Genetically engineered bacteria for improving the yield of mevalonic acid, and construction method and application thereof
By overexpressing the AdhEA267T/E568K and mvaE/mvaS genes in Escherichia coli and introducing the CRISPRi system to inhibit cell growth, the problem of low carbon atom utilization in MVA biosynthesis was solved, and efficient MVA production was achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
- Filing Date
- 2026-05-07
- Publication Date
- 2026-06-05
AI Technical Summary
The low carbon atom utilization rate in existing MVA biosynthesis technologies results in low MVA yield, which limits the economic viability of its industrial production. Furthermore, the process of synthesizing MVA from ethanol involves the problem of competitive consumption of carbon streams.
Genetically engineered bacteria were constructed to overexpress the bifunctional acetaldehyde-ethanol dehydrogenase mutant AdhEA267T/E568K gene adhEmut, the acetyl-CoA acyltransferase/HMG-CoA reductase gene mvaE, and the HMG-CoA synthase gene mvaS. The tetracycline-induced CRISPRi system was introduced to inhibit the expression of the cell growth-related gene pyrF and promote carbon flow to MVA synthesis.
The yield of MVA was improved, reaching 0.89 g/g with ethanol as the carbon source, which was 56.14% higher than the control strain without the CRISPRi system, breaking the theoretical yield limit with glucose as the carbon source.
Smart Images
Figure CN122146561A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a genetically engineered bacterium that improves the yield of mevalonic acid, its construction method, and its application. Background Technology
[0002] Mevalonate (MVA) is an intermediate product of the mevalonate pathway. Starting from MVA, organisms can synthesize isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP), and further synthesize various terpenoids and bioactive lipids, which have important applications in chemical, pharmaceutical, food, and cosmetic fields. Currently, the main methods for preparing MVA include chemical synthesis and biosynthesis. Traditional chemical synthesis typically uses 4-chloro-2-butanone as a starting material, carrying out multi-step reactions under high temperature and pressure conditions. This process uses hazardous chemicals, resulting in environmental pollution, high operational safety risks, and high costs, making it difficult to meet the requirements of green and sustainable production. With the development of genetic engineering and synthetic biology technologies, biosynthesis of MVA has become a major research direction in this field.
[0003] Currently, the biosynthesis of MVA relies on the mevalonate pathway. This pathway first involves the condensation of two molecules of acetyl-CoA to form acetoacetyl-CoA; then, it condenses with one molecule of acetyl-CoA under the action of 3-methyl-3-hydroxyglutaryl-CoA synthase to form 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA); finally, it is reduced by HMG-CoA reductase to generate MVA. In recent years, strategies such as the selection of chassis strains and enzymes, molecular modification of rate-limiting enzymes, metabolic engineering of strain combinations, and optimization of fermentation processes have gradually improved the yield of MVA synthesized by genetically engineered strains. However, the yield of MVA is limited by the core bottleneck of low carbon atom utilization. In the traditional process of synthesizing MVA using glucose as a substrate, one-third of the carbon is lost in the form of CO2 during the process of microorganisms synthesizing acetyl-CoA, the starting material for MVA, through natural glycolysis. This results in low carbon atom utilization and limits the theoretical mass yield of MVA to 0.55 g / g glucose (1.5 Glucose → MVA + 3ATP + 4 NADH + 3CO2), which seriously restricts the economics of its industrial production.
[0004] Previous studies have identified the bifunctional aldehyde-ethanol dehydrogenase (AdhE) mutant AdhE in Escherichia coli. A267T / E568K It can efficiently convert ethanol into acetyl-CoA without the loss of carbon atoms in the process. adhEgene product of Escherichia coli From a functional reductase to a dehydrogenase. (Genetic and biochemical studies of the mutant proteins). Compared to glucose, ethanol via AdhE... A267T / E568K The catalytic conversion to acetyl-CoA via a shorter metabolic pathway and higher carbon conversion rate results in a theoretical MVA yield of 1.07 g / g ethanol, significantly higher than the theoretical yield using glucose as the carbon source (0.55 g / g glucose). However, the acetyl-CoA produced from ethanol enters the tricarboxylic acid (TCA) cycle for cell growth, and MVA synthesis competes with cell growth for the carbon source ethanol, leading to a decrease in MVA yield. Therefore, redirecting the ethanol carbon flow from cell growth to the target product MVA synthesis is of great significance for improving MVA yield. Currently, there are no reports in existing technologies on regulating cell growth to improve the yield of MVA synthesized from ethanol. Summary of the Invention
[0005] To address the critical bottlenecks of low carbon economy and limited theoretical yield in existing MVA biosynthesis technologies, this invention, based on the construction of a carbon-loss-free biosynthetic pathway for MVA synthesis from ethanol, introduces an inducible CRISPRi system to inhibit the expression of cell growth-related genes, thereby directing carbon flow from cell growth to the synthesis of MVA, thus improving MVA yield and providing a new solution for achieving green and efficient biomanufacturing of MVA.
[0006] To solve the above-mentioned technical problems and achieve the corresponding technical effects, the present invention specifically provides the following technical solutions: The first objective of this invention is to provide a genetically engineered bacterium that improves the yield of mevalonic acid, wherein the genetically engineered bacterium uses *Escherichia coli* as the host bacterium and overexpresses the bifunctional acetaldehyde-ethanol dehydrogenase mutant AdhE. A267T / E568K Gene adhE mut Acetyl-CoA acyltransferase / HMG-CoA reductase gene mvaE HMG-CoA synthase gene mvaS Furthermore, the tetracycline-induced CRISPRi system was introduced to inhibit the orotic acid-5'-phosphate decarboxylase gene, a cell growth-related gene. pyrF The expression; the adhE mut The nucleotide sequence is shown in SEQ ID NO.1. mvaE The nucleotide sequence is shown in SEQ ID NO.4. mvaSThe nucleotide sequence is shown in SEQ ID NO.5. pyrF The Gene ID is 947121.
[0007] In one embodiment of the present invention, the Escherichia coli is Escherichia coli MG1655.
[0008] A second objective of this invention is to provide a method for constructing the above-mentioned genetically engineered bacteria, the method comprising the following steps: (1) Cloning separately adhE mut , mvaE and mvaS Gene fragments; (2) First, take the product obtained in step (1) mvaE and mvaS Gene fragments are linked to P-containing molecules via homologous recombination. trc Intermediate plasmids were obtained by inserting the promoter into the expression vector; then the plasmids obtained in step (1) were... adhE mut The gene fragment undergoes homologous recombination with the intermediate plasmid, and a constitutive promoter P is introduced during the homologous recombination process. J23102 Recombinant plasmids were obtained; (3) Insert the dCas9 with the tetracycline-inducible promoter into the expression vector to obtain the recombinant plasmid; (4) The tetracycline-inducible promoter and pyrF The gRNA scaffold gene fragment of the gene target sequence was inserted into the plasmid pgRNA-bacteria to obtain the recombinant plasmid; (5) The three recombinant plasmids obtained in steps (2), (3) and (4) are introduced into the host bacteria to obtain recombinant genetically engineered bacteria.
[0009] In one embodiment of the present invention, step (2) containing P trc The expression vector for the promoter is obtained by replacing the T7 promoter of MCS2 on the plasmid vector pACYCDuet-1 with P. trc The promoter is obtained through construction.
[0010] In one embodiment of the present invention, step (2) specifically involves replacing the T7 promoter of MCS2 on the plasmid vector pACYCDuet-1 with P trc Promoter, build pACYCDuet-P trc The plasmid vector, obtained in step (1), is converted into a homologous recombination method. mvaE and mvaS Gene fragment linked to pACYCDuet-P trc The recombinant plasmid pACYCDuet-P was constructed on the plasmid vector.trc -mvaE-mvaS; The homologous recombination method is used to obtain the mvaE-mvaS from step (1). adhE mut The gene fragment was ligated into the recombinant plasmid pACYCDuet-P. trc On -mvaE-mvaS, during homologous recombination, plasmid pACYCDuet-P trc The T7 promoter of MCS1 on -mvaE-mvaS was replaced with a constitutive promoter P. J23102 Construct the recombinant plasmid pACYCDuet-P J23102 -adhEmut-P trc -mvaE-mvaS.
[0011] In one embodiment of the present invention, the vector skeleton of the recombinant plasmid in step (3) is pCOLADuet-1.
[0012] In one embodiment of the present invention, step (3) involves inserting dCas9 with a tetracycline-inducible promoter into the plasmid vector pCOLADuet-1 by homologous recombination to obtain the recombinant plasmid pCOLA-tet-dCas9.
[0013] Further specifying, step (3) involves using plasmid pdCas9-bacteria as a template to clone a plasmid containing the tetracycline promoter P. tet The dCas9 gene fragment tet-dCas9 was ligated into the plasmid vector pCOLADuet-1 via homologous recombination to construct the recombinant plasmid pCOLA-tet-dCas9.
[0014] In one embodiment of the present invention, step (4) involves combining tetracycline-inducible promoters and... pyrF The gRNA scaffold gene fragment representing the gene target sequence was inserted into the plasmid pgRNA-bacteria to obtain the recombinant plasmid pgRNA-tet- pyrF The pyrF The nucleotide sequence of the gene target sequence is shown in SEQ ID NO.22.
[0015] In one embodiment of the present invention, step (5) involves introducing the three recombinant plasmids obtained in steps (2), (3) and (4) into the host bacteria using a heat shock method, with the volume ratio of the three recombinant plasmids being 1:1:1.
[0016] A third objective of this invention is to provide the application of the above-mentioned genetically engineered bacteria in the fermentation production of mevalonic acid.
[0017] In this invention, "overexpression" refers to the expression of a specific gene in a cell exceeding its original level after being regulated by various signals. This can be achieved by enhancing endogenous expression or introducing exogenous genes.
[0018] The beneficial effects of this invention are: To address the bottleneck problem of low MVA yield in existing MVA biosynthesis technologies, which suffers from carbon loss in the synthesis pathway and carbon loss coupled with cell growth, this invention constructs a carbon-loss-free biosynthetic pathway for MVA synthesis from ethanol. It introduces a tetracycline-induced CRISPRi system to inhibit the expression of cell growth-related genes, directing carbon flow from cell growth to MVA synthesis, thereby increasing MVA yield. Using the genetically engineered bacteria provided by this invention, the yield of MVA synthesized from ethanol as a carbon source was 0.89 g / g, which is 56.14% higher than the control strain without the CRISPRi system. Furthermore, it surpasses the theoretical yield of 0.55 g / g for mevalonic acid synthesis using glucose as a carbon source. Therefore, this invention provides a new approach and method for improving the carbon economy of MVA biomanufacturing. Attached Figure Description
[0019] Figure 1 This is a diagram of the metabolic pathway for the synthesis of mevalonic acid using ethanol as a carbon source. Figure 2 pACYCDuet-P J23102 -adhE mut -P trc Schematic diagram of the structure of the -mvaE-mvaS recombinant plasmid; Figure 3 This is a schematic diagram of the structure of the pCOLA-tet-dCas9 recombinant plasmid; Figure 4 This is a schematic diagram of the structure of the pgRNA-tet-pyrF recombinant plasmid; Figure 5 The images show the fermentation results of the control strain and the recombinant strain. Detailed Implementation
[0020] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be noted that the embodiments mentioned below are only for explaining the invention and are not intended to limit the scope of the invention. The embodiments mentioned below are only some embodiments of the invention, not all embodiments. Those skilled in the art can refer to the content of this document and appropriately improve the process parameters to achieve the objectives of the invention. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the invention. The methods and applications of this invention have been described through preferred embodiments, and those skilled in the art can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content and scope of this invention to realize and apply the technology of this invention. In the art, embodiments obtained by other those skilled in the art without creative effort are all protected by this invention.
[0021] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the materials, reagents, culture media and instruments used are conventional materials, reagents, culture media and instruments in the art, which can be obtained by those skilled in the art through commercial channels.
[0022] The English abbreviations used in the following examples are as follows: Mevalonate (MVA) Bifunctional aldehyde-ethanol dehydrogenase (AdhE); Acetyl-CoA acyltransferase / HMG CoA reductase encoding gene: Acetyl-CoA acyltransferase / HMG CoA reductase, mvaE ; HMG CoA synthase encoding gene: HMG CoA synthase, mvaS ; orotidine-5'-phosphate decarboxylase encoding gene: orotidine-5′ phosphate decarboxylase pyrF ; Escherichia coli: Escherichia coli , E. coli .
[0023] The high-fidelity enzymes and seamless cloning kits used in the following examples were purchased from Beijing Quanshijin Company, and the plasmid extraction and gel recovery kits were purchased from OMEGA Company, USA. The plasmids used included pACYCDuet-1, pCOLADuet-1, and pgRNA-bacteria. pdCas9-bacteria can be purchased commercially.
[0024] Unless otherwise specified, all culture media are prepared using deionized water.
[0025] LB liquid medium: 5 g / L yeast extract, 10 g / L tryptone, 10 g / L sodium chloride.
[0026] LB solid medium: 5 g / L yeast extract, 10 g / L tryptone, 10 g / L sodium chloride, 15 g / L agar powder.
[0027] The fermentation medium consisted of: 9.8 g / L dipotassium hydrogen phosphate trihydrate, 2.1 g / L citric acid monohydrate, 0.3 g / L ferric ammonium citrate, 3 g / L ammonium sulfate, 10 g / L ethanol, 2 mM magnesium sulfate, and 1000× trace elements ((NH4)6Mo7O). 24 The concentrations of each component (·4H2O 3.7 g / L, ZnSO4·7H2O 2.9 g / L, H3BO3 24.7 g / L, CuSO4·5H2O 2.5 g / L, MnCl2·4H2O 15.8 g / L) are all final concentrations in the fermentation medium.
[0028] The solution consisted of: 9.8 g / L dipotassium hydrogen phosphate trihydrate, 2.1 g / L citric acid monohydrate, 0.3 g / L ferric ammonium citrate, and 3 g / L ammonium sulfate, adjusted to pH 7.0 and autoclaved at 121°C for 20 min. Magnesium sulfate and ethanol were prepared separately and added, dissolved and mixed using ddH2O. The ethanol stock solution was 500 g / L, prepared by adding anhydrous ethanol to sterile water. The magnesium sulfate stock solution was 1 M and sterilized separately at 121°C for 20 min. The 1000× trace element solution was sterilized by filtration through a 0.22 μm bacterial membrane. Before transferring the inoculum, the separately sterilized ethanol, magnesium sulfate, 1000× trace element stock solution, and antibiotics were added separately.
[0029] High-performance liquid chromatography (HPLC) method for the detection of mevalonic acid and ethanol: The fermentation broth sample was centrifuged at 8000 rpm for 3 min, and the supernatant was filtered through a 0.22 μm aqueous filter membrane and placed in an HPLC vial for analysis. Detection conditions: HPLC instrument model: LC-20ADXR Shimadzu HPLC system; chromatographic column: Bio-Rad Aminex HPX-87H (300 mm × 7.8 mm); differential detector; column temperature: 55℃; flow rate: 0.5 mL / min; injection volume: 10 μL; mobile phase: 5 mM H2SO4 aqueous solution.
[0030] The bifunctional acetaldehyde-ethanol dehydrogenase mutant AdhE described in the following examples A267T / E568K Gene adhE mut The nucleotide sequence is shown in SEQ ID NO.1, and its wild type is a bifunctional acetaldehyde-ethanol dehydrogenase AdhE derived from Escherichia coli, with the nucleotide sequence shown in SEQ ID NO.2 and the amino acid sequence shown in SEQ ID NO.3; the acetyl-CoA acyltransferase / HMG CoA reductase gene mvaE Derived from Enterococcus faecalis, the nucleotide sequence is shown in SEQ ID NO.4; the HMG CoA synthase gene mvaS Derived from Enterococcus faecalis, the nucleotide sequence is shown in SEQ ID NO.5; the orotic acid-5'-phosphate decarboxylase gene. pyrF Derived from Escherichia coli, Gene ID: 947121.
[0031] SEQ ID NO.1 (5'-3'): SEQ ID NO.2(5’-3’): SEQ ID NO.3: MAVTNVAELNALVERVKKAQREYASFTQEQVDKIFRAAALAAADARIPLAKMAVAESGMGIVEDKVIKNHFASEYIYNAYKDEKTCGVLSEDDTFGTITIAEPIGIICGIVPTTNPTSTAIFKSLISLKTRNAIIFSPHPRAKDATNKAADIVLQAAIAAGAPKDLIGWIDQPSVELSNALMHHPDINLILATGGPGMVKAAYSSGKPAIGVGAGNTPVVIDETADIKRAVASVLMSKTFDNGVICASEQSVVVVDSVYDAVRERFATHGGYLLQGKELKAVQDVILKNGALNAAIVGQPAYKIAELAGFSVPENTKILIGEVTVVDESEPFAHEKLSPTLAMYRAKDFEDAVEKAEKLVAMGGIGHTSCLYTDQDNQPARVSYFGQKMKTARILINTPASQGGIGDLYNFKLAPSLTLGCGSWGGNSISENVGPKHLINKKTVAKRAENMLWHKLPKSIYFRRGSLPIALDEVITDGHKRALIVTDRFLFNNGYADQITSVLKAAGVETEVFFEVEADPTLSIVRKGAELANSFKPDVIIALGGGSPMDAAKIMWVMYEHPETHFEELALRFMDIRKRIYKFPKMGVKAKMIAVTTTSGTGSEVTPFAVVTDDATGQKYPLADYALTPDMAIVDANLVMDMPKSLCAFGGLDAVTHAMEAYVSVLASEFSDGQALQALKLLKEYLPASYHEGSKNPVARERVHSAATIAGIAFANAFLGVCHSMAHKLGSQFHIPHGLANALLICNVIRYNANDNPTKQTAFSQYDRPQARRRYAEIADHLGLSAPGDRTAAKIEKLLAWLETLKAELGIPKSIREAGVQEADFLANVDKLSEDAFDDQCTGANPRYPLISELKQILLDTYYGRDYVEGETAAKKEAAPAKAEKKAKKSA; SEQ ID NO.4(5’-3’): SEQ ID NO.5(5’-3’):
[0032] Example 1: Construction of genetically engineered bacteria to improve mevalonic acid yield According to the metabolic pathway diagram of mevalonic acid synthesis using ethanol as a carbon source ( Figure 1 ), and construct genetically engineered bacteria to improve the yield of mevalonic acid.
[0033] 1. Recombinant plasmid pACYCDuet-P J23102 -adhE mut -P trc Build -mvaE-mvaS Recombinant plasmid pACYCDuet-P J23102 -adhE mut -P trc The structural diagram of -mvaE-mvaS is shown below. Figure 2 As shown in the figure, the recombinant plasmid pACYCDuet-P was constructed. J23102 -adhE mut -P trc -mvaE-mvaS.
[0034] (1) Construction of plasmid vector pACYCDuet-P trc The T7 promoter of MCS2 on plasmid vector pACYCDuet-1 was replaced with the trc promoter to construct plasmid vector pACYCDuet-P. trc The specific steps are as follows: Using plasmid pACYCDuet-1 as a template, PCR amplification was performed using primers Trc-F and Trc-R to obtain the vector fragment. Then, self-ligation was performed using a recombinant cloning kit to obtain the plasmid vector pACYCDuet-P. trc The PCR amplification systems and procedures involved in the above process are shown in Tables 1 and 2, and the homologous recombination systems involved are shown in Table 3.
[0035] Trc-F (SEQ ID NO. 6): ATCATCCGGCTCGTAATGtgtggaattgtgagcggat; Trc-R (SEQ ID NO. 7): CATTATACGAGCCGGATGATTAATTgtcaaatttcgattatgcggccg.
[0036] Table 1 PCR amplification system
[0037] Table 2 PCR amplification program
[0038] Table 3 Homologous recombination system
[0039] (2) Construction of recombinant plasmid pACYCDuet-P trc -mvaE-mvaS pACYCDuet-P trc Using [a specific vector], the recombinant plasmid pACYCDuet-P was constructed. trc -mvaE-mvaS, the specific steps are as follows: Whole genome synthesis is commissioned to a biotechnology company. mvaE Genes (nucleotide sequences such as SEQ ID NO.4) and mvaS Gene (nucleotide sequence as shown in SEQ ID NO.5); with plasmid pACYCDuet-P trc Using ZT1-F and ZT1-R as templates, the vector fragment was amplified by PCR; the synthesized gene was then used. mvaE Using mvaE-F and mvaE-R as templates, PCR amplification was performed. mvaE Fragments, used to synthesize genes mvaS Using mvaS-F and mvaS-R as templates, PCR amplification was performed. mvaS Fragments. Vector fragments were ligated using a recombinant cloning kit via homologous recombination. mvaE Fragments and mvaS Fragments were obtained to obtain the recombinant plasmid pACYCDuet-P trc -mvaE-mvaS. The PCR amplification system and procedure are the same as those in Tables 1 and 2, and the homologous recombination method is shown in Table 4.
[0040] ZT1-F (SEQ ID NO.8): ctcgagtctggtaaagaaaccg; ZT1-R (SEQ ID NO.9): TATATTAGTTAAGTATAAGAAGGAGATATAatggagaaaacagtagttattattgatgc; mvaE-F (SEQ ID NO. 10): atggagaaaacagtagttattattgatgc; mvaE-R (SEQ ID NO. 11): ctgagctcgaattcggatccttattgttttcttaaatcatttaaaatagccaagg; mvaS-F (SEQ ID NO. 12): ggatccgaattcgagctcaggaggtaaaaaaacatgacaattgggattgataaaattagtttt; mvaS-R (SEQ ID NO. 13): gtttctttaccagactcgagttagtttcgataagagcgaacggt.
[0041] Table 4 Homologous recombination system
[0042] (3) Constructing the recombinant plasmid pACYCDuet-P J23102 -adhE mut -P trc -mvaE-mvaS pACYCDuet-P trc Using -mvaE-mvaS as a vector, the recombinant plasmid pACYCDuet-P was constructed. J23102 -adhE mut -P trc -mvaE-mvaS, the specific steps are as follows: Whole genome synthesis is commissioned to a biotechnology company. adhE mut Gene, nucleotide sequence as shown in SEQ ID NO.1; using plasmid pACYCDuet-P trc Using -mvaE-mvaS as a template, and primers ZT2-F and ZT2-R, the vector fragment was amplified by PCR; the synthesized gene... adhE mut Using adhE as a template, primers were employed. mut -F and adhE mut -R, PCR amplification adhE mut Fragment. The vector fragment and [other fragments] were ligated using a recombinant cloning kit via homologous recombination. adhE mut Fragments, during homologous recombination, plasmid pACYCDuet-P trc The T7 promoter of MCS1 on -mvaE-mvaS was replaced with a constitutive promoter P. J23102 The recombinant plasmid pACYCDuet-P was obtained. J23102 -adhE mut -P trc -mvaE-mvaS. The PCR amplification system and procedure are the same as those in Tables 1 and 2, and the homologous recombination system is shown in Table 5.
[0043] ZT2-F (SEQ ID NO. 14): tcgaacagaaagtaatcgtattgtac; ZT2-R (SEQ ID NO. 15): GTACATGCTAACAATACGGCTAGCACAGTACCTAGGACTGAGCTAGCTGTCAA atttcctaatgcaggagtcgc; adhE mut -F (SEQ ID NO.16): CGTATTGTTAGCATGTACGTTTAAACCAGGAGAACAGCTATGGCAGTTACCAATGTTGC; adhE mut -R (SEQ ID NO. 17): tacgattactttctgttcgaTTAGGCCGCTTTTTTTTGCTTT.
[0044] Table 5 Homologous Recombination System
[0045] 2. Construction of recombinant plasmid pCOLA-tet-dCas9 A schematic diagram of the structure of the recombinant plasmid pCOLA-tet-dCas9 is shown below. Figure 3 As shown in the figure, the recombinant plasmid pCOLA-tet-dCas9 was constructed.
[0046] The dCas9 vector carrying a tetracycline-inducible promoter was inserted into the pCOLADuet-1 vector to construct the plasmid pCOLA-tet-dCas9. The specific steps are as follows: using plasmid pCOLADuet-1 as a template, pCOLA-F and pCOLA-R were used as primers to amplify the vector fragment; using plasmid pdCas9-bacteria as a template, dCas9-F and dCas9-R were used as primers to amplify the tet-dCas9 fragment. The vector fragment and the tet-dCas9 fragment were ligated using a recombinant cloning kit via homologous recombination to obtain the recombinant plasmid pCOLA-tet-dCas9. The PCR amplification system and procedure are the same as in Tables 1 and 2, and the homologous recombination method is shown in Table 6.
[0047] pCOLA-F (SEQ ID NO. 18): TCGAACAGAAAGTAATCGTATTGTACA; pCOLA-R (SEQ ID NO. 19): GCGCAACGCAATTAATGTAAGT; dCas9-F (SEQ ID NO. 20): TTACATTAATTGCGTTGCGCttaagaccccactttcacatttaagttg; dCas9-R (SEQ ID NO. 21): TACGATTACTTTCTGTTCGAatccctaggtataaacgcagaaagg.
[0048] Table 6 Homologous Recombination System
[0049] 3. Construction of recombinant plasmid pgRNA-tet-pyrF The structural diagram of the recombinant plasmid pgRNA-tet-pyrF is shown below. Figure 4 As shown in the figure, the recombinant plasmid pgRNA-tet-pyrF was constructed.
[0050] Designing genes using targeted sequences on websites pyrF The target sequence (SEQ ID NO.22: aggagaattcgtaacagcgc) will contain a tetracycline-inducible promoter and pyrF The gRNA scaffold gene fragment of the target sequence was inserted into the plasmid pgRNA-bacteria to construct the recombinant plasmid pgRNA-tet-pyrF. The specific steps are as follows: using plasmid pdCas9-bacteria as a template, the tet-sg-F and tet-sg-R primers were used to amplify the tet-sg.pyrF fragment; using plasmid pgRNA-bacteria as a template, the pgRNA vector fragment was amplified using pgRNA-F and pgRNA-R primers. The pgRNA vector fragment and the tet-sg.pyrF fragment were ligated using a recombinant cloning kit via homologous recombination to obtain the recombinant plasmid pgRNA-tet-pyrF. The PCR amplification system and procedure are the same as those in Tables 1 and 2, and the homologous recombination method is shown in Table 7.
[0051] pgRNA-F (SEQ ID NO. 23): aggagaattcgtaacagcgcGTTTTAGAGCTAGAAATAGCAAGTTAAAATAA; pgRNA-R (SEQ ID NO. 24): AGATCTTTAGAATTccagaaatcatcc; tet-sg-F (SEQ ID NO. 25): ttctggAATTCTAAAGATCTttaagaccccactttcacatttaagttg; tet-sg-F (SEQ ID NO. 26): gcgctgttacgaattctcctACTAGTCTTttctctatcactgataggga.
[0052] Table 7 Homologous Recombination System
[0053] 4. Construction of recombinant strains The recombinant plasmid pACYCDuet-P obtained above was used. J23102 -adhE mut -P trc 1 μL each of -mvaE-mvaS, pCOLA-tet-dCas9, and pgRNA-tet-pyrF were transformed into *E. coli* MG1655 competent cells using a heat shock method to obtain recombinant bacteria. The specific method is as follows: *E. coli* MG1655 competent cells were placed in an ice bath (thawed for 5 min), and the recombinant plasmid pACYCDuet-P obtained above was added. J23102 -adhE mut -P trc Mix 1 μL each of -mvaE-mvaS, pCOLA-tet-dCas9, and pgRNA-tet-pyrF gently and incubate on ice for 30 min; incubate in a 42℃ water bath for 90 s, then quickly transfer to an ice bath and cool for 2 min; add 900 μL of sterile LB medium to each centrifuge tube, mix well, and incubate at 37℃ and 220 rpm for 60 min; centrifuge at 5000 rpm for 1 min, and spread 100 μL of the bacterial solution onto LB solid medium containing chloramphenicol, ampicillin, and kanamycin resistance. Invert the plate and incubate at 37℃ for 12–16 h to obtain the recombinant strain.
[0054] The above-obtained recombinant plasmid pACYCDuet-P J23102 -adhE mut -P trc -mvaE-mvaS was transformed into E. coli MG1655 cells using a heat shock method to form a control strain. The specific method is as follows: E. coli MG1655 competent cells were placed in an ice bath (thawed for 5 min), and the recombinant plasmid pACYCDuet-P obtained above was added. J23102 -adhE mut -P trc Add 1 μL of -mvaE-mvaS, mix gently, and place in an ice bath for 30 min; incubate in a 42℃ water bath for 90 s, then quickly transfer to an ice bath and cool for 2 min; add 900 μL of sterile LB medium to each centrifuge tube, mix well, and incubate at 37℃ and 220 rpm for 60 min; centrifuge at 5000 rpm for 1 min, and spread 100 μL of the bacterial solution onto LB solid medium containing chloramphenicol resistance. Invert the plate and incubate at 37℃ for 12–16 h to obtain the control strain.
[0055] Example 2: Application of the genetically engineered bacteria obtained in Example 1 in the fermentation production of mevalonic acid. By expressing CRISPRi system-related plasmids (pCOLA-tet-dCas9 and pgRNA-tet-pyrF) in the genetically engineered bacteria obtained in Example 1, the cell growth-related orotate-5'-phosphate decarboxylase gene was inhibited. pyrF The expression of [a specific ingredient] promotes carbon flow from cell growth to product synthesis, thereby increasing the yield of mevalonic acid. This example demonstrates the effect of the genetically engineered bacteria constructed in Example 1 on the production of mevalonic acid through a shake-flask fermentation experiment. The specific method of the shake-flask fermentation experiment is as follows: (1) Cultivation of primary seed culture: A single colony of the recombinant bacteria constructed in Example 1 was inoculated into 10 mL LB seed culture medium on a solid LB plate, and chloramphenicol, ampicillin and kanamycin were added to a final concentration of 34 μg / mL. The culture was carried out at 37℃ and 220 rpm for 12 h to obtain the primary seed culture of the genetically engineered bacteria described in this invention.
[0056] Control group: A single colony of the control strain constructed in Example 1 was inoculated into 10 mL of LB seed culture medium on a solid LB plate, and chloramphenicol was added to a final concentration of 34 μg / mL. The culture was carried out at 37℃ and 220 rpm for 12 h to obtain the primary seed culture of the control strain.
[0057] (2) Fermentation culture: Take 1 mL of the primary seed culture obtained in the previous step into 50 mL of fermentation medium. When transferring the seed culture, add ethanol stock solution, magnesium sulfate stock solution, 1000× trace element stock solution, chloramphenicol at a final concentration of 34 μg / mL, ampicillin at 100 μg / mL, and kanamycin at 50 μg / mL. Set up 3 replicates for each strain and culture at 37℃ and 180 rpm. Add chloramphenicol at a final concentration of 34 μg / mL to the culture of the control strain, and perform the other operations as above.
[0058] (3) Induction of expression and detection: When the bacterial culture OD 600 When the concentration reached 0.6-0.8, IPTG was added to a final concentration of 0.1 mM, and the mixture was incubated at 30℃ and 180 rpm. One hour after adding IPTG, tetracycline solution to a final concentration of 200 ng / mL was added to induce CRISPRi system expression. After 48 hours of IPTG induction culture, the bacterial culture was collected, the supernatant was collected by centrifugation, and the contents of ethanol and mevalonic acid were detected by high performance liquid chromatography.
[0059] According to the operation steps of this embodiment, the obtained detection results (such as...) Figure 5 The following is a list of recombinant strain OD: 600The OD value of the control strain was 3.5, the MVA yield was 4.5 g / L, and the yield was 0.89 g / g; 600 The concentration was 6.0, the MVA yield was 5.8 g / L, and the yield was 0.57 g / g. This indicates that gene targeting via CRISPRi technology... pyrF By regulating the growth of the strain, carbon flux was successfully diverted from growth to MVA synthesis, and the MVA yield reached 83.18% of the theoretical yield, which was 56.14% higher than that of the control strain. It also broke through the theoretical yield of mevalonic acid of 0.55 g / g using glucose as a carbon source.
[0060] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.
Claims
1. A genetically engineered bacterium that improves the yield of mevalonic acid, characterized in that, The genetically engineered bacteria used *Escherichia coli* as the host bacterium to overexpress the bifunctional acetaldehyde-ethanol dehydrogenase mutant AdhE. A267T / E568K Gene adhE mut Acetyl-CoA acyltransferase / HMG CoA reductase gene mvaE HMG CoA synthase gene mvaS Furthermore, the tetracycline-induced CRISPRi system was introduced to inhibit the orotic acid-5'-phosphate decarboxylase gene, a cell growth-related gene. pyrF The expression; the adhE mut The nucleotide sequence is shown in SEQ ID NO.
1. mvaE The nucleotide sequence is shown in SEQ ID NO.
4. mvaS The nucleotide sequence is shown in SEQ ID NO.
5. pyrF The Gene ID is 947121.
2. The genetically engineered bacterium according to claim 1, characterized in that, The Escherichia coli in question is Escherichia coli MG1655.
3. The method for constructing the genetically engineered bacteria according to claim 1 or 2, characterized in that, Includes the following steps: (1) Cloning separately adhE mut , mvaE and mvaS Gene fragments; (2) First, take the product obtained in step (1) mvaE and mvaS Gene fragments are linked to P-containing molecules via homologous recombination. trc Intermediate plasmids were obtained by expressing the promoter in an expression vector; Then take the obtained step (1) adhE mut The gene fragment undergoes homologous recombination with the intermediate plasmid, and a constitutive promoter P is introduced during the homologous recombination process. J23102 Recombinant plasmids were obtained; (3) Insert the dCas9 with the tetracycline-inducible promoter into the expression vector to obtain the recombinant plasmid; (4) The tetracycline-inducible promoter and pyrF The gRNA scaffold gene fragment of the gene target sequence was inserted into the plasmid pgRNA-bacteria to obtain the recombinant plasmid; (5) The three recombinant plasmids obtained in steps (2), (3) and (4) are introduced into the host bacteria to obtain recombinant genetically engineered bacteria.
4. The construction method according to claim 3, characterized in that, Step (2) contains P trc The expression vector for the promoter is obtained by replacing the T7 promoter of MCS2 on the plasmid vector pACYCDuet-1 with P. trc The promoter is obtained through construction.
5. The construction method according to claim 4, characterized in that, The specific method of step (2) is to replace the T7 promoter of MCS2 on the plasmid vector pACYCDuet-1 with P trc Promoter, build pACYCDuet-P trc The plasmid vector, obtained in step (1), is converted into a homologous recombination method. mvaE and mvaS Gene fragment linked to pACYCDuet-P trc The recombinant plasmid pACYCDuet-P was constructed on the plasmid vector. trc -mvaE-mvaS; The homologous recombination method is used to obtain the mvaE-mvaS from step (1). adhE mut The gene fragment was ligated into the recombinant plasmid pACYCDuet-P. trc On -mvaE-mvaS, during homologous recombination, plasmid pACYCDuet-P trc The T7 promoter of MCS1 on -mvaE-mvaS was replaced with a constitutive promoter P. J23102 Construct the recombinant plasmid pACYCDuet-P J23102 -adhEmut-P trc -mvaE-mvaS.
6. The construction method according to claim 3, characterized in that, The vector backbone of the recombinant plasmid in step (3) is pCOLADuet-1.
7. The construction method according to claim 6, characterized in that, Step (3) involves inserting dCas9 with a tetracycline-inducible promoter into the plasmid vector pCOLADuet-1 via homologous recombination to obtain the recombinant plasmid pCOLA-tet-dCas9.
8. The construction method according to claim 3, characterized in that, Step (4) involves combining tetracycline-inducible promoters and... pyrF The gRNA scaffold gene fragment representing the gene target sequence was inserted into the plasmid pgRNA-bacteria to obtain the recombinant plasmid pgRNA-tet- pyrF The pyrF The nucleotide sequence of the gene target sequence is shown in SEQ ID NO.
22.
9. The construction method according to claim 3, characterized in that, Step (5) involves introducing the three recombinant plasmids obtained in steps (2), (3) and (4) into the host bacteria using a heat shock method. The volume ratio of the three recombinant plasmids is 1:1:
1.
10. The use of the genetically engineered bacteria according to claim 1 or 2 in the fermentation production of mevalonic acid.