Use of a tar a inhibitor in the manufacture of an antibacterial potentiator for enhancing the efficacy of a beta-lactam antibiotic against a methicillin-resistant staphylococcus aureus infection
Virtual screening technology was used to discover that norzelamin, as a TarA protein inhibitor, solved the resistance of MRSA to β-lactam antibiotics, significantly enhanced the antibacterial effect, and provided a new drug combination for the treatment of MRSA, which has important clinical application prospects.
Patent Information
- Application Number
- CN202610589405.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-30
- Publication Date
- 2026-06-02
AI Technical Summary
Methicillin-resistant Staphylococcus aureus (MRSA) is resistant to β-lactam antibiotics. Existing treatment strategies are costly and easily induce resistance, and there is a lack of effective TarA protein target inhibitors.
Virtual screening technology was used to discover that norzelamin, as a TarA protein inhibitor, can enhance the antibacterial effect of β-lactam antibiotics when used in combination. By inhibiting TarA protein function, it reduces the synthesis of teichoic acid and reverses the resistance of MRSA.
It significantly enhanced the antibacterial activity of β-lactam antibiotics against MRSA, reduced the bacterial load in the lungs, alleviated the level of inflammatory factors, and improved histopathological damage, providing a new synergistic treatment strategy and candidate compounds.
Smart Images

Figure CN122124065A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, and in particular to the application of TarA inhibitors in the preparation of antibacterial potentiators for enhancing the efficacy of β-lactam antibiotics against methicillin-resistant Staphylococcus aureus infections. Background Technology
[0002] Staphylococcus aureus is an important zoonotic pathogen that can cause a variety of serious infections, including pneumonia, sepsis, and mastitis. Currently, clinical treatment still heavily relies on antibiotics. However, the emergence and prevalence of methicillin-resistant Staphylococcus aureus (MRSA) has led to widespread resistance to β-lactam antibiotics, often exhibiting multidrug resistance, which severely limits treatment options. Last-line drugs such as vancomycin and linezolid not only have significant toxic side effects, but also face the continuous emergence of resistant strains, posing a persistent threat to public health. Therefore, exploring novel treatment strategies for MRSA is crucial.
[0003] Traditional antibiotic development faces challenges such as long development cycles, high costs, and the potential to induce drug resistance. Natural products, due to their structural diversity and multiple biological activities, have become an important resource for antibacterial drug development. Compared to monotherapy, combining natural products with existing antibiotics is considered a promising synergistic treatment strategy. This strategy can reverse or delay the development of bacterial resistance through multi-target action, and its development cost is relatively low, providing a new approach to controlling drug-resistant bacteria.
[0004] Wall teichoic acid (WTA) is an amphoteric polymer covalently linked to peptidoglycan in the cell wall of Staphylococcus aureus, and is one of the most abundant components of its cell wall. WTA biosynthesis begins at the cell membrane, produced by… tar The gene clusters catalyze the process sequentially. Currently, the development of antibacterial synergists targeting the TarA protein is still lacking, especially TarA protein-specific inhibitors derived from natural products, which have not yet been reported.
[0005] Drug development is a costly and time-consuming process. Virtual drug screening technology based on receptor structure can predict compound activity by simulating the interaction between target proteins and compounds, thereby reducing the blind spots in drug development and effectively lowering R&D costs and timelines. Therefore, this invention aims to utilize virtual screening technology, targeting the TarA protein, to screen high-throughput natural product databases, with the goal of discovering natural compounds that can inhibit TarA protein function and thus enhance the efficacy of β-lactam antibiotics against methicillin-resistant Staphylococcus aureus (MRSA) infections, providing candidate molecules for innovative drug development. Summary of the Invention
[0006] The purpose of this invention is to provide the application of TarA inhibitors in the preparation of antibacterial potentiators for enhancing the efficacy of β-lactam antibiotics against methicillin-resistant Staphylococcus aureus (MRSA) infections, thereby addressing the problem of MRSA resistance to β-lactam antibiotics in existing technologies. This invention has found that norzelaminaraldehyde can serve as an effective inhibitor of the TarA protein, significantly improving the efficacy of β-lactam antibiotics in MRSA infection models. This provides a novel antibacterial potentiator for treating MRSA-resistant bacterial infections, demonstrating significant clinical application prospects and development value.
[0007] To achieve the above objectives, the present invention provides the following solution: This invention provides the use of a celloteichoic acid synthase TarA inhibitor in the preparation of a drug potentiator for enhancing the efficacy of β-lactam antibiotics in the prevention and / or treatment of methicillin-resistant Staphylococcus aureus infections.
[0008] Optionally, the cell wall teichoic acid synthase TarA inhibitor includes norzelaminaraldehyde; The β-lactam antibiotics include one or more of amoxicillin, cefuroxime sodium, cefoxitin, ceftiofur sodium, cefotaxime sodium, and meropenem.
[0009] More preferably, the methicillin-resistant Staphylococcus aureus infection is pneumonia.
[0010] This invention provides a drug potentiator for enhancing the prophylactic and / or therapeutic effects of β-lactam antibiotics against methicillin-resistant Staphylococcus aureus infections, the drug potentiator comprising a teratogenase TarA inhibitor and pharmaceutically acceptable excipients.
[0011] Optionally, the cell wall teichoic acid synthase TarA inhibitor includes norzelaminaraldehyde; The β-lactam antibiotics include one or more of amoxicillin, cefuroxime sodium, cefoxitin, ceftiofur sodium, cefotaxime sodium, and meropenem.
[0012] This invention provides the use of a tarA inhibitor of teichoic acid synthase in the preparation of a drug for reversing the resistance of methicillin-resistant Staphylococcus aureus (MRSA) to β-lactam antibiotics.
[0013] Optionally, the cell wall teichoic acid synthase TarA inhibitor includes norzelaminaraldehyde; The β-lactam antibiotics include one or more of amoxicillin, cefuroxime sodium, cefoxitin, ceftiofur sodium, cefotaxime sodium, and meropenem.
[0014] This invention provides a drug for reversing methicillin-resistant Staphylococcus aureus (MRSA) resistance to β-lactam antibiotics, the drug comprising a teratoteichoic acid synthase TarA inhibitor and pharmaceutically acceptable excipients.
[0015] Optionally, the cell wall teichoic acid synthase TarA inhibitor includes norzelaminaraldehyde; The β-lactam antibiotics include one or more of amoxicillin, cefuroxime sodium, cefoxitin, ceftiofur sodium, cefotaxime sodium, and meropenem.
[0016] The present invention provides a medicament for the prevention and / or treatment of methicillin-resistant Staphylococcus aureus infection, the medicament comprising a teratogenase TarA inhibitor and a β-lactam antibiotic.
[0017] Optionally, the cell wall teichoic acid synthase TarA inhibitor includes norzelaminaraldehyde; The β-lactam antibiotics include one or more of amoxicillin, cefuroxime sodium, cefoxitin, ceftiofur sodium, cefotaxime sodium, and meropenem.
[0018] The present invention discloses the following technical effects: This invention focuses on TarA protein, the target of teichoic acid synthesis in the walls of Staphylococcus aureus. Through virtual screening, norzelaminaldehyde was identified as an effective TarA protein inhibitor from a natural product library. This compound significantly enhances the antibacterial activity of β-lactam antibiotics against methicillin-resistant Staphylococcus aureus (MRSA), and norzelaminaldehyde exhibits a synergistic effect when used in combination with multiple β-lactam antibiotics (graded inhibition concentration index <0.5). In vivo experiments showed that in a mouse model of MRSA-induced pneumonia, compared with antibiotic monotherapy (50 mg / kg), the combined use of norzelaminaldehyde (12.5 mg / kg) significantly reduced bacterial load in the lungs, alleviated inflammatory factor levels, and improved histopathological damage, confirming its clear antibacterial synergistic effect. This invention provides a novel synergistic treatment strategy and candidate compounds for overcoming MRSA resistance in clinical practice. It also provides new antibacterial synergistic raw materials for developing natural compounds that target the TarA protein and enhance the efficacy of β-lactam antibiotics against methicillin-resistant Staphylococcus aureus infections, and has significant clinical application prospects and development value. Attached Figure Description
[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0020] Figure 1 This is a statistical graph showing the effects of physalicylate, norzelamin, betaine, rosalicylate, oleanolic acid, and hederone on the viability of RAW264.7 cells; among them, compared with the control group, ns P >0.05, P <0.1, P <0.01, P <0.001, P <0.0001; Figure 2 For norzelaminaraldehyde, oleanolic acid, and hederidine tarA Statistical graph showing the effects of gene expression and teichoic acid content; among them, compared with the control group, ns P >0.05, P <0.1, P <0.01, P <0.001, P <0.0001; Figure 3 The graded antimicrobial concentration index for the combined use of norzelaminaraldehyde with different types of β-lactam antibiotics; Figure 4 This is a statistical graph showing the effect of different treatment groups on the number of bacterial colonies in the lungs of mice; among them, compared with the control group, ns P >0.05, P <0.1, P <0.01, P <0.001, P <0.0001; Figure 5 Pathological microscopic observation of the effects of different treatment groups on lung tissue in a mouse pneumonia model; Figure 6This is a statistical graph showing the effect of different treatment groups on serum inflammatory factor levels in a mouse pneumonia model; among them, compared with the control group, ns P >0.05, P <0.1, P <0.01, P <0.0001. Detailed Implementation
[0021] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0022] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0023] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0024] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0025] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0026] Example 1: Molecular docking and screening of candidate small molecule compounds Using receptor-based virtual drug screening technology with TarA protein as the drug target, AutodockVina software was used to perform molecular docking with a commercial compound database containing approximately 1 million small molecules (provided by Shanghai Taoshu Biotechnology Co., Ltd.) to screen for potential inhibitors. The high-throughput screening steps are as follows: (1) Obtain and prepare target protein PDB files that meet the modeling requirements; (2) Perform molecular docking calculations and analyze and evaluate the results based on docking scores and interaction modes.
[0027] Taking into account factors such as docking scores, pharmacological activity, and research costs, six candidate compounds with high scores were initially screened: *Platycoside*, *Desmethylzelamin*, *Bessenoside*, *Rossaberin*, *Oleanene*, and *Hederone*. The structural formulas and corresponding molecular docking energies of each candidate compound are shown in Table 1.
[0028] Table 1. Structural formulas and binding energies of candidate compounds Example 2: Toxicity of candidate compounds on RAW264.7 cells 1. Drug treatment RAW264.7 cells were planted at a density of 1 × 10⁶ cells per well. 4 Cells were seeded at a density of [number] cells per well in 96-well plates and cultured in a cell culture incubator until cell confluence reached 70%-80%. Subsequently, 2 μL of candidate compound solutions at different concentrations were added to each well for 24 hours. The final concentration gradients of each candidate compound were set to 0, 6.25, 12.5, 25, and 50 μmol / L.
[0029] 2. CCK-8 assay for cytotoxicity Cell viability was assessed 24 hours after drug treatment. CCK-8 reagent was diluted with DMEM basal medium at a 1:10 volume ratio, and 100 μL of the diluted reagent was added to each well. The 96-well plate was incubated at 37°C with 5% CO2 for 1 hour, and then the absorbance of each well was measured at 450 nm using a microplate reader.
[0030] Cell viability (%) = (Experimental group OD) 450 - Blank group OD 450 ) / (Control group OD 450 - Blank group OD 450 )×100.
[0031] 3. Results like Figure 1As shown, at a concentration of 50 μmol / L, norzelamin, oleanolic acid, and hederonein exhibited low cytotoxicity against RAW264.7 cells. In contrast, styracil, betaine, and rosalidin showed strong cytotoxicity at a concentration of 25 μmol / L.
[0032] Example 3 Candidate compound pairs tarA Effects of gene expression and parietoteichoic acid content 1. Drug treatment The MRSA USA300 strain, in its logarithmic growth phase, was inoculated into liquid culture medium, and the bacterial concentration was adjusted to 1×10⁻⁶. 8 CFU / mL, were added to a final concentration of 4 μg / mL of norzelamin, oleanolic acid and hederagen, and cultured in a shaker at 37°C for 24 hours.
[0033] 2. tarA Gene (accession number: CP155452.1) transcriptional level detection (1) Bacterial lysis: Centrifuge to collect the drug-treated bacteria, resuspend the precipitate with 100 μL of lysozyme, and incubate in a water bath at 37°C for 2 hours.
[0034] (2) RNA extraction: Total bacterial RNA was extracted using the Vazyme RNA Extraction Kit RC112 according to the instructions.
[0035] (3) RNA quality detection: Take 1 μL of RNA sample and determine the concentration and A using a spectrophotometer. 260 / A 280 The ratio is considered acceptable if it is between 1.8 and 2.0.
[0036] (4) cDNA synthesis: The qualified total RNA was reverse transcribed into cDNA using the Vazyme III RT SuperMix for qPCR (+gDNA wiper) reverse transcription kit.
[0037] (5) RT-qPCR detection: synthesized by Sangon Biotech (Shanghai) Co., Ltd. tarA16S RNA-specific primers for the gene and internal reference gene (TarA-F: GTGAATTACGCGACGACACATC, SEQ ID NO.1; TarA-R: ATACGATGCGCTAGAGGTTGC, SEQ ID NO.2; 16S RNA-F: CGTGCTACAATGGACAATACAAA, SEQ ID NO.3; 16S RNA-R: ATCTACGATTACTAGCGATTCCA, SEQ ID NO.4) were used. Amplification was performed using 2×Universal SYBR Green Fast qPCR Mix reagent from Ibotek on a real-time quantitative PCR instrument. After the reaction, amplification specificity was confirmed by analyzing the amplification curve and melting curve, and the Ct value of each sample was recorded. 2 -ΔΔCt Method calculation tarA The relative expression level of genes.
[0038] The calculation formula is: Folds = 2 -ΔΔCt , ΔΔCt=(Ctl-Ct2)-(Ct3-Ct4); Wherein, Ct1: critical cycle number of the gene to be tested in the treated sample; Ct2: critical cycle number of the housekeeping gene in the treated sample; Ct3: critical cycle number of the gene to be tested in the control sample; Ct4: critical cycle number of the housekeeping gene in the control sample; 2 -ΔΔCt This indicates the fold change in the expression level of the target gene in the experimental group relative to the control group.
[0039] 3. Determination of cell wall teichoic acid content (1) Buffer preparation: Buffer 1: 50 mM MES, pH 6.5; Buffer 2: 50 mM MES, pH 6.5, 4% (w / v) SDS; Buffer 3: 50 mM MES, pH 6.5, 2% (w / v) NaCl; Buffer 4: 20 mM Tris-HCl, pH 8.0, 0.5% (w / v) SDS.
[0040] (2) Extraction of teichoic acid from bacterial cell walls: The bacterial culture obtained after drug treatment was centrifuged (7000×g, 10 min), and the precipitate was resuspended in 4 mL of buffer 1 to obtain resuspension 1; resuspension 1 was centrifuged (7000×g, 10 min), and the precipitate was resuspended in 4 mL of buffer 2 and incubated in boiling water for 1 hour to obtain resuspension 2; resuspension 2 was centrifuged (7000×g, 10 min), and the particles were resuspended in 1 mL of buffer 2 to obtain resuspension 3; resuspension 3 was centrifuged (16000×g, 5 min), and the particles were resuspended in 1 mL of buffer 2. Resuspension 4 was obtained by centrifuging 1 mL of buffer 2 (16000×g, 5 min); resuspension 4 was centrifuged (16000×g, 5 min), and then the particles were resuspended in 1 mL of buffer 3 to obtain resuspension 5; resuspension 5 was centrifuged (16000×g, 5 min), and then the particles were resuspended in 1 mL of buffer 1 to obtain resuspension 6; resuspension 6 was centrifuged (16000×g, 5 min), and then the particles were resuspended in 1 mL of buffer 4, 4 μL of proteinase K solution was added, and the mixture was incubated at 50 °C with shaking for 4 h to obtain resuspension 7; resuspension 7 was centrifuged (16000×g, 5 min), and then the particles were resuspended in 1 mL of buffer 3 to obtain resuspension 8; resuspension 8 was centrifuged (16000×g, 5 min), washed three times with distilled water, and then the particles were resuspended in 1 mL of buffer 3. The solution was cultured in mL of sodium hydroxide hydrolysis solution at 25°C with shaking for 16 hours to obtain resuspension 9; after centrifugation of resuspension 9 (16000×g, 10 minutes), the supernatant containing extractable WTA was collected.
[0041] (3) Content determination: The molybdenum blue method was used. A standard curve was prepared using phosphate standards. The extracted cell wall teichoic acid samples were treated in the same way, and the absorbance was measured at a wavelength of 630 nm using an enzyme-linked immunosorbent assay (ELISA) reader. The phosphate concentration in the samples was calculated based on the standard curve to reflect the relative content of cell wall teichoic acid.
[0042] 4. Results like Figure 2 As shown, compared with the control group, the MRSA USA300 strain treated with demethylzelamyl aldehyde had... tarA Both mRNA transcription levels and piezotetrachiic acid content were significantly downregulated. No significant changes were observed in the oleanolic acid and hederone treatment groups. These results indicate that, among the three compounds tested, only norzelamin can effectively inhibit [the gene's activity]. tarA It reduces gene expression and decreases the biosynthesis of its downstream product, teichoic acid.
[0043] Example 4 Effect of norzelaminaraldehyde on the anti-MRSA activity of β-lactam antibiotics 1. Preparation of bacterial culture Single colonies were picked from the MRSA USA300 strain plate and inoculated into TSB liquid medium, and cultured with shaking at 37 °C and 200 rpm until the mid-logarithmic growth phase. The bacterial suspension concentration was adjusted to approximately 5×10 5 CFU / mL with normal saline to obtain the working bacterial suspension for experiments.
[0044] 2. Determination of fractional inhibitory concentration index by checkerboard method (1) Drug dilution: In a 96-well plate, β-lactam antibiotics (amoxicillin, cefuroxime sodium, cefoxitin, cefotaxime sodium, meropenem) were serially diluted 2-fold along the vertical axis. At the same time, demethylzeylasteral was serially diluted 2-fold along the horizontal axis. The final drug volume in each well was 50 μL, thus forming a matrix of drug combinations with different concentrations.
[0045] (2) Inoculation: 100 μL of the working bacterial suspension was added to each drug well to make the final volume in each well 200 μL, and the final bacterial suspension concentration was approximately 2.5×10 5 CFU / mL. Growth control wells without drugs and blank control wells without bacteria were set up.
[0046] (3) Culture and reading: The 96-well plate was placed in an incubator at 37 °C and incubated statically for 18 - 24 hours. After the incubation, the absorbance of each well at a wavelength of 600 nm was measured using an enzyme-labeled instrument.
[0047] (4) MIC determination: The lowest drug concentration with an OD value increase ≤ 10% compared to the growth control wells was taken as the minimum inhibitory concentration of the drug under this condition.
[0048] (5) Calculation of FIC index: Calculate according to the formula FIC index = (MIC of demethylzeylasteral in combination / MIC of demethylzeylasteral alone) + (MIC of antibiotic in combination / MIC of the single antibiotic). Judgment criteria: FIC index ≤ 0.5 indicates synergistic effect; 0.5 < FIC index ≤ 1 indicates additive effect; 1 < FIC index ≤ 2 indicates no relevant effect; FIC index > 2 indicates antagonistic effect.
[0049] 3. Results The results of the checkerboard test are as Figure 3 shown. When demethylzeylasteral was combined with various β-lactam antibiotics such as amoxicillin, cefuroxime sodium, cefoxitin, cefotaxime sodium, cefotaxime sodium, meropenem, the FIC index for the MRSA USA300 strain was less than 0.5, indicating a significant synergistic antibacterial effect between demethylzeylasteral and these antibiotics.
[0050] Example 5 Evaluation of the efficacy of demethylzeylasteral combined with cefotaxime sodium in a murine pneumonia model of MRSA infection 1. Establishment of animal model and experimental grouping BALB / c mice aged 6-8 weeks, weighing 18-20g, and of equal sex, were intranasally inoculated with 1.0 × 10⁻⁶ ppm. 7 A mouse pneumonia model was established using CFU-MRSAUSA300 bacterial suspension. Twenty-four hours after infection, mice were randomly divided into four groups and treated with the medication via intramuscular injection every 12 hours for five consecutive days.
[0051] Model control group (saline group): saline; Norzemarin monotherapy: 12.5 mg / kg; Cefotaxime sodium monotherapy group: 50 mg / kg; Combined therapy: Cefotaxime sodium 50 mg / kg + norzelaminaraldehyde 12.5 mg / kg; Each group of BALB / c mice contains 10 mice, half male and half female.
[0052] 2. Efficacy evaluation indicators Lung tissue was collected from mice on days 1, 5, and 10 after the start of treatment. A portion of the lung tissue was homogenized, diluted, and spread onto agar plates. After incubation, colony-forming units were counted to assess the bacterial load in the lungs.
[0053] Blood samples were collected from mice on days 5 and 10 of treatment. After centrifugation at 3000 rpm for 5 minutes, serum was collected. The levels of inflammatory factors IL-1β, IL-6, and TNF-α in the serum were detected using a commercially available ELISA kit (Enzyme Immunosorbent Assay Biotech).
[0054] After treatment, mouse lung tissue was taken for paraffin embedding, sectioning, and hematoxylin-eosin staining. Pathological changes in the lung tissue were observed under an optical microscope to assess the degree of inflammatory cell infiltration and tissue damage.
[0055] 3. Results (1) Effect of clearing bacteria from the lungs: such as Figure 4 As shown, on days 1, 5, and 10 of treatment, the bacterial load in the lungs of mice in the combined treatment group was significantly lower than that in the model control group. Furthermore, on days 1, 5, and 10 of treatment, the antibacterial effect of the combined treatment group was significantly better than that of the two single-drug treatment groups.
[0056] (2) Pathological observation of lung tissue: such as Figure 5 As shown, H&E staining results revealed extensive inflammatory cell infiltration and significant pathological damage in the lung tissue of the model control group mice. The degree of inflammatory infiltration and pathological damage in the lung tissue of the combined treatment group mice was significantly reduced compared to both the model control group and the single-drug treatment group.
[0057] (3) Systemic inflammation level: such as Figure 6As shown, ELISA results indicated that on days 5 and 10 of treatment, the serum levels of inflammatory factors IL-1β, IL-6, and TNF-α in the combined treatment group were significantly lower than those in the model control group.
[0058] The above experimental results demonstrate that the TarA inhibitor norzelaminaldehyde described in this invention can effectively inhibit the biosynthesis of piezotetrachiic acid in MRSA, significantly enhancing the in vitro antibacterial activity of β-lactam antibiotics against methicillin-resistant Staphylococcus aureus. In a mouse pneumonia model infected with MRSA, its combination with cefotaxime sodium significantly reduced the bacterial load in the lungs, alleviated the inflammatory response, and improved histopathological damage. These findings confirm that targeting TarA and utilizing norzelaminaldehyde as an antibacterial synergist can effectively reverse the resistance of MRSA to β-lactam antibiotics, providing a novel synergistic treatment strategy and candidate compound for the clinical treatment of multidrug-resistant bacterial infections, and possessing significant development value and application prospects.
[0059] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. Application of TarA inhibitors of celloteichoic acid synthase in the preparation of drug potentiators for enhancing the efficacy of β-lactam antibiotics in the prevention and / or treatment of methicillin-resistant Staphylococcus aureus infections.
2. The application according to claim 1, characterized in that, The cell teichoic acid synthase TarA inhibitor includes norzelamin; The β-lactam antibiotics include one or more of amoxicillin, cefuroxime sodium, cefoxitin, cefotaxime sodium, ceftiofur sodium, and meropenem.
3. A drug potentiator for enhancing the efficacy of β-lactam antibiotics in the prevention and / or treatment of methicillin-resistant Staphylococcus aureus infections, characterized in that, The drug potentiators include TarA inhibitors of teichoic acid synthase and pharmaceutically acceptable excipients.
4. The drug synergist according to claim 3, characterized in that, The cell teichoic acid synthase TarA inhibitor includes norzelamin; The β-lactam antibiotics include one or more of amoxicillin, cefuroxime sodium, cefoxitin, ceftiofur sodium, cefotaxime sodium, and meropenem.
5. Application of TarA inhibitors of teichoic acid synthase in the preparation of drugs for reversing the resistance of methicillin-resistant Staphylococcus aureus (MRSA) to β-lactam antibiotics.
6. The application according to claim 5, characterized in that, The cell teichoic acid synthase TarA inhibitor includes norzelamin; The β-lactam antibiotics include one or more of amoxicillin, cefuroxime sodium, cefoxitin, ceftiofur sodium, cefotaxime sodium, and meropenem.
7. A drug for reversing methicillin-resistant Staphylococcus aureus (MRSA) resistance to β-lactam antibiotics, characterized in that, The drug comprises a TarA inhibitor of teichoic acid synthase and pharmaceutically acceptable excipients.
8. The medicament according to claim 7, characterized in that, The cell teichoic acid synthase TarA inhibitor includes norzelamin; The β-lactam antibiotics include one or more of amoxicillin, cefuroxime sodium, cefoxitin, ceftiofur sodium, cefotaxime sodium, and meropenem.
9. A drug for the prevention and / or treatment of methicillin-resistant Staphylococcus aureus (MRSA) infections, characterized in that, The drugs include TarA inhibitors of teichoic acid synthase and β-lactam antibiotics.
10. The medicament according to claim 9, characterized in that, The cell teichoic acid synthase TarA inhibitor includes norzelamin; The β-lactam antibiotics include one or more of amoxicillin, cefuroxime sodium, cefoxitin, ceftiofur sodium, cefotaxime sodium, and meropenem.