[0031] (A) Immunofluorescence staining was used to detect the expression of AXL, DOCK1, MERTK, and Rac1. 1: FLS, 2: RA-FLS, 3: RA-FLS+siRNA-MERTK-NC, 4: RA-FLS+siRNA-MERTK. ***P<0.001. (B) Flow cytometry was used to assess the effect of MERTK knockdown on RA-FLS apoptosis. *P<0.05, **P<0.01, ***P<0.001. Detailed Implementation
[0032] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings.
[0033] Example 1 Experimental Section:
[0034] 1. N6-Methyladenosine Sequencing Data Analysis
[0035] The quality of the raw read data was checked using fastqc v0.10.1 (http: / / www.bioinformatics.babraham.ac.uk / projects / fastqc / ) and low-quality bases and adapters were trimmed using TrimGalore (http: / / www.bioinformatics.babraham.ac.uk / projects / trim_galore / ). The cleaned read data were aligned to Human Genome Version 38 (GRCh38) using HISAT2v2.0.4. Alignment data for each sample were assembled using StringTie v1.3.1, employing a reference genome approach. If a gene had multiple transcripts, the longest transcript was retained. Methylation sites (peaks) on RNA were identified using MACS software. Peaks of differential m6A modification between the IP and input samples were identified using exomePeak. Enrichment analysis of Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) was performed using the clusterProfiler R package (http: / / bioconductor.org / packages / release / bioc / html / clusterProfiler.html).
[0036] 2. mRNA sequencing data analysis
[0037] The quality of the raw read data was checked using fastqc v0.10.1 (http: / / www.bioinformatics.babraham.ac.uk / projects / fastqc / ) and low-quality bases and adapters were trimmed using TrimGalore (http: / / www.bioinformatics.babraham.ac.uk / projects / trim_galore / ). After quality control, the sequence data were processed using STAR and read alignments with the hg38 genome were generated. Raw read counts of annotated genes were obtained using featureCounts and normalized using default settings, followed by analysis using DESeq2. Genes with a p-value <0.05 and a fold change ≥2 (|log2 fold change| ≥1) obtained by DESeq2 analysis were considered differentially expressed, and the top 50 genes by p-value were selected for cluster analysis. To understand the potential functions of different differentially expressed genes, GO and KEGG enrichment analyses were performed using the clusterProfiler R package (http: / / bioconductor.org / packages / release / bioc / html / clusterProfiler.html). Protein-protein interaction networks of the differentially expressed genes were constructed using the STRING database.
[0038] 3 Clinical Data
[0039] This invention involved 15 RA patients from the outpatient and inpatient departments of the Rheumatology Department of Anhui Provincial Hospital of Traditional Chinese Medicine. Fifteen healthy controls (HC group) were from the hospital's health checkup center. Recruitment took place from August to December 2023, and all participants signed informed consent forms. The diagnosis of RA was based on the 2010 American College of Rheumatology (ACR) / European League Against Rheumatism (EULAR) criteria, and the 1987 revised ACR classification criteria and scoring system.
[0040] Inclusion criteria: Meeting the ACR / EULAR classification criteria, aged 18-60 years, signing informed consent, and exhibiting good compliance. Exclusion criteria: Presence of serious comorbidities significantly affecting the heart, brain, lungs, liver, kidneys, or hematopoietic system; other metabolic diseases; pregnancy or lactation; severe joint deformities (see Table 1).
[0041] Peripheral blood mononuclear cells (PBMCs) were collected from peripheral blood samples of 15 pairs of healthy controls (HC) and RA patients. Synovial tissue samples were collected from 3 RA patients and 3 age- and sex-matched controls and stored at -80°C for RNA extraction and transcriptome sequencing.
[0042] Detection parameters: Erythrocyte sedimentation rate (ESR) was measured using an automated ESR analyzer (Vital Monitor-20). Biochemical indicators (including C-reactive protein [CRP], rheumatoid factor [RF], and anti-cyclic citrullinated peptide antibody [CCP]) were measured using an automated biochemical analyzer (HITACHI 7600-020).
[0043] Disease activity in RA patients was assessed using the ESR-based 28-joint disease activity score (DAS28-ESR).
[0044] The experiment has been reviewed and approved by the Ethics Committee of the Affiliated Hospital of Anhui University of Traditional Chinese Medicine (Approval No.: 2023AH-52; Approval Date: July 27, 2023).
[0045] Table 1 Clinical baseline data
[0046] index RA(n=15) HC(n=15) t / χ² P Age (years) 39.47±8.58 36.00±7.86 1.154 0.258 Gender (Male / Female) 2 / 13 2 / 13 0.000 1.000 Course of illness (months) 11.13±3.80 - - - Height (cm) 158.07±6.96 154.26±7.08 1.488 0.148 Weight (kg) 50.20±6.48 47.67±6.55 1.064 0.296 ESR (mm / h) 53.34±15.20 - - - CRP (mg / L) 66.15±8.71 - - - RF (U / mL) 49.49±6.81 - - - CCP (U / mL) 80.37±8.01 - - - DAS28 (points) 5.25±1.73 - - - History of RA-related medication treatment (yes / no) 2 / 13 0 / 15 2.143 0.483
[0047] 4. Cell Culture and Transfection
[0048] FLS and RA-FLS cells (iCell, Shanghai, China) were removed from the incubator and the culture medium was discarded. After washing twice with PBS (Hyclone, Shanghai, China), they were incubated with 1 mL of trypsin (Beyotime, Shanghai, China) at 37°C for 2 min. When the cells shrank and rounded, fresh culture medium was added to stop digestion. The cells were gently pipetted and collected into 15 mL centrifuge tubes, and centrifuged at 1000 r / min for 5 min. Cells were passaged at a ratio of 1:1 or 1:2 every 2 days, and experiments were performed after the 7th passage. For RA-FLS, after digestion, the culture medium was discarded, the cells were washed twice with PBS, resuspended in fresh culture medium, and incubated at 5 × 10⁻⁶ cells / mL. 5 Cells were seeded at a density of 10 cells / well in 6-well plates and incubated overnight at 37°C in a 5% CO2 incubator. Transfection was performed when the cells reached 70-80% confluence.
[0049] siRNAs targeting GAS6 and MERTK, along with a negative control (si-NC), were resuspended to 20 µmol / L in DEPC-treated water (Generay Biotech, Shanghai, China). For transfection, 5 µL of siRNA / NC was added to 250 µL of serum-free medium, mixed, and then combined with 5 µL of Lipofectamine™ 2000 (Invitrogen, Carlsbad, USA) in another 250 µL of serum-free medium. The mixture was incubated at room temperature for 5 min, followed by incubation for another 20 min. 500 µL of the transfection mixture was added to each well, and transfection efficiency was assessed by real-time quantitative PCR. 24 h after transfection, cells were digested with 2.5 g / L trypsin, washed twice with PBS, collected, and stored at -80°C for further analysis. siRNAs and negative controls were synthesized by GenePharma (Shanghai, China).
[0050] 5 CCK-8
[0051] Cells were seeded in 96-well plates and cultured at 37°C and 5% CO2 for 0, 24, 48, and 72 h. Cell morphology was observed using an inverted microscope. At each time point, 10 µL of CCK-8 solution (BIOSS, Beijing, China) was added to each well, and cells were incubated at 37°C for 1–4 h. A blank control was provided, and absorbance (A) was measured at 450 nm using a microplate reader.
[0052] 6. Cell Scratch Assay
[0053] Cells in the logarithmic growth phase were collected by trypsin digestion, centrifuged, and resuspended in fresh culture medium. The concentration of the cell suspension was adjusted to 5 × 10⁻⁶. 5 Cells were seeded per well in 6-well plates and incubated overnight at 37°C with 5% CO2. After cell confluence, cells were scratched with a sterile pipette tip, aligned with pre-marked scratch lines. After scratching, cells were washed three times with PBS to remove detached cells, and fresh serum-free medium was added. Initial scratch area images were taken at 0 h, followed by 24 h of incubation at 37°C with 5% CO2. Scratch images were taken again at 24 h to assess cell migration. Migration rates were calculated using ImageJ software.
[0054] 7. Immunofluorescence staining and imaging
[0055] Cells cultured on glass slides were washed three times with PBS-T (PBS containing 0.1% Tween-20; ebiogo, Hefei, China) after the culture medium was aspirated. Cells were fixed with 4% paraformaldehyde for 20 min, followed by three washes with PBS-T. Cells were incubated with 0.5% Triton X-100 at 37°C for 30 min to achieve permeability. After removing Triton X-100, cells were washed three times with PBS-T. To prevent nonspecific binding, cells were incubated with goat serum blocking solution at 37°C for 30 min. After blocking, the blocking solution was removed and primary antibodies (GAS6, rabbit, 1:200, SanYing, Wuhan, China; TGF-β1, rabbit, 1:100; AXL, rabbit, 1:100; DOCK1, rabbit, 1:100; MERTK, rabbit, 1:200; Rac1, rabbit, 1:100, all from Bioss, Beijing, China) were added and incubated at 37°C for 60 min. After incubation, cells were washed three times with PBS-T and incubated with secondary antibody (goat anti-rabbit IgG (CY3, 1:400, ebiogo, Hefei, China)) at 37°C for 30 min in the dark. After removing the secondary antibody, cells were washed three times with PBS-T and mounted with anti-fluorescence quenching mounting medium containing DAPI. Fluorescence images were acquired using a digital slide scanner.
[0056] 8. Real-time quantitative PCR detection of gene expression
[0057] Total RNA was extracted using TRIzol reagent (Life Technologies, Waltham, USA) according to the manufacturer's instructions. 1.0 µL of RNA was used as a template for cDNA synthesis. Quantitative PCR was performed with an initial denaturation temperature of 95°C for 1 min, followed by 40 cycles (95°C for 20 seconds, 60°C for 1 min). The PCR reaction mixture (10 µL total) contained: 5 µL 2×SYBR GreenMaster Mix (Novoprotein, Suzhou, China), 1 µL 10 µmol / L forward and reverse primers, 1 µL cDNA, and 2 µL RNase-free water (Generay Biotech, Shanghai, China). Gene expression was quantified using the 2-ΔΔCt method. The primer sequences used in this study are shown in Table 2.
[0058] Table 2 Primer sequences
[0059] Gene Amplicon size (bp) Forward primer (5'→3') Reverse primer (5'→3') β-actin 96 CCCTGGAGAAGAGCTACGAG GGAAGGAAGGCTGGAAGAGT GAS6 142 GAAGTAGAAGTCGTGGCTCA CCAGCTGCTTCTTGAGTTTC MERTK 104 GACTTGAAAGACAGTGGTCG AAGCAATGCCAAGAATGGTC AXL 183 CGTAAACAACACGCAGAACT CTTCGCAGGAGAAAGAGGAT CRK 188 GTATCGGCTCTGATTGGAGG CCCATCTGTCAGCAAAACTG DOCK1 142 AAAGGAATGGAAAATGGCGG GCTCCTCTGGCATCATAGTT ERK1 145 TTTTCCCCAAGTCAGACTCC GACTGGCCCACCTCATC ERK2 86 AACTTGTGTTAGGGCTGTGA AAGGTCTGAAGAACCACCTG FAK 157 AGATGGCTTTTCAGGTGACT GTTAACTTACGCCACGCTAC Rac1 180 ATGGGATACAGCTGGACAAG GTTCCCACTAGGATGATGGG TGF-β1 136 GCAACAATTCCTGGCGATAC CTAAGGCGAAAGCCCTCAAT
[0060] 9. Flow cytometry
[0061] Cells were collected by centrifugation, digested with EDTA-free trypsin, and washed with cold PBS. Approximately 1–10 × 10⁻⁶ cells. 5Cells were resuspended in 500 µL of 1× binding buffer, and then diluted with distilled water to prepare 5× binding buffer. 5 µL of Annexin V-FITC (LinkBio, Hangzhou, China) and 10 µL of PI were added to each tube. After mixing, the cells were incubated at room temperature in the dark for 5 min. Apoptosis was analyzed by flow cytometry, and the apoptosis rate was calculated using FlowJo V10 software.
[0062] 10 ELISA test
[0063] The levels of inflammatory cytokines IL-1β, IL-6, IL-10 and TGF-β1 in peripheral blood samples and RA-FLS culture supernatant from subjects were measured using an ELISA kit (GeneMed, Wuhan, China) according to the manufacturer's instructions.
[0064] 11 Western Blot Detection
[0065] Cells and blood samples were lysed using 600 µL RIPA buffer (Beyotime, Shanghai, China) containing 0.6 mM PMSF and centrifuged at 12000 × g for 15 min. The supernatant containing total protein was collected. Proteins were separated using SDS-PAGE. Gel preparations were as follows: stacking gel (2 mL) and separating gel (10 mL), using acrylamide, Tris, SDS, APS, and TEMED. Equal volumes of protein (5–10 µL) were mixed with 5X SDS sample buffer, boiled at 95°C for 15 min, and loaded onto the gel. Electrophoresis was performed at 80 V for 1 h. Proteins were transferred onto PVDF membranes (Bedford, MA, USA) using a semi-dry transfer system. Transfer times were adjusted for specific proteins: GAS6 (50 min), MERTK (120 min), ERK (40 min), TGF-β1 (50 min), FAK (70 min), CRK (40 min), DOCK1 (140 min), AXL (60 min), Rac1 (25 min), and GAPDH (30 min).
[0066] After transfer, the membrane was blocked with 5% skim milk powder at room temperature for 2 hours, and then incubated overnight at 4°C. Primary antibodies were used: GAS6 (1:1000, rabbit, Bioss), MERTK (1:2000, rabbit, Abcam), ERK (1:1000, rabbit, CST), TGF-β1 (1:1500, rabbit, Bioss), FAK (1:1000, rabbit, Bioss), CRK (1:2000, rabbit, Bioss), DOCK1 (1:2000, rabbit, Abcam), AXL (1:2000, rabbit, Bioss), Rac1 (1:2000, rabbit, Bioss), and GAPDH (1:2000, mouse, Zsbio). After washing with TBST, the membrane was incubated with HRP-labeled secondary antibody (1:20000, Zsbio) at room temperature for 1.2 hours. Protein bands were detected using the ECL kit (ThermoFisher), and band intensity was quantitatively analyzed using ImageJ.
[0067] 12 Statistical Analysis
[0068] Data were analyzed using SPSS 23.0. Quantitative data are expressed as mean ± standard deviation. Independent samples t-tests were used for comparisons between two groups, and one-way ANOVA was used for comparisons among multiple groups. Pearson correlation tests were used for correlation analysis, and all statistical tests were two-tailed. A p-value < 0.05 was considered statistically significant.
[0069] Example 2
[0070] Results section:
[0071] 1. Differential gene expression analysis in synovial tissue of rheumatoid arthritis
[0072] Principal component analysis (PCA) of the transcriptome data showed a significant separation between the RA group and the control group, indicating a significant difference in gene expression profiles between the two groups. Figure 1 A). Differential gene expression analysis was performed using DESeq2, with a significance threshold set at P < 0.05 and |log2(Fold Change)| > 1. Genes with log2(Fold Change) > 1 were classified as upregulated genes, while those with log2(Fold Change) < -1 were considered downregulated genes. A total of 1123 differentially expressed genes (DEGs) were identified, of which 454 were upregulated genes and 669 were downregulated genes. Figure 1B, C). Gene Ontology (GO) enrichment analysis was performed on these DEGs. The results showed that in biological processes (BP), DEGs were mainly enriched in extracellular structural tissues, mitotic nuclear division, and extracellular matrix tissues; in cellular components (CC), they were enriched in the extracellular matrix, collagen-containing extracellular matrix, and condensed chromosome centromere regions; and in molecular functions (MF), they were enriched in glycosaminoglycan binding, extracellular matrix structural components, and heparin binding. Figure 1 D–F). Pathway analysis using the Kyoto Encyclopedia of Genetics and Genomes (KEGG) showed that DEGs were primarily enriched in pathways related to the cell cycle, PI3K-Akt signaling pathway, cellular senescence, ABC transporters, p53 signaling pathway, and Hippo signaling pathway. Figure 1 G).
[0073] Cross-analysis of m6A modification genes and mRNA in rheumatoid arthritis
[0074] To investigate the role of RNA m6A modification in RA, differential m6A methylation patterns in PBMCs from 5 RA patients and 5 healthy controls were first analyzed using the publicly available dataset GSE193913. By setting thresholds |Fold Change|>1.5 and P<0.05, 262 significantly hypermethylated and 397 significantly hypomethylated m6A peaks were found in RA patients compared to healthy controls. Volcano plots illustrate these differences. Figure 2 A). Meanwhile, mRNA expression analysis revealed 797 upregulated genes and 457 downregulated genes in RA PBMCs, as shown by volcano plots and heatmaps ( Figure 2 B, C). Subsequently, an intersection analysis was performed between m6A-modified genes (DMGs) and DEGs, revealing 323 overlapping genes (B, C). Figure 2 D, E). To elucidate the biological significance of these overlapping genes, GO and KEGG pathway enrichment analyses were performed. GO analysis showed that these genes were mainly enriched in biological processes such as platelet degranulation, hemostasis, and blood coagulation (BP); in terms of cellular components (CC), they were mainly located in secretory granular cavities, cytoplasmic vesicle cavities, and vesicle cavities; in terms of molecular function (MF), they were significantly enriched in cyclosporine A binding, enzyme inhibitory activity, and protein serine / threonine kinase inhibitory activity (…). Figure 2 F). KEGG pathway analysis further revealed that these overlapping genes are significantly involved in key pathways including phagocytosis, the PI3K-Akt signaling pathway, cellular senescence, the FoxO signaling pathway, the TGF-β signaling pathway, and Th17 cell differentiation. Figure 2 These results indicate that genes co-regulated by m6A modification and transcriptional changes play a crucial role in immune responses, cellular homeostasis, and the pathogenesis of rheumatoid arthritis (RA).
[0075] 3. The m6A-modified gene GAS6 drives phagocytosis by phagocytes through the MERTK / AXL pathway.
[0076] Based on the intersection analysis of m6A-modified genes and mRNA-seq data, the GSE193913 dataset was downloaded from the GEO database, and differentially expressed genes (DEGs) were identified. Comparison with the DEGs in the mRNA-seq data revealed five commonly upregulated genes and five commonly downregulated genes. Figure 3 A). Among them, GAS6 showed the most significant difference in the m6A modification analysis (P=2.17256E-08). Further validation using the GSE181614 dataset revealed that GAS6 was significantly upregulated in the RA samples ( Figure 3 B). A query of the KEGG database shows that GAS6 is involved in the phagocytic pathway ( Figure 3 C). Pathway mapping and protein-protein interaction (PPI) network analysis showed that GAS6 has strong interactions with the AXL, MERTK, and TYRO3 genes. Figure 3 D).
[0077] Differential expression of GAS6 and MERTK in patients with rheumatoid arthritis and their clinical relevance
[0078] This invention aims to explore the roles of GAS6 and MERTK in the pathogenesis of rheumatoid arthritis (RA), focusing on analyzing their expression levels and their clinical relevance to inflammatory markers and disease activity. PBMCs and blood samples from RA patients and healthy controls (HC) were analyzed using qRT-PCR and ELISA. Figure 4 AB). The results showed that the expression levels of GAS6, MERTK, IL-1β, IL-6, and TGF-β1 were significantly increased in RA patients (P<0.001), while the expression level of IL-10 was significantly decreased (P<0.001). Western blot analysis further confirmed the upregulation of GAS6 and MERTK proteins in RA patients (AB). Figure 4 D), where the upregulation of GAS6 was more significant than that of MERTK (P<0.1, P<0.01). Correlation analysis showed that GAS6 expression in RA patients was positively correlated with MERTK, ESR, CRP, CCP, DAS28, IL-1β, IL-6, and TGF-β1 (P<0.05, P<0.01), and negatively correlated with IL-10 (P<0.01). Furthermore, MERTK expression levels were positively correlated with CCP, DAS28, IL-6, and TGF-β1 (P<0.05), and negatively correlated with IL-10 (P<0.05). Figure 4C). ROC curve analysis showed that GAS6 had a higher predictive accuracy for disease activity (AUC=0.889, P<0.001), while MERTK had a lower predictive value (AUC=0.667, P=0.120). Figure 4 (E), indicating that GAS6 is a more reliable biomarker for RA disease activity. These results suggest that both GAS6 and MERTK are involved in the pathogenesis of RA, and that GAS6 is strongly correlated with inflammatory markers and disease activity, suggesting that it may be a potential biomarker for the severity of RA.
[0079] 5. The role of GAS6 in the proliferation, inflammation and gene expression of synovial fibroblasts in rheumatoid arthritis
[0080] To elucidate the functional role of GAS6 in RA-FLS, a comprehensive analysis of cell proliferation, cytokine secretion, and gene and protein expression was performed. CCK-8 assay results showed that the biological activity of RA-FLS was significantly higher than that of normal FLS (P<0.001), and siRNA-mediated GAS6 knockdown significantly inhibited RA-FLS proliferation (P<0.001). Figure 5 A) indicates that GAS6 has a proliferative effect. ELISA analysis of the culture supernatant showed that the absence of GAS6 significantly reduced the secretion of pro-inflammatory cytokines IL-6, IL-1β, and TGF-β1 (P<0.001), while significantly increasing the secretion of the anti-inflammatory cytokine IL-10 (P<0.001). Figure 5 B). At the transcriptional level, qRT-PCR results showed that silencing GAS6 significantly downregulated the mRNA expression of MERTK, TGF-β1, ERK1, and ERK2 (P<0.01, P<0.001). Figure 5 C). Western blot analysis further confirmed the corresponding decrease in protein levels; GAS6 knockdown significantly reduced the expression of GAS6, MERTK, TGF-β1, and ERK (P<0.05, P<0.01, P<0.001). Figure 5 D). These results suggest that GAS6 enhances the pathogenic phenotype of RA-FLS by activating the MERTK / ERK / TGF-β1 signaling pathway, while promoting synovial cell proliferation and the production of pro-inflammatory cytokines and inhibiting IL-10 secretion.
[0081] 6. GAS6 regulates TGF-β1 expression and cell migration in RA-FLS
[0082] Immunofluorescence staining was performed to assess the expression of GAS6 and TGF-β1 in normal FLS, RA-FLS, RA-FLS+siRNA-GAS6, and RA-FLS+siRNA-GAS6+siRNA-NC. The results showed that the fluorescence intensity of GAS6 and TGF-β1 was significantly enhanced in RA-FLS compared to normal FLS (P<0.001), indicating significant upregulation in disease cells. Silencing GAS6 significantly reduced the fluorescence signal of both proteins (P<0.001). Figure 6 A). These results indicate that GAS6 positively regulates TGF-β1 expression in RA-FLS. To assess the functional consequences of this regulation, a scratch wound assay was performed to evaluate cell migration. The migration rate of RA-FLS was significantly higher than that of normal FLS (P<0.001), consistent with the characteristics of an activated phenotype. GAS6 knockdown significantly inhibited migration (P<0.001). Figure 6 B). In summary, these results indicate that GAS6 enhances TGF-β1 expression and migration in RA-FLS, suggesting that GAS6 acts as a positive regulator of synovial cell activation and is involved in the pathogenesis of RA.
[0083] 7. MERTK regulates the proliferation and inflammatory signaling of RA-FLS.
[0084] The function of MERTK in RA-FLS was investigated by evaluating its cellular bioactivity, inflammatory cytokine secretion, and key signaling molecules. CCK-8 assays showed that RA-FLS proliferation was significantly higher than that of normal FLS (P<0.001). MERTK knockdown significantly reduced the bioactivity of RA-FLS (P<0.001). Figure 7 A). ELISA analysis showed that RA-FLS secreted significantly higher levels of IL-1β and IL-6 than normal FLS (P<0.001), while IL-10 secretion was lower (P<0.001). These changes were reversed to control levels after MERTK knockdown (P<0.001). TGF-β1 expression partially recovered after MERTK knockdown (P<0.01). Figure 7 B). qRT-PCR analysis showed that the mRNA levels of MERTK, FAK, CRK, DOCK1, AXL, and Rac1 in RA-FLS were significantly higher than those in the control group (P<0.05, P<0.01, P<0.001), while the expression of these genes was significantly downregulated after MERTK knockdown (P<0.05, P<0.01, P<0.001). Figure 7C). Western blotting showed that the protein expression of MERTK and its downstream molecules was significantly increased in RA-FLS (P<0.001), while the expression of these proteins was significantly decreased after MERTK knockdown (P<0.05, P<0.01, P<0.001). Figure 7 D). These results combined indicate that MERTK promotes the proliferation and inflammatory phenotype of RA-FLS, while its inhibition effectively attenuates these pathogenic processes.
[0085] 8. MERTK knockdown upregulates reversal protein and promotes apoptosis in RA-FLS.
[0086] To investigate the effects of MERTK knockdown on the expression of AXL, DOCK1, MERTK, and Rac1 proteins, as well as apoptosis in RA-FLS patients, immunofluorescence staining and flow cytometry analysis were performed. Immunofluorescence results showed that the relative mean fluorescence density of AXL, DOCK1, MERTK, and Rac1 in the RA-FLS group was significantly higher than that in the FLS group (P<0.001). In contrast, MERTK knockdown significantly reduced the expression of these proteins (P<0.001). Figure 8 A). These results indicate that MERTK knockdown reversed the upregulation of these proteins in RA-FLS, suggesting a role for MERTK in regulating their expression. In apoptosis studies, flow cytometry showed that the apoptosis rate in RA-FLS was significantly lower than that in FLS (P<0.01), while MERTK knockdown significantly increased the apoptosis rate in RA-FLS (P<0.05). Figure 8 B). These results combined indicate that MERTK knockdown promotes apoptosis in RA-FLS, suggesting that MERTK may inhibit the apoptosis pathway.
Claims
1. A novel application of the m6A-modified gene GAS6 and its receptor MERTK in rheumatoid arthritis, characterized by, By mediating abnormal activation of the GAS6 / MERTK signaling axis, it promotes synovial cell proliferation and inflammatory response, thereby driving disease progression.
2. The novel use of the m6A-modified gene GAS6 and its receptor MERTK in rheumatoid arthritis as described in claim 1, characterized in that, The m6A-modified gene GAS6 drives phagocytosis by phagocytes through the MERTK / AXL pathway.
3. The novel use of the m6A-modified gene GAS6 and its receptor MERTK in rheumatoid arthritis as described in claim 1, characterized in that, GAS6 knockdown significantly reduced the expression of MERTK, TGF-β1, and ERK, inhibited synovial cell proliferation and the production of pro-inflammatory cytokines, while increasing IL-10 secretion. By activating the MERTK / ERK / TGF-β1 signaling pathway, it suppressed the pathogenic phenotype of RA-FLS.
4. The novel use of the m6A-modified gene GAS6 and its receptor MERTK in rheumatoid arthritis as described in claim 1, 2, or 3, characterized in that, Preparations that inhibit or interfere with the expression of the m6A-modified gene GAS6 can be used in the preparation of targeted therapies for rheumatoid arthritis.
5. The novel use of the m6A-modified gene GAS6 and its receptor MERTK in rheumatoid arthritis as described in claim 1, 2, or 3, characterized in that, Formulas that detect the expression level of the m6A-modified gene GAS6 can be used in the preparation of targeted diagnostic formulas for rheumatoid arthritis.