Use of a pitx2 gene haplotype marker in identifying photoperiod sensitivity in rattus norvegicus
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
- Filing Date
- 2026-04-30
- Publication Date
- 2026-07-21
Smart Images

Figure CN122128444B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a... Pitx2 Application of gene haplotype markers in identifying photothermal sensitivity traits in brown rats. Background Technology
[0002] Brown rats, as one of the most widely distributed mammals globally, exhibit highly adaptive evolutionary characteristics. Driven by long-term natural selection pressures, different subspecies have developed differentiated reproductive strategies, which is one of the main factors contributing to population fluctuations. Among them, the Northeast subspecies inhabiting high-latitude regions (… R. n. caraco The brown rat has evolved a typical "seasonal reproductive strategy," adjusting its physiological state to cope with harsh seasonal climate fluctuations. Studies have confirmed that the Northeast Asian brown rat exhibits testicular development inhibition during autumn and winter (low temperatures and short light periods). This highly sensitive reproductive phenotype makes it an ideal model for studying the molecular mechanisms by which environmental factors regulate the mammalian reproductive cycle. However, the construction of traditional animal strains relies on long-term environmental induction and continuous phenotypic observation, which is not only time-consuming and costly but also highly susceptible to environmental interference, severely restricting the standardized breeding and application of specific animal models. Therefore, a deep understanding of the molecular mechanisms of reproductive regulation in the brown rat is crucial.
[0003] Pitx2 Paired-liked homodomain transcription factor 2 (PMC2), a member of the Paired-Bicoid homobox transcription factor family, is a downstream core target gene of the Wnt / β-catenin signaling pathway. Upon Wnt signaling activation, nuclear-bound β-catenin binds to TCF / LEF and directly induces… Pitx2 Transcription. During germ cell development, Pitx2 It plays a crucial role by transcriptionally activating Cyclin D1 / D2 to drive the G1 / S phase transition of the cell cycle and regulating the binding of Cyclin A1 to the CDK complex to promote the G2 / M phase transition, ultimately providing the molecular basis for spermatogenesis. Therefore, identification... Pitx2 By identifying key regulatory regions (SNPs) in genes and developing efficient genotyping technologies, we can not only fill the theoretical gap in the molecular regulation of seasonal reproduction, but also accelerate the process of precision breeding. Summary of the Invention
[0004] The purpose of this invention is to provide a Pitx2 The application of gene haplotype markers in identifying photothermosensitivity traits in brown rats addresses the problems existing in the prior art. This invention provides a method related to photothermosensitivity traits in brown rats. Pitx2The haplotype markers provided in this invention, using molecular markers and detection methods, can pinpoint the environmental response characteristics of brown rat individuals at the juvenile stage through genotyping. This overcomes the lag and environmental sensitivity issues inherent in traditional strain selection relying on phenotypic identification, significantly improving breeding efficiency and providing core technical support for constructing photothermal-sensitive brown rat strains with stable genetic characteristics. This invention can also assist in constructing a brown rat testicular development inhibition model. By accurately screening photothermal-sensitive individuals and developing personalized treatment plans, the construction speed of indoor testicular development inhibition models can be accelerated, reducing model construction costs.
[0005] To achieve the above objectives, the present invention provides the following solution: This invention provides Pitx2 The application of haplotype markers in identifying photothermal sensitivity traits in brown rats, the aforementioned Pitx2 The nucleotide sequence of the gene haplotype marker is shown in SEQ ID NO.3; polymorphisms exist at bases 168, 173, 188, 556, 609, 1001, 1051, 1058, and 1070 of the nucleotide sequence shown in SEQ ID NO.3; including two haplotypes with the base combinations ACCCTGTTG and GTTCGAGCG; When a brown rat is homozygous for the ACCCTGTTG haplotype, it is considered to be photothermally sensitive; when a brown rat is homozygous for the GTTCGAGCG haplotype, it is considered to be photothermally insensitive.
[0006] Furthermore, the method for identifying the photothermosensitive trait of brown rats includes the steps of detecting and sequencing brown rats using primer pairs with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2.
[0007] The present invention also provides Pitx2 The application of haplotype markers in the screening or assisted breeding of photothermally sensitive brown rats, the aforementioned Pitx2 The nucleotide sequence of the gene haplotype marker is shown in SEQ ID NO.3; polymorphisms exist at bases 168, 173, 188, 556, 609, 1001, 1051, 1058, and 1070 of the nucleotide sequence shown in SEQ ID NO.3; including two haplotypes, ACCCTGTTG and GTTCGAGCG; When the brown rat is homozygous for the ACCCTGTTG haplotype, it is determined that the brown rat is photothermally sensitive and should be retained.
[0008] Furthermore, the method for screening or assisted breeding of photothermally sensitive brown rats includes the steps of detecting and sequencing brown rats using primer pairs with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2.
[0009] The present invention also provides Pitx2 The application of haplotype markers in the construction of a brown rat model of testicular development inhibition. Pitx2 The nucleotide sequence of the gene haplotype marker is shown in SEQ ID NO.3; polymorphisms exist at bases 168, 173, 188, 556, 609, 1001, 1051, 1058, and 1070 of the nucleotide sequence shown in SEQ ID NO.3; including two haplotypes with base combinations of ACCCTGTTG and GTTCGAGCG; Homozygous brown rats with the ACCCTGTTG haplotype were subjected to short-light or short-light-low-temperature treatments to construct a brown rat testicular development inhibition model.
[0010] Furthermore, the method for detecting homozygous brown rats with the ACCCTGTTG haplotype includes the steps of detecting and sequencing brown rats using primer pairs with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2.
[0011] Optionally, the short illumination treatment is: the illumination time is 10 hours; The short-light low-temperature treatment is as follows: the light exposure time is 10 hours and the temperature is 8℃.
[0012] The present invention also provides a method for identifying the photothermosensitive trait of brown rats, comprising the following steps: The genome of the brown rat to be tested was extracted, and PCR amplification and sequencing were performed using primer pairs with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2; When the base combination at positions 168, 173, 188, 556, 609, 1001, 1051, 1058, and 1070 of the nucleotide sequence shown in SEQ ID NO.3 in the brown rat being tested is homozygous for ACCCTGTTG, the brown rat is determined to be photothermally sensitive; when the base combination is homozygous for GTTCGAGCG, the brown rat is determined to be photothermally insensitive.
[0013] This invention also provides a method for screening or assisting in the breeding of photothermally sensitive brown rats, comprising the following steps: The genome of the brown rat to be tested was extracted, and PCR amplification and sequencing were performed using primer pairs with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2; When the base combination at positions 168, 173, 188, 556, 609, 1001, 1051, 1058, and 1070 of the nucleotide sequence shown in SEQ ID NO.3 in the brown rat to be tested is homozygous for ACCCTGTTG, the brown rat is determined to be photothermally sensitive and is retained.
[0014] This invention also provides a method for constructing a brown rat testicular development inhibition model, comprising the following steps: The genome of the brown rat to be tested was extracted, and PCR amplification and sequencing were performed using primer pairs with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2; Homozygous brown rats with the ACCCTGTTG haplotype were subjected to short-light or short-light-low-temperature treatments to construct a brown rat testicular development inhibition model.
[0015] The present invention discloses the following technical effects: This invention, through in-depth analysis of brown rats Pitx2 In the intergenic region, a set of SNP molecular marker combinations highly associated with the light-temperature sensitivity trait was discovered and verified for the first time. These SNPs are located at positions 168, 173, 188, 556, 609, 1001, 1051, 1058, and 1070 of the nucleotide sequence shown in SEQ ID NO.3, with polymorphisms of A / G, C / T, C / T, C / T, T / G, G / A, T / G, T / C, and G / T, respectively.
[0016] This invention experimentally confirms that homozygous brown rats with the ACCCTGTTG haplotype exhibit significant fluctuations in testicular weight under different light and temperature treatments, while homozygous brown rats with the GTTCGAGCG haplotype remain stable under the same conditions. This demonstrates that this marker combination is a core genetic element controlling the "environmental response" of the brown rat reproductive system. Using the molecular markers and detection methods provided by this invention, environmental response characteristics of individual brown rats can be identified early in their infancy through genotyping, overcoming the lag and environmental sensitivity issues inherent in traditional strain selection relying on phenotypic identification. This significantly improves breeding efficiency and provides core technical support for constructing light and temperature-sensitive brown rat strains with stable genetic characteristics. This invention can also assist in constructing a brown rat testicular development inhibition model. By accurately screening light and temperature-sensitive individuals and developing personalized treatment plans, the construction speed of indoor testicular development inhibition models can be accelerated, and the model construction cost reduced. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0018] Figure 1 For containing 9 SNP sites Pitx2 Figure showing the electrophoresis results of gene PCR amplification products; where M is the DL2000 molecular weight standard, and lanes 1-4 are... Pitx2 Gene amplification products; Figure 2 for Pitx2 A comparison of sequencing peak diagrams of individuals with different haplotypes; Figure 3 Figure 1 shows the testicular weight measurement results of different haplotype populations under different treatment conditions (T23DL14 vs T8DL10); Figure 4 Figure 1 shows the testicular weight measurement results of different haplotype populations under different treatment conditions (T23DL14 vs T23DL10); Figure 5 Figure 1 shows the testicular weight measurement results of different haplotype populations under different treatment conditions (T8DL14 vs T8DL10); Figure 6 Figure 1 shows the testicular weight measurement results of different haplotype populations under different treatment conditions (T23DL14 vs T8DL14); Figure 7 Figure 1 shows the testicular weight measurement results of different haplotype populations under different treatment conditions (T23DL10 vs T8DL10). Detailed Implementation
[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0020] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0021] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0022] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0023] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0024] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the instruments and equipment used in the following examples are all conventional laboratory instruments and equipment; unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent stores.
[0025] The technical solution of the present invention is as follows: The inventors previously obtained brown rats using the RT-PCR method. Pitx2 Based on the complete coding region sequence of the gene, high-throughput sequencing and genotyping verification were used to accurately identify nine key variant sites in the intergenic region for the first time. Polymorphism analysis and phenotypic association studies confirmed that the SNP combination markers located at specific positions are closely related to the seasonal reproductive traits of the Northeast Asian brown rat. The discovery of this molecular marker combination overcomes the lag and environmental sensitivity issues inherent in traditional strain selection relying on phenotypic identification. It allows for the prediction of an individual's environmental response ability through genotyping at the juvenile stage, providing core technical support for constructing photothermal-sensitive brown rat strains with stable genetic characteristics.
[0026] The technical solution of the present invention will be described in detail with reference to the following embodiments.
[0027] Example 1 1. Materials and Methods 1.1 Laboratory Animals Select Northeast Asian species of brown rat ( Rattus norvegicus caracoGenomic DNA was extracted from rat tail samples using the phenol-chloroform method. After extraction, the DNA was tested for integrity, purity, and concentration, and then stored at -20°C for future use.
[0028] 1.2 Methods 1.2.1 Primer Design and PCR Amplification Based on Rnor_6.0 reference genome Pitx2 Intergenic region sequences were used to design upstream and downstream primers centered on candidate mutation sites, and the primers were synthesized by Shanghai Sangon Biotech Co., Ltd.
[0029] Primer sequence information is as follows: Upstream primer: 5'-TGTGTGAGAGGGGACAAATA-3', SEQ ID NO.1; Downstream primer: 5'-GATAACAACCTCAGCACCTT-3', SEQ ID NO.2, The total PCR reaction volume was 25 µL, including: 1 µL template DNA, 1 µL each of forward and reverse primers (10 µM), 12.5 µL 2×TaqMaster Mix, and 9.5 µL ddH2O. The PCR reaction program was as follows: 94 °C pre-denaturation for 3 min; 94 °C denaturation for 45 s, 60 °C annealing for 45 s, 72 °C extension for 1 min 30 s, 10 cycles; 94 °C denaturation for 45 s, 56.5 °C annealing for 45 s, 72 °C extension for 1 min 30 s, 30 cycles; final extension at 72 °C for 5 min, and storage at 10 °C.
[0030] The amplified PCR products were detected by 1.5% agarose gel electrophoresis. The sample volume was 5 μL, and the electrophoresis program was 120V for 25 min. After electrophoresis, the product was scanned using a UVP gel imaging system and observed to be a single bright band. The product was then sent to the company for Sanger sequencing.
[0031] The sequence of the PCR product is shown in SEQ ID NO.3: TGTGTGAGAGGGGACAAATAAATAGAGAAAGTGGAAGAAGTTTTGAAGCCAAGAGAAAGCCTTAACTTTCGTTTGAATGGGTTATCTCTAGGATCAGTAGCAAGTAGACTAGGGAAACAGGGGTGGAAAGGAGAAAGGTAATAGTTTTTAAAAATTTGAGTGAAAAT A TTGC C GTTCAGCAGGAGTC CGAGAAGAGGAGTCATCGAGAAAGGGTCTGATTCCAGGCAAAGATGAGGTACAATAAACAGCGAGGTGGCCAACGTGGATTCAGGTGTGTTCAATTTCTCGTTTGTATCAGACGTCCAGCTTAAATTCCAATTGGAATCCGATGCCAATGGTTCCGGCAGTGATGTAAAAACAGCAGTCACAGCGAAGACTGCAGGGAATTTGCCAACACTGAGTGTGTGCAGGGAACACACTTGGTTCCAGAGCATTTCTGTGTGGTGCTACAGAGGGCAGAGAGGGACAAGCTAAGAAGAAACATCCATTGGAGTGAATGGGGAACAGTATCCTGGAGACCGAGTGAACGTCAGGTGTGCTACTCGTCATGTGTGT C AAAACCTGCCTGTCTGTAAAGGAGATAGGAACTTAGCAGTGGCTGACGACTC T TGCACCCTGGAGATTTGATTGTACCGTGAAAGCTGCCACTGCACCATGGAAGGACCGGATGCAGAATAAAGTACAGTCAAGAGAAACAAGGACTTGCTTTTCTAATATGTGACAGCATGGCGTAGGAAAACAACTCCAGAAACAATACTCTCCATGTTGAAGCTGGTGATGGTGTACAATGATAATCTCAGGCGGGCCAAAGAGAAGCCATGCTTTGTATGTGAAGAGAAGGCAGAAACCTCGAGAACAATTGCTAAGGCTGGTAGATCTGCTGCGGCAGGACGGAGGAGTTGCCTTTTGAGTGTTTTGAATTTTTCCAGTGAGATAAGAAAAGGGGAAGGAGACTAAAGGCAGGAGATGATCCTGAGGCTTCCACAGTGGAAGAACAAAG G TCCTTGAAGCACAAGAGGCTCTAGTACAGCACTCAGAGCCCACTAGAGC T TAGCAG T GGTGAGCTTTG GTCCCCTGACTGCAGTTTTCCTCCTCTCTGGGCAACCCCTTGAACAGTTGGATTATGGGTAAAGAGACAGATTTCATAGGCTTGGGGTCCTACTCAGTCTACATAATGGCTACTGAGATGAGCAAAGGTGCTGAGGTTGTTATC. The bases in the bold, slanted positions are the SNP sites involved in this invention.
[0032] 1.2.2 SNP site screening Sequence alignment was performed using SeqMan software to screen out internal variant sites in the amplified fragment. The SNP sites were located at positions 168, 173, 188, 556, 609, 1001, 1051, 1058, and 1070 of the sequence shown in SEQ ID NO.3.
[0033] 1.2.3 Reproduction of individuals with different haplotypes Male and female Northeast Asian brown rats (individuals of brown rats captured in the wild in Harbin and bred indoors for more than 10 generations) were paired for one week under normal indoor conditions (temperature 23℃, light duration 14 h / d, starting at 6:00 AM). After that, the female rats were separated into individual cages and continued to be raised under normal conditions until the offspring were born. 21 days after birth, the offspring were separated into individual cages and their tails were used for DNA extraction. The DNA was amplified and sequenced using the primer pairs shown in SEQ ID NO.1 and 2. Homozygous haplotype individuals were screened for further experiments.
[0034] 1.2.4 Correlation analysis of different haplotype population treatment methods and reproductive characteristics Male and female brown rats of the same homozygous haplotype were selected and raised to adulthood (90 days old) before being paired. Adult parent brown rats of the same haplotype were paired indoors under normal conditions (temperature 23℃, light duration 14 h / d, starting at 6:00 AM) for one week. Then, the female rats were randomly transferred to four different light and temperature treatments until 30 days after the offspring's birth. This was to establish an indoor testicular development inhibition model. The four different light and temperature treatments are as follows: Group T23DL14: Temperature 23℃, light duration 14 h / d, starting at 6:00 AM; Group T23DL10: Temperature 23℃, light duration 10 h / d, starting at 6:00 AM; Group T8DL14: Temperature 8℃, light duration 14 h / d, starting at 6:00 AM; Group T8DL10: Temperature 8℃, light duration 10 h / d, starting at 6:00 AM.
[0035] After treatment, correlation analysis was used to compare the differences in testicular development among different haplotype populations under different treatment conditions, in order to clarify the association between different haplotypes and reproductive traits. The statistical results were plotted using the R package.
[0036] 2. Results 2.1 PCR amplification The PCR products were detected by 1.5% agarose gel electrophoresis, and the results showed a specific band at approximately 1000 bp (see...). Figure 1 Sequencing and sequence alignment revealed a correlation with the brown rat. Pitx2 The sequence of the intergenic region is consistent, indicating that this fragment belongs to the brown rat. Pitx2 Genes, consistent with subsequent analysis.
[0037] 2.2 Genotyping Sequencing, after comparison and screening, revealed that, as shown in SEQ ID NO.3, bases at positions 168, 173, 188, 556, 609, 1001, 1051, 1058, and 1070 were mutated (see...). Figure 2 When the base combination is ACCCTGTTG homozygous, its frequency in the population is 40.29%, denoted as Allele 4 haplotype; when the combination result is GTTCGAGCG homozygous, its frequency in the population is 30.58%, denoted as Allele 14 haplotype. Allele frequencies at each locus are shown in Table 1. These two main haplotypes together account for over 70% of the population, suggesting they can be used as molecular markers for rapid identification of photosensitive / thermosensitive strains.
[0038] Table 1. Allele frequencies at each locus
[0039] 2.3 Correlation analysis between SNP locus genotype and reproductive phenotype Using an indoor model of testicular developmental inhibition, the relationship between Allele 4 and Allele 14 haplotypes and testicular weight and reproductive characteristics was analyzed. Statistical results showed (see...) Figures 3-7 ): Testicular weight in Allele 4 haplotype male rats showed significant changes under different photothermal conditions (T23DL14 vs T8DL10, P < 0.001). It remained at a high level under suitable photothermal conditions (T23DL14), but decreased significantly under the dual stress of low temperature and short light exposure (T8DL10), suggesting that this haplotype is a typical photothermal sensitive type. In contrast, testicular weight in Allele 14 haplotype male rats remained relatively stable under different photothermal treatments (T23DL14 vs T8DL10, P = 0.295), indicating that this haplotype has extremely low response to photothermal stress and possesses a stable photothermal insensitive physiological phenotype.
[0040] Further grouping and pooling analysis revealed significant differences between haplotypes Allele 4 and Allele 14 under the same temperature but different light treatments. Allele 4 showed a significant change in testicular weight (P < 0.001), while Allele 14 showed no significant change (P = 0.289, 0.371). Under the same light treatment but different temperature treatments, the change in testicular weight in Allele 4 (P = 0.219, 0.058) was still higher than that in Allele 14 (P = 0.500, 0.193). This result clearly reveals the polar differentiation of the two haplotypes in photothermal response and the additive effect of environmental stress, providing direct phenotypic evidence for their use as molecular markers to distinguish photothermal-sensitive / insensitive strains.
[0041] Further analysis revealed that, under the same temperature but different light conditions, haplotype Allele 4 exhibited testicular development inhibition under short-light treatment, with significantly lower testicular weight compared to the long-light treatment group (see...). Figure 4 and Figure 5 (p<0.001). Under the same light exposure but different temperature treatments, the testicular weight of Allele 4 haplotype was slightly lower at low temperature than at room temperature, but the difference was not statistically significant (see [reference needed]). Figure 6 and Figure 7 When low temperature and short light exposure work together, the inhibitory effect on testicular development in the Allele 4 haplotype is significantly enhanced (see...). Figure 3 (p<0.001), showing a significant additive effect. This indicates that the haplotype markers provided by this invention can be used to assist in the construction of an indoor testicular development inhibition model. By accurately screening photothermal-sensitive individuals and formulating personalized treatment plans, the construction speed of the indoor testicular development inhibition model can be accelerated and the model construction cost reduced.
[0042] In conclusion, brown rats Pitx2Multiple SNP sites in the intergenic region were significantly associated with their photothermal-sensitive seasonal reproductive characteristics. The Allele 4 and Allele 14 haplotypes showed significant differentiation in their photothermal response patterns to testicular weight; the former exhibited significant phenotypic changes and was photothermal-sensitive, while the latter had a stable phenotype and low responsiveness to photothermal stress, and was photothermal-insensitive. These results indicate that... Pitx2 SNP sites of genes can serve as effective molecular markers, providing a reliable molecular tool for distinguishing and identifying light- and temperature-sensitive populations. They also reveal the molecular adaptation mechanism of the reproductive rhythm of brown rat populations to environmental light and temperature conditions, providing a key basis for subsequent research on reproductive regulation.
[0043] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. An identification method Pitx2 The application of haplotype markers in identifying the photothermal sensitivity trait in brown rats is characterized by, The Pitx2 The nucleotide sequence of the gene haplotype marker is shown in SEQ ID NO.3; polymorphisms exist at bases 168, 173, 188, 556, 609, 1001, 1051, 1058, and 1070 of the nucleotide sequence shown in SEQ ID NO.3; including two haplotypes with the base combinations ACCCTGTTG and GTTCGAGCG; When a brown rat is homozygous for the ACCCTGTTG haplotype, it is considered to be photothermally sensitive; when a brown rat is homozygous for the GTTCGAGCG haplotype, it is considered to be photothermally insensitive.
2. The application according to claim 1, characterized in that, The method for identifying the photothermosensitive trait of brown rats includes the steps of detecting and sequencing brown rats using primer pairs with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.
2.
3. An identification method Pitx2 The application of haplotype marker products in the screening or assisted breeding of photothermally sensitive brown rats is characterized by... The Pitx2 The nucleotide sequence of the gene haplotype marker is shown in SEQ ID NO.3; polymorphisms exist at bases 168, 173, 188, 556, 609, 1001, 1051, 1058, and 1070 of the nucleotide sequence shown in SEQ ID NO.3; including two haplotypes, ACCCTGTTG and GTTCGAGCG; When the brown rat is homozygous for the ACCCTGTTG haplotype, it is determined that the brown rat is photothermally sensitive and should be retained.
4. The application according to claim 3, characterized in that, The method for screening or assisted breeding of photothermally sensitive brown rats includes the steps of detecting and sequencing brown rats using primer pairs with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.
2.
5. An identification method Pitx2 The application of haplotype marker products in assisting the construction of a brown rat testicular development inhibition model is characterized by, The Pitx2 The nucleotide sequence of the gene haplotype marker is shown in SEQ ID NO.3; polymorphisms exist at bases 168, 173, 188, 556, 609, 1001, 1051, 1058, and 1070 of the nucleotide sequence shown in SEQ ID NO.3; including two haplotypes with base combinations of ACCCTGTTG and GTTCGAGCG; Homozygous brown rats with the ACCCTGTTG haplotype were subjected to short-light or short-light hypothermia treatment to construct a brown rat testicular development inhibition model. The short-light treatment is defined as follows: the light exposure time is 10 hours / day; The short-light low-temperature treatment is as follows: the light exposure time is 10 h / d and the temperature is 8℃.
6. The application according to claim 5, characterized in that, The method for detecting homozygous brown rats with the ACCCTGTTG haplotype includes the steps of detecting and sequencing brown rats using primer pairs with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.
2.
7. A method for identifying the photothermosensitive trait of brown rats, characterized in that, Includes the following steps: The genome of the brown rat to be tested was extracted, and PCR amplification and sequencing were performed using primer pairs with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2; When the base combination at positions 168, 173, 188, 556, 609, 1001, 1051, 1058, and 1070 of the nucleotide sequence shown in SEQ ID NO.3 in the brown rat being tested is homozygous for ACCCTGTTG, the brown rat is determined to be photothermally sensitive; when the base combination is homozygous for GTTCGAGCG, the brown rat is determined to be photothermally insensitive.
8. A method for screening or assisting in the breeding of photothermally sensitive brown rats, characterized in that, Includes the following steps: The genome of the brown rat to be tested was extracted, and PCR amplification and sequencing were performed using primer pairs with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2; When the base combination at positions 168, 173, 188, 556, 609, 1001, 1051, 1058, and 1070 of the nucleotide sequence shown in SEQ ID NO.3 in the brown rat to be tested is homozygous for ACCCTGTTG, the brown rat is determined to be photothermally sensitive and is retained.
9. A method for constructing a brown rat testicular development inhibition model, characterized in that, Includes the following steps: The genome of the brown rat to be tested was extracted, and PCR amplification and sequencing were performed using primer pairs with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2; Homozygous brown rats with the ACCCTGTTG haplotype were subjected to short-light or short-light hypothermia treatment to construct a brown rat testicular development inhibition model. The short-light treatment is defined as follows: the light exposure time is 10 hours / day; The short-light low-temperature treatment is as follows: the light exposure time is 10 h / d and the temperature is 8℃.
Citation Information
Patent Citations
Molecular markers related to swine production properties and preparation and application
CN101880663A
Method for detecting single nucleotide polymorphism (SNP) of milk goat PITX2 gene and application thereof
CN102808018A