Nucleic acid molecules targeting sars-cov-2 virus spike protein, recombinant expression vectors comprising the same and uses thereof

By designing nucleic acid molecules containing promoters, antisense oligonucleotides, and TRIM21 domains, and combining RNA editing and protein degradation technologies, the problems of low efficiency and high development difficulty of PROTAC technology were solved, achieving efficient targeted inhibition of SARS-CoV-2 Spike protein and providing a preparation method for drugs for novel coronavirus infection.

CN122146697APending Publication Date: 2026-06-05GUANGZHOU MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610124264.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-29
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing PROTAC technology has limited efficiency in protein degradation, is difficult to develop, and restricts its widespread application. Moreover, most research institutions lack the relevant technical conditions.

Method used

Design a nucleic acid molecule containing a promoter, an antisense oligonucleotide, a RING domain encoding TRIM21, and a target protein-specific binding domain. Silence the start or stop codons of the target protein using RNA editing technology, and degrade the target protein using the TRIM21 ubiquitination pathway. Combine this with mTA protein degradation technology to achieve highly efficient targeted inhibition.

Benefits of technology

This significantly improves the inhibition efficiency of target proteins and provides an efficient and simple protein-targeting degradation strategy, which is suitable for the preparation of drugs to treat novel coronavirus infection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146697A_ABST
    Figure CN122146697A_ABST
Patent Text Reader

Abstract

The application discloses a nucleic acid molecule targeting SARS-CoV-2 virus Spike protein, a recombinant expression vector comprising the same and application. The nucleic acid molecule comprises a promoter and a downstream regulatory sequence, wherein the regulatory sequence comprises an antisense oligonucleotide, a nucleic acid sequence encoding a RING domain of TRIM21 and a nucleic acid sequence encoding a specific binding domain of a target protein. The design simultaneously realizes translation inhibition and ubiquitination degradation of the target protein through a single vector, significantly improves the inhibition efficiency of the target protein and provides a new efficient and simple strategy for protein targeted degradation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of biotechnology, specifically to nucleic acid molecules targeting the Spike protein of the SARS-CoV-2 virus, recombinant expression vectors containing them, and their applications. Background Technology

[0002] Protein degradation technology has become an important research direction. Among them, PROTAC (Proteolysis-Targeting Chimeras) technology, which recruits E3 ubiquitin ligases to induce ubiquitination and degradation of target proteins, has shown certain therapeutic potential, but its practical application still has significant limitations. First, PROTAC technology suffers from off-target effects, making it difficult to achieve ultra-high levels of protein concentration reduction, often only achieving a degradation efficiency of around 70%. Furthermore, the development of protein ligands used in PROTAC technology is highly challenging, requiring state-of-the-art equipment and technology in the chemical field to prepare novel ligands. Most research institutions lack the technical capabilities for this development, severely limiting the widespread adoption and application of this technology.

[0003] Therefore, there is an urgent need to develop a new protein-targeting inhibition strategy that is more efficient in degradation, easier to develop, and easier to promote. Summary of the Invention

[0004] Therefore, it is necessary to provide nucleic acid molecules that target the Spike protein of the SARS-CoV-2 virus, recombinant expression vectors containing them, and their applications.

[0005] A first aspect of this application provides a nucleic acid molecule comprising a promoter and a downstream regulatory sequence, wherein the regulatory sequence comprises an antisense oligonucleotide, a nucleic acid sequence encoding a RING domain of TRIM21, and a nucleic acid sequence encoding a specific binding domain of a target protein, wherein the antisense oligonucleotide is capable of silencing a start codon or a stop codon of the target protein, the RING domain of TRIM21 is used to degrade the target protein, and the specific binding domain of the target protein is capable of specifically binding to the target protein or a marker protein linked to the target protein.

[0006] In some embodiments, the target protein includes the Spike protein.

[0007] In some embodiments, the sequence of the antisense oligonucleotide of the start codon of the silenced target protein is shown in SEQ ID NO: 1; and / or, the sequence of the antisense oligonucleotide of the stop codon of the silenced target protein is shown in SEQ ID NO: 2.

[0008] In some implementations, the nucleic acid sequence encoding the RING domain of TRIM21 is shown in SEQ ID NO: 3.

[0009] In some embodiments, the marker protein includes green fluorescent protein.

[0010] In some embodiments, the specific binding domain of the target protein includes nanobodies.

[0011] In some embodiments, the nucleic acid sequence encoding the specific binding domain of the target protein is shown in SEQ ID NO: 4.

[0012] In some embodiments, the regulatory sequence, from the 5' end to the 3' end, consists of an antisense oligonucleotide, a nucleic acid sequence encoding the RING domain of TRIM21, and a nucleic acid sequence encoding the specific binding domain of the target protein, in sequence; and / or,

[0013] The regulatory sequence, from the 5' end to the 3' end, consists of a nucleic acid sequence encoding the RING domain of TRIM21, an antisense oligonucleotide, and a nucleic acid sequence encoding the specific binding domain of the target protein; and / or,

[0014] The regulatory sequence, from the 5' end to the 3' end, consists of the nucleic acid sequence of the RING domain of TRIM21, the nucleic acid sequence encoding the specific binding domain of the target protein, and an antisense oligonucleotide.

[0015] A second aspect of this application provides a recombinant expression vector comprising the nucleic acid molecule described in the first aspect of this application.

[0016] A third aspect of this application provides the use of the nucleic acid molecule described in the first aspect of this application or the recombinant expression vector described in the second aspect of this application in degrading intracellular target proteins, comprising the following steps: introducing the nucleic acid molecule described in the first aspect of this application or the recombinant expression vector described in the second aspect of this application into cells expressing the target protein for culturing.

[0017] The fourth aspect of this application provides the use of the nucleic acid molecule described in the first aspect of this application or the recombinant expression vector described in the second aspect of this application in the preparation of a medicament for treating novel coronavirus infection.

[0018] The aforementioned nucleic acid molecules, by integrating antisense oligonucleotides, nucleic acid sequences encoding the RING domain of TRIM21, and nucleic acid sequences encoding the target protein-specific binding domain in the same vector, synergistically inhibit the translation of target proteins and promote their degradation via the ubiquitin-proteasome pathway, significantly improving the inhibition efficiency of target proteins. Moreover, this can be accomplished with only a single vector, providing a new strategy for efficient and convenient protein-targeted degradation. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments and examples of this application, and to more completely understand this application and its beneficial effects, the accompanying drawings used in the description of the embodiments or examples will be briefly introduced below. Obviously, the drawings described below are merely some embodiments of this application. Those skilled in the art can obtain other drawings based on these drawings without any creative effort.

[0020] Figure 1 This is a schematic diagram illustrating the design principle of degrading target proteins in one embodiment of this application;

[0021] Figure 2 The degradation effect of ASO insertion of the start codon at the 5' end of mTA on Spike protein in one embodiment of this application;

[0022] Figure 3 The degradation effect of ASO insertion of the start codon on the linker of mTA on Spike protein in one embodiment of this application;

[0023] Figure 4 The degradation effect of ASO insertion of the start codon at the 3' end of mTA on Spike protein in one embodiment of this application;

[0024] Figure 5 This application describes the degradation effect of two plasmids expressing ASO (targeted start codon) and mTA on Spike protein in one embodiment.

[0025] Figure 6 The degradation effect of ASO insertion of the targeted stop codon into the 5' end of mTA on Spike protein in one embodiment of this application;

[0026] Figure 7 The degradation effect of ASO insertion of the targeted stop codon into the linker of mTA on Spike protein in one embodiment of this application;

[0027] Figure 8 The degradation effect of ASO insertion of the targeted stop codon into the 3' end of mTA on Spike protein in one embodiment of this application;

[0028] Figure 9 This application describes the degradation effect of two plasmids expressing ASO (targeted stop codon) and mTA on Spike protein in one embodiment of the present application.

[0029] Figure 10 This is a comparison of the effects of different construction strategies on the degradation of Spike protein in one embodiment of this application. Detailed Implementation

[0030] To facilitate understanding of this application, a more complete description will be provided below with reference to the accompanying drawings. Preferred embodiments of this application are shown in the drawings. However, this application can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of this application.

[0031] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0032] The terms “having,” “containing,” “comprising,” and “including” as used in this application are synonyms and are inclusive or open-ended, not excluding additional, uncited members or features. Members or features include, for example, materials or components, structures, elements, instruments, etc.; non-limiting examples of members or features include actions, conditions under which actions occur, timing, states, etc.

[0033] In this application, the technical features or solutions described in open-ended language include both closed-ended technical features or solutions consisting of the listed contents and open-ended technical features or solutions that include the listed contents.

[0034] In this application, if the unit of a data range is only followed by the right endpoint, it means that the units of the left and right endpoints are the same.

[0035] In this application, where the method flow involves multiple steps, unless otherwise explicitly stated herein, there is no strict order restriction on the execution of these steps; they can be executed in any order other than those described. Moreover, any step may include multiple sub-steps or multiple stages, which are not necessarily completed at the same time, but can be executed at different times, and their execution order is not necessarily sequential, but can be performed alternately or simultaneously with other steps or parts of the sub-steps or stages of other steps.

[0036] In this application, the exemplary descriptions such as "in some implementations (or embodiments)" and "in one implementation (or embodiment)" may cover, but are not limited to, the following meanings: these solutions can be combined with other solutions in a suitable manner to form new technical solutions.

[0037] In this application, the terms "first aspect," "second aspect," etc., are used for descriptive purposes only and should not be construed as indicating or implying relative importance or quantity, nor should they be construed as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first aspect," "second aspect," etc., serve only as a non-exhaustive enumeration and should be understood not to constitute a closed limitation on quantity.

[0038] In this application, when numerical intervals (i.e., numerical ranges) are mentioned, unless otherwise specified, the distribution of selectable numerical values ​​within the numerical interval is considered continuous, and includes the two endpoints of the numerical interval (i.e., the minimum and maximum values), as well as every numerical value between these two endpoints. Unless otherwise specified, when a numerical interval refers only to integers within that numerical interval, it includes the two endpoint integers of the numerical range, as well as every integer between the two endpoints, which is equivalent to directly listing every integer. When multiple numerical ranges are provided to describe features or characteristics, these numerical ranges can be merged. In other words, unless otherwise specified, the numerical ranges disclosed herein should be understood to include any and all subranges included therein. The "numerical value" in the numerical interval can be any quantitative value, such as a number, percentage, ratio, etc. The term "numerical interval" can be broadly included to include numerical interval types such as percentage intervals, ratio intervals, and proportion intervals.

[0039] In this application, the terms "room temperature" or "normal temperature" generally refer to 4°C to 35°C, for example, 20°C ± 5°C. In some embodiments of this application, "room temperature" or "normal temperature" refers to 10°C to 30°C. In some embodiments of this application, "room temperature" or "normal temperature" refers to 20°C to 30°C.

[0040] In this application, "ASO" refers to antisense oligonucleotide, which is a synthetic oligonucleotide capable of inducing gene silencing.

[0041] In this application, "T21R" refers to the RING domain of TRIM21. The mechanism of action of TRIM21 mainly involves ubiquitination and protein degradation. When TRIM21 recognizes a specific pathogen molecule, it recruits the E3 ubiquitin ligase complex through its RING domain, adding the ubiquitin molecule to the target protein. This process usually leads to the degradation of the target protein by the proteasome, thereby eliminating the threat of the pathogen.

[0042] In this application, "mTA" refers to mini-TrimAway, a protein degradation technology. See the inventor's published literature in Science (Jonathan Benn et al., Aggregate-selective removal of pathological tau by clustering-activated degraders. Science 385, 1009-1016 (2024). DOI: 10.1126 / science.adp5186). Its core design is to fuse the RING domain responsible for catalytic activity in the human E3 ubiquitin ligase TRIM21 with a nanobody that can specifically recognize the target protein through genetic engineering methods.

[0043] In some embodiments, this application provides for the first time a novel protein expression inhibition and degradation technology that combines "ADAR-mediated A-to-I RNA editing technology" and "mTA protein degradation technology." For example... Figure 1 As shown, in this technology, ASO (Antisense Oligonucleotide) is a 75-nucleotide sequence that can bind to specific gene sites (start codons or stop codons) and summon ADAR enzymes to edit the A base into an I base. Then, the cell reads I as G, changing the ATG promoter to ITG, ultimately recognized by the cell as GTG; TAA becomes TII, ultimately recognized by the cell as TGG. This ultimately prevents protein expression. Meanwhile, the mTA protein degradation technology uses nanobodies to bind to the target protein (taking SARS-CoV-2 Spike protein as an example), initiating ubiquitin ligase activity through the RING domain of Trim21, ultimately degrading the target protein via the cell's proteasome. This "two-pronged approach" ultimately achieves highly efficient inhibition of the target protein.

[0044] In a first aspect of this application, a nucleic acid molecule is provided, comprising a promoter and a downstream regulatory sequence, wherein the regulatory sequence comprises an antisense oligonucleotide, a nucleic acid sequence encoding a RING domain of TRIM21, and a nucleic acid sequence encoding a target protein-specific binding domain, wherein the antisense oligonucleotide is capable of silencing the start codon or stop codon of the target protein, the RING domain of TRIM21 is used to degrade the target protein, and the target protein-specific binding domain is capable of specifically binding to the target protein or a marker protein linked to the target protein.

[0045] In this application, the term "codon" refers to the pattern in which three adjacent nucleotides in a messenger RNA molecule are grouped together to represent a specific amino acid during protein synthesis.

[0046] In this context, a codon is a triplet of nucleotide residues on mRNA (or DNA) that encodes a specific amino acid. The anticodon of tRNA is complementary to the mRNA codon. The start codon, also known as the initiation codon, is the codon that designates the site where protein synthesis begins. The termination codon is the codon that terminates protein synthesis and is not recognized by any tRNA carrying an amino acid. In this application, antisense oligonucleotides are designed to specifically target and silence the start or termination codon of the target protein's mRNA, thereby inhibiting the translation of that protein.

[0047] In some implementations, the target protein includes, but is not limited to, the Spike protein.

[0048] In some implementations, the antisense oligonucleotide sequence of the start codon of the silenced target protein is shown in SEQ ID NO:1.

[0049] In some implementations, the sequence of the antisense oligonucleotide of the stop codon of the silencing target protein is shown in SEQ ID NO: 2.

[0050] In some implementations, the nucleic acid sequence encoding the RING domain of TRIM21 is shown in SEQ ID NO: 3.

[0051] In some implementations, the marker protein linked to the target protein includes, but is not limited to, green fluorescent protein.

[0052] In some implementations, the specific binding domains of the target protein include, but are not limited to, nanobodies.

[0053] In some embodiments, the specific binding domain of the target protein specifically binds to a marker protein linked to the target protein. It is understood that the marker protein provides a universal, high-affinity binding site for the specific binding domain of the target protein, while facilitating real-time monitoring of the target protein's expression level, localization, and dynamic changes within the cell using techniques such as fluorescence microscopy and flow cytometry. For example, the nucleic acid sequence encoding the specific binding domain of the target protein is shown in SEQ ID NO: 4.

[0054] In some embodiments, the regulatory sequence from the 5' end to the 3' end is, in sequence, an antisense oligonucleotide, a nucleic acid sequence encoding the RING domain of TRIM21, and a nucleic acid sequence encoding the specific binding domain of the target protein.

[0055] In some implementations, the regulatory sequence, from the 5' end to the 3' end, consists of a nucleic acid sequence encoding the RING domain of TRIM21, an antisense oligonucleotide, and a nucleic acid sequence encoding the specific binding domain of the target protein.

[0056] In some implementations, the regulatory sequence, from the 5' end to the 3' end, consists of the nucleic acid sequence of the RING domain of TRIM21, the nucleic acid sequence encoding the specific binding domain of the target protein, and an antisense oligonucleotide.

[0057] In some embodiments, when the antisense oligonucleotide is located at the 5' or 3' end of the regulatory sequence, the RING domain of TRIM21 and the target protein-specific binding domain are linked by a linker peptide. For example, the nucleic acid sequence encoding the linker peptide is GGTGGAGGCGGTTCACTCGAG (SEQ ID NO: 5).

[0058] In some implementations, the promoter in the nucleic acid molecule is the CMV promoter.

[0059] In a second aspect of this application, a recombinant expression vector is provided, comprising the aforementioned nucleic acid molecules.

[0060] In some implementations, the backbone of the recombinant expression vector includes, but is not limited to, pCDNA3.1.

[0061] It should be noted that this application achieves simultaneous RNA editing and protein degradation by integrating RNA editing and protein degradation technologies, requiring only one plasmid vector, thereby enabling a more efficient reduction in protein concentration.

[0062] In a third aspect of this application, a recombinant cell is provided, comprising a recipient cell and the aforementioned recombinant expression vector. It is understood that the recombinant cell is obtained by introducing the aforementioned recombinant expression vector into a recipient cell.

[0063] In some embodiments, the recipient cell is a mammalian cell, and more specifically, the recipient cell is a HEK293T cell.

[0064] In a fourth aspect of this application, a method for degrading intracellular target proteins is provided, comprising introducing the aforementioned nucleic acid molecule or the aforementioned recombinant expression vector into cells expressing the target protein for culturing.

[0065] In some implementations, the above methods are for non-therapeutic purposes and can be used to establish cell models or perform target protein function analysis, etc.

[0066] In some implementations, the introduction may be carried out using methods conventional in the art, such as transfection, transduction, or transformation.

[0067] In some implementations, the target protein includes, but is not limited to, the Spike protein.

[0068] In a fifth aspect of this application, the use of the aforementioned nucleic acid molecule or the aforementioned recombinant expression vector in the preparation of products containing degraded proteins is provided.

[0069] In a sixth aspect of this application, the use of the aforementioned nucleic acid molecule or the aforementioned recombinant expression vector in the preparation of a medicament for treating novel coronavirus infection is provided.

[0070] The following are some examples.

[0071] The embodiments of this application will be described in detail below with reference to examples. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of this application. For experimental methods in the following embodiments where conditions are not specified, reference should be made to the guidelines given in this application, or to experimental manuals or conventional conditions in the art, or to the conditions recommended by the manufacturer, or to experimental methods known in the art.

[0072] In the following examples, the measurement parameters of the raw material components may have slight deviations within the weighing accuracy range unless otherwise specified. Temperature and time parameters are subject to acceptable deviations due to instrument testing accuracy or operational precision.

[0073] The key functional nucleic acid sequences involved in the following embodiments are shown in Table 1 below:

[0074] Table 1

[0075]

[0076] Unless otherwise specified, all test materials used in the following examples are commercially available products.

[0077] Example 1

[0078] 1. Plasmid construction:

[0079] 1.1 As shown in Table 2, synthesize the nucleic acid sequences required for each embodiment.

[0080] 1.2 Double digestion of pcDNA3.1-CMV-mCherry vector (128744, Addgene) and synthesized sequence with KpnI (R3142, NEB) and EcoRI (R3101, NEB): 5 μg of vector or synthesized sequence was added to 1 μL of KpnI and EcoRI restriction endonucleases, 5 μL of CutSmart digestion buffer (NEB), and enzyme-free water was added to a final volume of 50 μL. The mixture was incubated at 37°C for 15 minutes. 1% agarose gel electrophoresis was performed at a constant voltage of 100V for 1 hour. The target band was then cut and recovered according to the molecular weight. The digested vector and the fragment to be inserted were recovered using a plasmid extraction kit (DC201, Novizan). The digested vector and the fragment to be inserted were ligated using T4 DNA ligase (C301-01, Novizan): 2 μL of T4 DNA ligase buffer (Novizan), 50 ng of digested vector, 17.5 ng of digested fragment to be inserted, and 1 μL of T4 DNA ligase (Novizan) were added to a test tube, and enzyme-free water was added to a final volume of 20 μL. The mixture was incubated overnight at 16°C. The plasmid was then transformed into DH5α competent cells: the T4 ligated plasmid DNA was added to 100 μL of competent cells, incubated on ice for 30 minutes, heat-shocked at 42°C for 45 seconds, and then incubated on ice for 2 minutes. 900 μL of LB medium was added, and the mixture was incubated at 37°C with shaking for 1 hour. After centrifugation at 5000 rpm for 3 minutes, discard 850 μL of supernatant. Resuspend the bacterial cells in the remaining culture medium and spread evenly on LB agar plates containing the appropriate antibiotic. Incubate overnight at 37°C. The next day, select single colonies and transfer them to LB liquid medium. Shake at 37°C for 8-12 hours. Extract plasmid DNA using the Novizan Bacterial DNA Extraction Kit (DC103). This plasmid DNA can then be used for subsequent cell transfection experiments.

[0081] 2. Cell transfection:

[0082] 2.1 The plasmid constructed in 1.2 was transfected into the HEK293T cell line stably expressing GFP using liposomes. First, 400,000 cells were seeded into each well of a six-well plate one day before transfection.

[0083] 2.2 Add 125 μL of Opti-MEM medium (31985062, Thermo Fisher Scientific), 2.5 μg of DNA, and 4 μL of Lipo8000 transfection reagent (C0533, Beyotime Biotechnology) to a test tube. Mix well, and then add 125 μL to a cell culture plate. Continue culturing for 24 hours, and then change the medium in the cell culture plate.

[0084] 3. Microscopic photography and ImageJ analysis

[0085] The experimental results shown in the embodiments of this application were obtained by taking pictures with an inverted fluorescence microscope (Zeiss Corporation), and the cell fluorescence intensity was analyzed by ImageJ software (version 1.53a, developed by NIH).

[0086] Table 2. Complete nucleic acid sequences of plasmid multiple cloning sites designed in the embodiments of this application.

[0087]

[0088]

[0089]

[0090]

[0091] Example 2

[0092] like Figure 2 As shown, firstly, an ASO is inserted into the 5' end of the mTA. This ASO can bind to and silence the start codon expressing the SARS-CoV-2 Spike protein. The mTA then binds to GFP-labeled SARS-CoV-2 Spike via a GFP-binding nanobody (vhhGFP), ultimately degrading the SARS-CoV-2 Spike protein. This degradative plasmid contains an mCherry fluorescent protein as an expression level reporter protein, such as... Figure 2 As shown, over time, more cells exhibited stronger red fluorescence on day 3 after transfection, while the green fluorescence within these cells was significantly degraded. Fluorescence analysis was performed using ImageJ software: First, cells containing red fluorescence were selected, and the intensity of green fluorescence within these cells was analyzed. On day 3 after transfection, the green fluorescence intensity in cells expressing red fluorescence accounted for only 1.74% of the total green fluorescence in the field of view. Compared to day 1 after plasmid transfection, green fluorescent protein was significantly degraded.

[0093] Example 3

[0094] like Figure 3 As shown, first, the ASO is inserted into the mTA's Linker. (And...) Figure 2 Similarly, this ASO can bind to the start codon expressing the SARS-CoV-2 Spike protein and silence the start codon; while mTA can bind to GFP-labeled SARS-CoV-2 Spike via a GFP-binding nanobody (vhhGFP), ultimately degrading the SARS-CoV-2 Spike protein. Figure 3As shown, over time, more cells exhibited stronger red fluorescence on day 3 after transfection, while the green fluorescence within these cells was significantly degraded. Fluorescence analysis was performed using ImageJ software: First, cells containing red fluorescence were selected, and the intensity of green fluorescence within these cells was analyzed. On day 3 after transfection, the green fluorescence intensity in cells expressing red fluorescence accounted for only 2.01% of the total green fluorescence in the field of view. Compared to day 1 after plasmid transfection, green fluorescent protein was significantly degraded.

[0095] Example 4

[0096] like Figure 4 As shown, the first step of the study is to insert ASO into the 3' end of the mTA. (Compared to...) Figure 2 Consistent with previous results, this ASO effectively binds to the start codon of the SARS-CoV-2 Spike protein and silences its expression. Meanwhile, mTA achieves degradation of the SARS-CoV-2 Spike protein by binding to a GFP-labeled SARS-CoV-2 Spike protein via a nanobody (vhhGFP) bound to green fluorescent protein (GFP). As the experiments progressed, Figure 4 The results showed that on day 3 after transfection, an increasing number of cells exhibited significantly enhanced red fluorescence. Simultaneously, the GFP-labeled SARS-CoV-2 Spike protein within these cells was effectively degraded. To quantitatively analyze this phenomenon, ImageJ software was used to analyze the fluorescence signal. First, cells displaying red fluorescence were selected for further analysis of the intensity of green fluorescence within these cells. The results showed that on day 3 after transfection, the intensity of green fluorescence within cells expressing red fluorescence accounted for only 1.52% of the total green fluorescence in the field of view. This result, compared to day 1 after plasmid transfection, indicates a significant decrease in the expression level of green fluorescent protein, demonstrating the effectiveness of ASO insertion into the 3' end of mTA in degrading SARS-CoV-2 Spike protein.

[0097] Example 5

[0098] To investigate whether transfection and expression of ASO and mTA using two different plasmids resulted in higher protein degradation and inhibition effects, such as... Figure 5As shown, this example used two plasmids to express ASO and mTA respectively. On the third day after plasmid transfection, the GFP fluorescence intensity in mCherry-expressing cells accounted for 3.89% of the total fluorescence intensity. This inhibition efficiency is lower compared to inserting ASO and mTA into the same vector. The reason for this is mainly because most cells are transfected with only one of the expression plasmids, ASO or mTA, and only a small number of cells can be transfected with both plasmids simultaneously. In cells transfected with only one plasmid, the protein inhibition effect is weaker than that of ASO and mTA acting simultaneously.

[0099] Example 6

[0100] like Figure 6 As shown, firstly, an ASO is inserted into the 5' end of the mTA. This ASO binds to the stop codon expressing the SARS-CoV-2 Spike protein, silencing the start codon by converting the stop codon TAA to TGG. The mTA then binds to GFP-labeled SARS-CoV-2 Spike via a GFP-binding nanobody (vhhGFP), ultimately degrading the SARS-CoV-2 Spike protein. This degradative plasmid contains an mCherry fluorescent protein as an expression level reporter protein, such as... Figure 6 As shown, over time, more cells exhibited stronger red fluorescence on day 3 after transfection, while the green fluorescence within these cells was significantly degraded. Fluorescence analysis was performed using ImageJ software: First, cells containing red fluorescence were selected, and the intensity of green fluorescence within these cells was analyzed. On day 3 after transfection, the green fluorescence intensity in cells expressing red fluorescence accounted for only 3.76% of the total green fluorescence in the field of view. Compared to day 1 after plasmid transfection, green fluorescent protein was significantly degraded.

[0101] Example 7

[0102] like Figure 7 As shown, first, the ASO is inserted into the mTA's Linker. (And...) Figure 6 Similarly, this ASO can bind to and disrupt the stop codon expressing the SARS-CoV-2 Spike protein; while mTA can bind to GFP-labeled SARS-CoV-2 Spike via a GFP-binding nanobody (vhhGFP), ultimately degrading the SARS-CoV-2 Spike protein. Figure 6As shown, over time, more cells exhibited stronger red fluorescence on day 3 after transfection, while the green fluorescence within these cells was significantly degraded. Fluorescence analysis was performed using ImageJ software: First, cells containing red fluorescence were selected, and the intensity of green fluorescence within these cells was analyzed. On day 3 after transfection, the green fluorescence intensity in cells expressing red fluorescence accounted for only 2.77% of the total green fluorescence in the field of view. Compared to day 1 after plasmid transfection, green fluorescent protein was significantly degraded.

[0103] Example 8

[0104] like Figure 8 As shown, the first step of the study is to insert ASO into the 3' end of the mTA. (Compared to...) Figure 6 , Figure 7 Consistent with the results, this ASO effectively binds to and disrupts the stop codon of the SARS-CoV-2 Spike protein, thereby reducing the expression level of the SARS-CoV-2 Spike protein. Meanwhile, mTA achieves degradation of the SARS-CoV-2 Spike protein by binding to GFP-labeled SARS-CoV-2 Spike protein via a nanobody (vhhGFP) that binds to green fluorescent protein (GFP). As the experiment progressed, Figure 8 The results showed that on day 3 after transfection, an increasing number of cells exhibited significantly enhanced red fluorescence. Simultaneously, the GFP-labeled SARS-CoV-2 Spike protein within these cells was effectively degraded. To quantitatively analyze this phenomenon, ImageJ software was used to analyze the fluorescence signal. First, cells displaying red fluorescence were selected for further analysis of the intensity of green fluorescence within these cells. The results showed that on day 3 after transfection, the intensity of green fluorescence within cells expressing red fluorescence accounted for only 4.92% of the total green fluorescence in the field of view. This result, compared to day 1 after plasmid transfection, indicates a significant decrease in the expression level of green fluorescent protein, demonstrating the effectiveness of ASO insertion into the 3' end of mTA in degrading SARS-CoV-2 Spike protein.

[0105] Example 9

[0106] To investigate whether transfection and expression of ASO and mTA using two different plasmids resulted in higher protein degradation and inhibition effects, such as... Figure 9As shown, this embodiment used two plasmids to express ASO and mTA respectively. On the third day after plasmid transfection, the GFP fluorescence intensity in mCherry-expressing cells accounted for 4.71% of the total fluorescence intensity. This inhibition efficiency is comparable to inserting ASO and mTA into the same vector. The reason for this is that disrupting the stop codon is less effective at inhibiting protein expression than silencing the start codon, and the reduction in target protein concentration depends more on the degradation effect of mTA on the target protein. Therefore, whether ASO and mTA are expressed in two separate vectors makes little difference.

[0107] Example 10

[0108] Figure 10 The efficiencies of eight methods for inhibiting protein expression and degrading proteins in Examples 2-9 were compared. Overall, the start codon of a silenced gene was more effective at inhibiting protein expression than the stop codon of a disrupted gene. Among the start codon schemes for silencing genes, inserting ASO into the 5' end of mTA resulted in the strongest inhibition of protein expression, and this inhibitory effect was superior to expressing ASO and mTA separately using two plasmids. Therefore, this application proposes a novel protein inhibition technology and preliminarily applies it to the targeted degradation of the SARS-CoV-2 Spike protein. This method provides new insights for the future development of therapeutic strategies against SARS-CoV-2 and its variants, especially important in the context of the COVID-19 pandemic, where finding effective and safe drugs is crucial. It can provide strong technical support for clinical applications.

[0109] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0110] The embodiments described above are merely illustrative of several implementation methods of this application, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the protection scope of this application. Therefore, the protection scope of this patent application should be determined by the appended claims, and the specification and drawings can be used to interpret the content of the claims.

Claims

1. A nucleic acid molecule, characterized in that, The nucleic acid molecule includes a promoter and downstream regulatory sequences, wherein the regulatory sequences include an antisense oligonucleotide, a nucleic acid sequence encoding the RING domain of TRIM21, and a nucleic acid sequence encoding a target protein-specific binding domain. The antisense oligonucleotide can silence the start codon or stop codon of the target protein, the RING domain of TRIM21 is used to degrade the target protein, and the target protein-specific binding domain can specifically bind to the target protein or a marker protein linked to the target protein.

2. The nucleic acid molecule as described in claim 1, characterized in that, The target proteins include the Spike protein.

3. The nucleic acid molecule as described in claim 2, characterized in that, The sequence of the antisense oligonucleotide of the start codon of the silencing target protein is shown in SEQ ID NO: 1; and / or, the sequence of the antisense oligonucleotide of the stop codon of the silencing target protein is shown in SEQ ID NO:

2.

4. The nucleic acid molecule as described in claim 2, characterized in that, The nucleic acid sequence encoding the RING domain of TRIM21 is shown in SEQ ID NO:

3.

5. The nucleic acid molecule as described in claim 2, characterized in that, One or more of the following conditions must be met: The labeled protein includes green fluorescent protein; The specific binding domain of the target protein includes nanobodies.

6. The nucleic acid molecule as described in claim 5, characterized in that, The nucleic acid sequence encoding the specific binding domain of the target protein is shown in SEQ ID NO:

4.

7. The nucleic acid molecule according to any one of claims 1 to 6, characterized in that, The regulatory sequence, from the 5' end to the 3' end, consists of an antisense oligonucleotide, a nucleic acid sequence encoding the RING domain of TRIM21, and a nucleic acid sequence encoding the specific binding domain of the target protein; and / or, The regulatory sequence, from the 5' end to the 3' end, consists of a nucleic acid sequence encoding the RING domain of TRIM21, an antisense oligonucleotide, and a nucleic acid sequence encoding the specific binding domain of the target protein; and / or, The regulatory sequence, from the 5' end to the 3' end, consists of the nucleic acid sequence of the RING domain of TRIM21, the nucleic acid sequence encoding the specific binding domain of the target protein, and an antisense oligonucleotide.

8. A recombinant expression vector, characterized in that, The recombinant expression vector comprises the nucleic acid molecule as described in any one of claims 1 to 7.

9. The use of the nucleic acid molecule according to any one of claims 1 to 7 or the recombinant expression vector according to claim 8 in the degradation of intracellular target proteins, characterized in that, It includes the following steps: The nucleic acid molecule according to any one of claims 1 to 7 or the recombinant expression vector according to claim 8 is introduced into cells expressing the target protein and cultured.

10. The use of the nucleic acid molecule according to any one of claims 1 to 7 or the recombinant expression vector according to claim 8 in the preparation of a medicament for treating novel coronavirus infection.