Application of siRNA in the preparation of antihypertensive agents

By designing siRNA with specific base modifications to target the ACE gene, an antihypertensive agent was prepared, which solved the problem of side effects of ACEI drugs and achieved the effect of effectively lowering blood pressure and reducing the frequency of medication.

CN122128304APending Publication Date: 2026-06-02QILU HOSPITAL(QINGDAO) CHEELOO COLLEGE OF MEDICINE SHANDONG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
QILU HOSPITAL(QINGDAO) CHEELOO COLLEGE OF MEDICINE SHANDONG UNIV
Filing Date
2026-03-09
Publication Date
2026-06-02

Smart Images

  • Figure CN122128304A_ABST
    Figure CN122128304A_ABST
Patent Text Reader

Abstract

This invention discloses the application of siRNA in the preparation of antihypertensive agents, belonging to the field of biomedical technology. By analyzing the mRNA sequences of human and rat angiotensin-converting enzyme (ACE), siRNA sequences for silencing ACE protein expression were designed, and unmodified siRNA and siRNA with introduced base modifications were synthesized. Both unmodified and base-modified siRNAs were transfected into human umbilical vein endothelial cells via liposomes. The silencing efficiency of the unmodified siRNA on the ACE gene was 83.42%, while that of the base-modified siRNA was 83.10%. Intravenous injection of both siRNAs into a hypertensive rat model effectively silenced ACE expression, reducing systolic and diastolic blood pressure. The stability of the base-modified siRNA was improved, which could prolong the duration of drug effect and reduce the frequency of administration.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and in particular relates to the application of siRNA in the preparation of antihypertensive agents. Background Technology

[0002] Hypertension is a disease characterized primarily by elevated systemic arterial blood pressure. It is a significant risk factor for coronary artery disease, stroke, and other conditions, impacting not only patients' quality of life but also imposing a heavy burden on society and families. The prevalence of hypertension in my country is showing a year-on-year upward trend. Statistics indicate that there are currently at least 200 million hypertension patients in my country, accounting for approximately one-fifth of the global population. As a major independent risk factor for cardiovascular and cerebrovascular events, the rising incidence of hypertension places a tremendous burden on individual health and social healthcare.

[0003] One important mechanism leading to essential hypertension is the overactivation of the renin-angiotensin-aldosterone system (RAAS). Excessive renin secretion by the glomeruli activates the liver to produce angiotensinogen, which further generates angiotensin I. Angiotensin I is then converted to angiotensin II by angiotensin-converting enzyme (ACE). Angiotensin II has a strong vasoconstrictive effect, increasing peripheral vascular resistance and raising blood pressure. ACE is widely present on vascular endothelial cell membranes and plays a crucial role in bradykinin degradation and angiotensin II production. Its gene polymorphism is closely related to blood pressure stability and smooth muscle cell proliferation. ACE inhibitors, such as pril-type drugs, are currently first-line antihypertensive drugs that increase arterial and venous blood flow, dilate blood vessels, and inhibit angiotensin II production. ACEIs inhibit angiotensin-converting enzyme, reducing angiotensin II (a potent vasoconstrictor), lowering peripheral vascular resistance, and thus reducing blood pressure. For example, clinical trial data for ACEIs such as captopril and lisinopril show that 10%–20% of patients may experience cough, 2%–5% report taste abnormalities, and some patients may experience transient proteinuria, sinus tachycardia, and other side effects. It is important to note that pregnant and breastfeeding women should not use these drugs to avoid harm to the fetus and infant. Patients allergic to any of the ingredients in these drugs should not use them, as they may experience discomfort such as difficulty breathing, diarrhea, and generalized itching.

[0004] Small interfering RNA (siRNA) is a short double-stranded RNA molecule, typically composed of 20-25 nucleotides. It plays a crucial role in RNA interference (RNAi), efficiently and specifically silencing the expression of target genes. In recent years, siRNA drugs have become a research hotspot due to their significant efficacy, and several siRNA drugs have been marketed globally. Interfering with angiotensin-converting enzyme (ACE) expression levels using siRNA technology can effectively reduce the body's angiotensin II production, thereby lowering blood pressure and playing an important role in the treatment of hypertension. Identifying siRNA targets on ACE and designing them rationally holds promise for developing siRNA drugs to replace traditional oral ACE inhibitors, providing a new treatment option for patients intolerant to chemotherapy and serving as a complementary therapy for hypertension. Summary of the Invention

[0005] The purpose of this invention is to provide an application of siRNA in the preparation of antihypertensive agents, thereby utilizing siRNA to reduce the harm of hypertension.

[0006] To achieve the above objectives, the present invention provides the following technical solution: First, this invention provides the application of siRNA in the preparation of antihypertensive agents, wherein the nucleotide sequence of the positive strand of the siRNA is SEQ ID NO.1.

[0007] Furthermore, the nucleotide sequence of the siRNA antisense strand is SEQ ID NO.2.

[0008] Furthermore, the siRNA, when used as a short-acting formulation, is unmodified siRNA.

[0009] Furthermore, the siRNA, when used as a long-acting formulation, is a base-modified siRNA.

[0010] Secondly, the present invention provides a base-modified siRNA, wherein the base modification site of the siRNA is the introduction of 2'-OMe modification at the 20th and 21st bases of the positive strand.

[0011] Furthermore, the siRNA antisense strand has 2'-OMe modification at positions 1 and 2, and 2'-F modification at positions 4, 10, and 15.

[0012] The beneficial effects of this invention are as follows: By analyzing the mRNA sequences of angiotensin-converting enzyme (ACE) in humans and rats, siRNA sequences for silencing ACE protein expression were designed. Unmodified siRNA and siRNA with modified bases were synthesized. Both unmodified and modified siRNAs were transfected into human umbilical vein endothelial cells via liposomes. The silencing efficiency of the unmodified siRNA against the ACE gene was 83.42%, while that of the modified siRNA was 83.10%. Intravenous injection of both siRNAs into a hypertensive rat model effectively silenced ACE expression, reducing systolic and diastolic blood pressure. The modified siRNA showed improved stability, prolonging the duration of action and reducing the frequency of administration. The application of the siRNA provided by this invention in the preparation of antihypertensive agents offers a new direction for drug development for patients intolerant to ACE inhibitors. Attached Figure Description

[0013] Figure 1 The figure shows the results of the silencing efficiency test of ACE gene in human umbilical vein endothelial cells by siRNA. Figure 2 The figure shows the results of the experiment on the effect of siRNA on systolic blood pressure in hypertensive rats; Figure 3 The figure shows the results of the experiment on the effect of siRNA on diastolic blood pressure in hypertensive rats. Detailed Implementation

[0014] The following is a more detailed description of the present invention, illustrated by examples. It should be understood that these examples are merely illustrative of the invention and are intended to explain the principles and functions of the invention, and are not intended to limit the scope of protection of the invention.

[0015] Example 1: Design of angiotensin-converting enzyme (ACE) siRNA In order to design siRNA that can efficiently inhibit the translation of angiotensin-converting enzyme (ACE) mRNA into active angiotensin-converting enzyme, and at the same time evaluate the blood pressure-lowering effect of siRNA in a hypertensive rat animal model, siRNA that can silence the expression of angiotensin-converting enzyme in both humans and rats was designed. The *Homo sapiensangiotensin* converting enzyme 2 (ACE2) mRNA and *Mus musculus angiotensin* converting enzyme 2 (ACE2) gene sequences were retrieved from GenBank. Referring to sequences NM_001371415.1, NM_021804.3, NM_001386259.1, NM_001386260.1, NM_001388452.1, NM_001389402.1, NM_001012006.2, XM_039099654.2, XM_039099655.2, and AY881244.1, the designed siRNA sequence is as follows: Chain of Justice: 5'-GAAGACAATGAAACAGAAATA-3'; Antonym chain: 5'-TAUUUCUGUUUCAUUGUCUUCTT-3'.

[0016] The synthesis and purification were commissioned to Sangon Biotech (Shanghai) Co., Ltd.

[0017] To improve siRNA stability, reduce off-target effects, and lower immune responses, 2'-OMe modifications were introduced at bases 20 and 21 of the sense strand; 2'-OMe modifications were introduced at bases 1 and 2 of the antisense strand, and 2'-F modifications were introduced at bases 4, 10, and 15. The siRNA was synthesized and purified by Sangon Biotech (Shanghai) Co., Ltd.

[0018] Example 2: Effect of siRNA on the expression level of angiotensin-converting enzyme in human umbilical vein endothelial cells (1) Cell seeding: Human umbilical vein endothelial cells (HUVEC-T1) were seeded into 6-well plates, and 2 mL of a solution containing 1~2×10⁻⁶ cells was added to each well. 5 Cell culture medium was incubated at 37°C in a CO2 incubator until approximately 60% confluence was achieved. Four wells were also set up for a blank control (NC group), an unmodified siRNA group, and a base-modified siRNA group.

[0019] (2) Transfection solution preparation: Prepare the following two solutions in EP tubes: Solution A: Dilute the unmodified siRNA and the base-modified siRNA to a final concentration of 50 nM with 125 μL of Opti-MEM™ medium, and add 5 μL of P3000™ reagent and mix thoroughly. Solution B: Add 7.5 μL of Lipofectamine™ 3000 reagent to 125 μL of Opti-MEM™ medium and mix thoroughly. Gently mix solutions A and B and incubate at room temperature for 10-15 minutes to form siRNA liposome complexes.

[0020] (3) Transfection preparation: Wash the cells twice with 2 mL of serum-free DMEM culture medium, and then add 1 mL of serum-free DMEM culture medium.

[0021] (4) Transfection: Slowly add the siRNA liposome complex to the culture medium, shake well, and incubate at 37°C for 6 hours in a carbon dioxide incubator. Remove the serum-free transfection medium and replace it with DMEM + 10% FBS culture medium for continued culture.

[0022] (5) Culture conditions: Continue to culture in a 37°C, 5% CO2 incubator for 48 hours.

[0023] (6) Verification of mRNA silencing efficiency: Total RNA was extracted 48 hours after transfection (Trizol method). It was reverse transcribed into cDNA and ACE was performed using ACEf / ACEr primers. At the same time, GAPDH was performed using GAPDHf / GAPDHr primers for the internal reference gene GAPDH.

[0024] ACEf:TGATTACTCATTCATTCGAT; ACEr: TTGAGATGTCACATTTGTG.

[0025] GAPDHf: AGCAAGAGCACAAGAGGAAG; GAPDHr:TCTACATGGCAACTGTGAG.

[0026] (7) Calculate the silencing efficiency (ΔΔCt method, compared with negative control).

[0027] ΔCt experimental group = Ct target gene (experimental group) - Ct internal reference gene; ΔCtNC group = CtNC group - Ct internal reference gene; ΔCt=ΔCt experimental group ΔCtNC group; KD%=(1 2 ΔΔCt )×100%.

[0028] From Figure 1 The results showed that the silencing efficiency of unmodified siRNA against the ACE gene was 83.42%, and that of base-modified siRNA against the ACE gene was 83.10%. Both unmodified and modified siRNAs could achieve good silencing effects on the ACE gene, and there was no significant difference between them.

[0029] Example 3 Effect of siRNA on blood glucose level in diabetic model rats The primer siRNA was designed in the homologous region of human and rat ACE genes, and the effect of siRNA on blood glucose level could be evaluated in diabetic model rats.

[0030] (1) Thirty 3-month-old male spontaneously hypertensive rats with a body weight of (215±17) g were randomly divided into 3 groups of 10 rats each, namely the hypertensive model group (MC), the unmodified siRNA treatment group, and the base-modified siRNA treatment group. At the same time, 10 3-month-old male Wistar-Kyoto rats were used as the normal control group (NC). All rats were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., and the animal license number was SCXK(Beijing)2018-0027. The animal rearing environment: temperature 20-22 °C, 1 standard atmospheric pressure, relative humidity 50%-60%, 12 h∶12 h light-dark cycle, caged separately (2 rats / cage), with free access to food and water.

[0031] (2) The unmodified siRNA group and the base-modified siRNA group were intravenously injected with 100 μL of siRNA-liposome complex respectively. On the day of injection and every 2 days after injection at 9 am, a non-invasive blood pressure measuring instrument was used to measure the systolic and diastolic blood pressures of the tail arteries of rats in each group and record them.

[0032] From Figure 2 The results showed that the mean systolic blood pressure of the normal control group was within the range of 116±6 mm Hg during the entire experimental period; the systolic blood pressure of the hypertensive model group was within the range of 186±4 mm Hg; in the unmodified siRNA treatment group, the systolic blood pressure of rats dropped to 129.0 mm Hg on the second day after injection and to 121.67 mm Hg on the fourth day, reaching the normal level, and the antihypertensive effect lasted until the sixth day and started to rebound to abnormal blood pressure on the eighth day; in the base-modified siRNA treatment group, the systolic blood pressure of rats dropped to 139.33 mm Hg on the second day after injection and to 122.31 mm Hg on the fourth day, reaching the normal level, and the antihypertensive effect lasted until the twelfth day and started to rebound to abnormal blood pressure on the fourteenth day.

[0033] From Figure 3The results showed that the mean diastolic blood pressure in the normal control group was within the range of 90±4 mm Hg throughout the entire experimental period; the diastolic blood pressure in the hypertension model group was within the range of 100±4 mm Hg; in the unmodified siRNA treatment group, the diastolic blood pressure of rats decreased to 98.33 mm Hg on the second day after injection and to 91.67 mm Hg on the fourth day, reaching the normal level. The antihypertensive effect was maintained until the eighth day, and the blood pressure rebounded to abnormal levels on the tenth day; in the base-modified siRNA treatment group, the diastolic blood pressure of rats decreased to 93.0 mm Hg on the second day after injection and to 92.67 mm Hg on the fourth day, reaching the normal level. The antihypertensive effect was maintained until the twelfth day, and the blood pressure rebounded to abnormal levels on the fourteenth day.

[0034] It is evident that both the unmodified siRNA and the base-modified siRNA of this invention can effectively silence angiotensin-converting enzyme expression, and effectively reduce systolic and diastolic blood pressure in hypertensive model rats. The stability of the base-modified siRNA is improved, prolonging the antihypertensive effect and reducing the frequency of medication.

Claims

1. The application of siRNA in the preparation of antihypertensive agents, characterized in that, The nucleotide sequence of the sense strand of the siRNA is SEQ ID NO.1, and the nucleotide sequence of the antisense strand is SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, The siRNA is unmodified when used as a short-acting formulation.

3. The application according to claim 1, characterized in that, When the siRNA is used as a long-acting formulation, it is a base-modified siRNA. The base modification sites of the siRNA are: 2'-OMe modification is introduced at the 20th and 21st bases of the sense strand; 2'-OMe modification is introduced at the 1st and 2nd bases of the antisense strand; and 2'-F modification is introduced at the 4th, 10th and 15th bases.