Use of fabp4 in the preparation of products for diagnosing preeclampsia and drugs for treating preeclampsia
By using FABP4 as a diagnostic biomarker and therapeutic target, an early diagnosis and precise treatment plan for preeclampsia is provided, which solves the problems of difficult diagnosis and ineffective treatment in existing technologies and achieves highly specific diagnosis and effective treatment.
Patent Information
- Application Number
- CN202610316371.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-16
- Publication Date
- 2026-06-05
Smart Images

Figure CN122146876A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and more specifically, to the application of FABP4 in the preparation of diagnostic products and therapeutic drugs for preeclampsia. Background Technology
[0002] Preeclampsia (PE) is a serious disease that occurs during pregnancy. It has become a major factor threatening maternal and infant health and significantly increasing maternal and perinatal morbidity and mortality. The global incidence rate is approximately 2% to 8%.
[0003] Currently, the academic community generally believes that the core pathogenesis of preeclampsia (PE) is closely related to placental trophoblastic cell dysfunction, maternal insulin resistance, and systemic vascular endothelial damage. Specifically, it can be divided into two stages: The first stage occurs in early pregnancy, where insufficient trophoblastic cell invasion leads to impaired remodeling of the uterine spiral arteries, resulting in a chronic ischemic and hypoxic state of the placenta. The second stage occurs in mid-to-late pregnancy, where the ischemic and hypoxic placenta releases large amounts of anti-angiogenic factors, pro-inflammatory mediators, and reactive oxygen species into the maternal bloodstream, triggering a systemic inflammatory response, severe oxidative stress, and widespread vascular endothelial cell damage, ultimately manifesting clinically as typical symptoms such as hypertension and proteinuria. Recent studies have shown that placental metabolic reprogramming, lipid metabolism disorders, and mitochondrial dysfunction play crucial roles in the occurrence and development of preeclampsia, which is even considered a "metabolic disease of the placenta."
[0004] Despite ongoing research into the pathogenesis of preeclampsia, its complex and heterogeneous etiology still leaves clinicians lacking ideal indicators and drug targets for early and accurate prediction, diagnosis, and effective treatment. Diagnosis currently relies primarily on blood pressure monitoring and urine protein testing; however, these traditional indicators represent non-specific clinical manifestations in the middle to late stages of the disease. By the time pregnant women develop significant hypertension and proteinuria, placental pathological damage and maternal systemic endothelial damage are often already irreversible and severe. Treatment currently focuses on symptomatic and supportive care, with common strategies including antihypertensive drugs to control maternal blood pressure and magnesium sulfate to prevent eclamptic seizures. However, these symptomatic treatments only temporarily alleviate maternal symptoms and cannot reverse the core pathological processes such as placental trophoblast cell dysfunction, ischemia-hypoxia, and lipid metabolism imbalance. Therefore, the optimal treatment for preeclampsia is currently termination of pregnancy and placental delivery. This passive intervention not only leads to a very high rate of premature birth but also makes newborns highly susceptible to severe premature complications, imposing a heavy medical and economic burden on families and society.
[0005] Therefore, there is a need to develop highly specific diagnostic biomarkers and therapeutic drugs for preeclampsia. Summary of the Invention
[0006] The technical problem to be solved by this invention is how to achieve effective diagnosis and treatment of preeclampsia.
[0007] To solve the above-mentioned technical problems, the first aspect of the present invention provides an application of FABP4 detection reagent in the preparation of preeclampsia diagnostic products. The FABP4 gene is located on the long arm of chromosome 8, region 2, band 1, subband 3, with coordinates 81478419-81483236 and a length of 4818 bp, including 4 exons and 3 introns.
[0008] A second aspect of the present invention provides a preeclampsia diagnostic product, the preeclampsia diagnostic product comprising the FABP4 expression level detection reagent described in the first aspect.
[0009] Preferably, the FABP4 expression level detection reagent includes a FABP4 mRNA expression level detection reagent and / or a FABP4 protein expression level detection reagent.
[0010] Preferably, the FABP4 mRNA expression level detection reagent includes the primer pairs shown in SEQ ID No. 1 to SEQ ID No. 2.
[0011] Preferably, the FABP4 protein expression level detection reagent includes an antibody that specifically binds to the FABP4 protein.
[0012] A third aspect of the present invention provides the use of a FABP4 inhibitor in the preparation of a drug for the treatment of preeclampsia, wherein the FABP4 inhibitor includes a FABP4 gene expression inhibitor and / or a FABP4 protein inhibitor.
[0013] Preferably, the FABP4 gene expression inhibitor includes a small interfering RNA that targets and inhibits FABP4 expression.
[0014] Preferably, the small interfering RNA targeting and inhibiting FABP4 expression is selected from any one or more of si144, si267, and si371, wherein... The si144 consists of the nucleotide sequences shown in SEQ ID No. 3 and SEQ ID No. 4; The si267 is composed of the nucleotide sequences shown in SEQ ID No. 5 and SEQ ID No. 6; The si371 consists of the nucleotide sequences shown in SEQ ID No. 7 and SEQ ID No. 8.
[0015] Preferably, the FABP4 protein inhibitor is the small molecule inhibitor BMS309403.
[0016] Compared with the prior art, the present invention has the following beneficial effects: 1. This invention is the first to demonstrate that FABP4 can be used as a diagnostic marker for preeclampsia, and confirms that the expression level of FABP4 is high in maternal serum and placental tissue of patients with preeclampsia. This not only fills the gap in the current clinical lack of high-specificity early screening indicators for preeclampsia, but also provides an extremely reliable direct molecular target for the future development of minimally invasive and convenient early diagnostic kits for preeclampsia, and has clinical auxiliary diagnostic application value. 2. This invention is the first to demonstrate that FABP4 can be directly used as a therapeutic target for preeclampsia, confirming the key driving role of FABP4 in maintaining abnormal energy metabolism and pathological proliferation of trophoblast cells. It also confirms that FABP4 inhibitors can effectively break the vicious cycle of pathological metabolism-inflammatory stress that triggers preeclampsia, laying a solid foundation for the development of drugs for the treatment of preeclampsia and opening up a new avenue for the precision treatment of preeclampsia. Attached Figure Description
[0017] Figure 1 The amplification curve and melting curve are shown in Example 1 of this invention; Figure 2 The results of the linear regression equation and R² value calculation in Example 1; Figure 3 The results show the comparison of FABP4 expression levels in serum and placental samples from PE patients and healthy controls in Example 1. Figure 4 The results of ROC curve evaluation for the diagnostic value of serum FABP4 for PE in Example 1 were used. Figure 5 The results of the inhibitor intervention experiment in Example 2; Figure 6 The CCK-8 results are from Example 2; Figure 7 The results of JC-1 fluorescence staining in Example 2; Figure 8 The results of ATP content detection in Example 2; Figure 9 The results of DCFH-DA staining to assess ROS levels in Example 2 are shown. Detailed Implementation
[0018] To make the above-mentioned objects, features, and advantages of the present invention more apparent and understandable, specific embodiments of the present invention are described in detail below. It should be noted that the following embodiments are only used to illustrate the implementation methods and typical parameters of the present invention, and are not intended to limit the parameter range described in the present invention. Reasonable variations derived therefrom are still within the protection scope of the present invention.
[0019] As described in the background section, currently, there is a lack of advanced diagnostic markers and therapeutic targets for preeclampsia in clinical practice. In view of this, specific embodiments of the present invention provide the application of FABP4 in the preparation of preeclampsia diagnostic products and preeclampsia treatment drugs.
[0020] The present invention provides an application of a FABP4 detection reagent in the preparation of a preeclampsia diagnostic product. The FABP4 gene is located on the long arm of chromosome 8, region 2, band 1, subband 3, with coordinates 81478419-81483236 and a length of 4818 bp, including 4 exons and 3 introns.
[0021] More specifically, the mRNA sequence of FABP4 can be found in NCBI: NM_001442.3.
[0022] Another embodiment of the present invention provides a preeclampsia diagnostic product, the preeclampsia diagnostic product comprising the FABP4 expression level detection reagent described in the first aspect.
[0023] In the above embodiments, the FABP4 expression level detection reagent includes a FABP4 mRNA expression level detection reagent and / or a FABP4 protein expression level detection reagent.
[0024] More specifically, the FABP4 mRNA expression level detection reagent includes the primer pairs shown in SEQ ID No. 1 to SEQ ID No. 2. Among them, SEQ ID No.1: TGGCATGGCCAAACCTAACA; SEQ ID No. 2: CACATGTACCAGGACACCCC.
[0025] In the above embodiments, the FABP4 protein expression level detection reagent includes an antibody that specifically binds to the FABP4 protein.
[0026] More specifically, the antibody that specifically binds to the FABP4 protein can be a humanized monoclonal antibody or a polyclonal antibody.
[0027] A specific embodiment of the present invention also provides the application of a FABP4 inhibitor in the preparation of a drug for the treatment of preeclampsia.
[0028] In the above embodiments, the FABP4 inhibitor includes FABP4 gene expression inhibitors and / or FABP4 protein inhibitors.
[0029] In the above embodiments, the FABP4 gene expression inhibitor includes a small interfering RNA that targets and inhibits FABP4 expression.
[0030] In the above embodiments, the small interfering RNA that targets and inhibits FABP4 expression is selected from any one or more of si144, si267, and si371.
[0031] Specifically, si144 consists of the nucleotide sequences shown in SEQ ID No. 3 and SEQ ID No. 4; si267 consists of the nucleotide sequences shown in SEQ ID No. 5 and SEQ ID No. 6; and si371 consists of the nucleotide sequences shown in SEQ ID No. 7 and SEQ ID No. 8, wherein... SEQ ID No.3: GGGCUUUGCCACCAGGAAATT; SEQ ID No.4:UUUCCUGGUGGCAAAGCCCTT; SEQ ID No.5: GGGCCAGGAAUUUGACGAATT; SEQ ID No.6:UUCGUCAAAUUCCUGGCCCTT; SEQ ID No.7: CAACCACCAUAAAGAGAAATT; SEQ ID No. 8: UUUCUCUUUAUGGUGGUUGTT.
[0032] In the above embodiments, the FABP4 protein inhibitor is preferably the small molecule inhibitor BMS309403.
[0033] The technical solution of the present invention is further described below through specific embodiments. It should be noted that the endpoints and any values of the ranges disclosed herein are not limited to the precise ranges or values; these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of various ranges, the endpoint values of various ranges and individual point values, and individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.
[0034] Example 1 Validation of FABP4 as a diagnostic marker for preeclampsia This study included serum samples from 96 patients with preeclampsia (PE) and 100 healthy controls. Placental tissue was also collected from 25 PE patients and 21 healthy controls. All samples were collected at Ningbo University Women and Children's Hospital between January 2024 and October 2025. The study strictly adhered to the ethical guidelines established by the Declaration of Helsinki, fully protecting and ensuring the rights and safety of participants. All participants met the diagnostic criteria for preeclampsia established by the International Society for the Study of Hypertension in Pregnancy (ISSSHP), and all included subjects were singleton pregnancies with a gestational age of ≥28 weeks. Patients with other systemic diseases that might interfere with the study results were excluded, specifically including macrovascular infections, diabetes, metabolic syndrome, various infectious diseases, renal dysfunction, and malignant tumors. This study protocol was submitted to the Ethics Committee of Ningbo University Women and Children's Hospital for review before implementation and was formally approved (Approval No.: EC2023-093), ensuring that the study design and execution process complied with ethical standards.
[0035] After blood collection, all samples were allowed to stand at room temperature for 30 minutes, centrifuged at 4°C (3000 rpm, 10 min), and the supernatant was collected, aliquoted, and stored at -80°C. Placental tissue was collected immediately after delivery, with each sample containing approximately 50 mg. The sampling site was selected at least 2 cm from the edge of the placenta, avoiding areas of obvious infarction or calcification. The samples were fixed in 10% neutral formalin, flash-frozen in liquid nitrogen, and then transferred to an ultra-low temperature freezer at -80°C for long-term stable storage to ensure the quality of biological samples for subsequent experimental analysis.
[0036] Total RNA was extracted from serum samples using the centrifugation column method, and total RNA was extracted from tissues and cells using the RNA-easy method. All RNA samples were stored in an ultra-low temperature freezer at -80°C.
[0037] The extracted RNA was quantified to 1000 ng and then reverse transcribed. The reaction system was prepared according to the reverse transcription kit instructions shown in Table 1, and the reverse transcription conditions were shown in Table 2.
[0038] Table 1 Table 2 After obtaining cDNA from reverse transcription, the relative expression level of FABP4 was calculated using real-time quantitative PCR with GADPH as an internal control and the 2^-ΔΔCt method. The reaction system for real-time quantitative PCR is shown in Table 3. The conditions for real-time quantitative PCR were: 95℃ for 10 min, 95℃ for 15 s, 60℃ for 34 s, and 72℃ for 30 s, for a total of 45 cycles. The relevant primers are shown in Table 4.
[0039] Table 3 Table 4 The amplification and melting curves of all samples for real-time quantitative PCR are as follows: Figure 1 As shown, where, Figure 1 The left figure in the image is the amplification curve. Figure 1 The right figure in the image shows the melting curve, which is... Figure 1 As can be seen, all samples showed a single specific peak, with no extraneous peaks or non-specific amplification, indicating that the primers had good specificity.
[0040] A standard curve was established using cDNA gradient dilution experiments (dilution ratios of 1:1, 1:10, 1:100, 1:1000, 1:1000, 1:10000, and 1:100000). The linear regression equation and R² value were calculated, and the results are as follows: Figure 2 As shown, by Figure 2 As can be seen, the R² value of FABP4 is 0.9956, and the linear regression equation is Y = -2.338X + 23.59 ( Figure 2 (A in the original text); the R² value of the internal reference gene GAPDH is 0.9984, and the linear equation is Y = -2.031X + 19.41 (…). Figure 2 (B in the figure) indicates that the method has a good linear relationship within the detection range, and the quantification is accurate and reliable, making it suitable for comparison and correlation analysis of FABP4 expression levels.
[0041] For a comparison of FABP4 expression levels in serum samples from PE patients and healthy controls, see [link to relevant documentation]. Figure 3 The expression levels of FABP4 in placental tissue samples from A, PE patients and healthy controls are compared in [reference needed]. Figure 3 B in the text. (The rest of the text appears to be a list of characters and symbols, possibly related to a document or instruction.) Figure 3 It was observed that the relative expression level of serum FABP4 mRNA in the PE group was significantly higher than that in the healthy control group (P<0.001), suggesting that elevated circulating FABP4 levels may reflect the systemic pathological state of PE. The results of placental tissue analysis were consistent with those of serum analysis; the expression level of FABP4 mRNA in placental tissue of the PE group was significantly upregulated compared to the control group (P<0.01), confirming that FABP4 is highly expressed locally in the placenta of PE patients.
[0042] To explore the association between FABP4 levels and the clinical phenotype of PE, 96 PE patients were divided into a high-expression group (n=48) and a low-expression group (n=48) based on the median serum FABP4 level. The correlation between FABP4 and metabolic indicators and placental function indicators was systematically analyzed.
[0043] The results showed that patients in the high-expression group had more significant lipid metabolism disorders. Specifically, the proportion of patients with triglyceride (TG) >2.5 mmol / L was significantly higher in the high-expression group than in the low-expression group (43.8% vs 18.8%, P<0.001), the proportion of patients with total cholesterol (TC) >5.2 mmol / L was significantly higher (89.6% vs 62.5%, P=0.002), and the proportion of patients with low-density lipoprotein (LDL) >3.12 mmol / L was also significantly increased (54.2% vs 33.3%, P=0.040). Furthermore, the proportion of patients with BMI ≥24 kg / m² in the high-expression group showed an increasing trend (50.0% vs 33.3%, P=0.098). These results suggest that high FABP4 expression is closely related to maternal metabolic disorders, supporting its biological characteristics as a biomarker of lipid metabolism abnormalities.
[0044] The high FABP4 expression group exhibited more severe placental dysfunction and adverse pregnancy outcomes. Three placental-maternal function indicators—mean arterial pressure (MAP), 24-hour urinary protein, and birth weight—were significantly worse in the high-expression group: MAP was (114.60±9.60) mmHg, higher than the low-expression group's (109.30±8.02) mmHg (P=0.004); 24-hour urinary protein reached (1.92±1.20) g, approximately 1.7 times that of the low-expression group (P<0.001); and the newborn's birth weight was only (1937.88±829.61) g, lower than the low-expression group's (2282.50±679.21) g (P=0.028). These associations link maternal circulating FABP4 levels with placental dysfunction and fetal growth restriction, suggesting that FABP4 may be involved in the pathological process of preeclampsia placenta.
[0045] All data were analyzed using SPSS Statistics 29.0 and GraphPad Prism 9.0. Quantitative data were first tested for normality. Normally distributed data were expressed as mean ± standard deviation (x ± s), and independent samples t-tests were used for comparisons between two groups. Data that were not normally distributed were expressed as median (interquartiles), and Mann-Whitney U tests were used for comparisons between two groups. A p-value < 0.05 was considered statistically significant. Receiver operating characteristic (ROC) curves and area under the curve (AUC) were created and calculated to assess the diagnostic efficacy of serum FABP4 for PE. All trials were performed independently at least three times. The diagnostic value of serum FABP4 for PE was evaluated using ROC curves. Results are as follows: Figure 4 As shown, where, Figure 4 In the figure, A represents the ROC curve for FABP4 distinguishing between PE patients and healthy controls. Figure 4 B in the figure represents the ROC curve for FABP4 in differentiating between mild and severe PE patients. Figure 4 As can be seen, the AUC of FABP4 in distinguishing PE from healthy controls was 0.774 (95% CI: 0.71-0.84), indicating that it has moderate diagnostic efficacy.
[0046] Example 2 Validation of the therapeutic potential of FABP4 inhibitors This embodiment uses siRNA-mediated gene silencing and the FABP4 small molecule inhibitor BMS309403 for intervention validation. First, three siRNA sequences targeting different sites of FABP4 (si144, si371, si267) were designed, while a non-specific sequence was set up as a negative control (NC, composed of the nucleotide sequences shown in SEQ ID No. 9 and SEQ ID No. 10, where SEQ ID No. 9: UUCUCCGAACGUGUCACGUTT; SEQ ID No. 10: ACGUGACACGUUCGGAGAATT). Related experiments were performed using HTR-8 / SVneo cells.
[0047] For siRNA, LiPo3000 reagent was used to transfect siRNA. Taking a six-well plate as an example, 5 μL of siRNA was transfected into each well of cells. For BMS309403, DMSO was first used to prepare a 10 mM stock solution of BMS309403. In this example, the concentration of BMS309403 was 0 µM, 20 µM, 40 µM, 60 µM, 80 µM, and 100 µM.
[0048] After transfection or drug administration, cell viability was assessed using the CCK-8 assay and EdU cell proliferation assay. Inhibitor intervention results were as follows: Figure 5 As shown, the intervention results of siRNA are as follows: Figure 5 As shown in A, the intervention results of BMS309403 are as follows: Figure 5 As shown in B, by Figure 5 As can be seen, the siRNA and BMS309403 provided in this embodiment can significantly inhibit the expression of FABP4. All three siRNAs can effectively downregulate the expression of FABP4, among which si267 has the highest silencing efficiency. The half-maximal inhibitory concentration (IC50) of BMS309403 on trophoblast cells is 70µM.
[0049] The results of the CCK-8 experiment are as follows: Figure 6 As shown, where, Figure 6 In the figure, A represents the effect of FABP4 siRNA (si267) transfection at different time points (24h, 48h, 72h) on the proliferation of trophoblast cells as detected by the CCK8 assay. Figure 6 B in the figure represents the effect of the FABP4 inhibitor BMS309403 on the proliferation of trophoblast cells at different time points (24h, 48h, 72h). Figure 6 In the figure, C represents the effect of EdU proliferation assay on the proliferation activity of trophoblast cells after transfection with FABP4 siRNA (si267); Figure 6 In the figure, D represents the effect of the FABP4 inhibitor BMS309403 on the proliferation activity of trophoblast cells as detected by the EdU proliferation assay. CCK-8 results showed that cell viability was significantly lower in both the siRNA-mediated gene silencing and the intervention with the FABP4 small molecule inhibitor BMS309403 compared to the NC group. The EdU assay results also indicated that the proportion of EdU-positive cells was significantly lower in both the siRNA and BMS309403 groups compared to the NC group (P<0.01). In conclusion, inhibition of FABP4 can suppress the proliferation of trophoblast cells in vitro.
[0050] To clarify the changes in mitochondrial membrane potential after FABP4 function restriction, this study used the JC-1 fluorescent probe dye to detect changes in trophoblast cells. The results are as follows: Figure 7 As shown, Figure 7 In the figure, A represents the change in mitochondrial membrane potential of trophoblast cells after transfection with FABP4 siRNA (si267). Figure 7In the figure, B represents the change in mitochondrial membrane potential of trophoblast cells after treatment with the FABP4 inhibitor BMS309403. JC-1 staining results showed that the red / green fluorescence intensity ratio in the siRNA group was significantly lower than that in the NC group (P<0.001). The BMS309403 group was also significantly lower than that in the NC group (P<0.001). These results indicate that inhibition of FABP4 can induce a significant decrease in mitochondrial membrane potential in trophoblast cells.
[0051] Given that mitochondrial membrane potential is a key electrochemical gradient driving oxidative phosphorylation to synthesize ATP, its decrease may directly affect cellular energy supply. To clarify the ultimate impact of impaired FABP4 function on trophoblast energy metabolism, this study further used bioluminescence assays to detect intracellular ATP levels. The results are as follows: Figure 8 As shown, Figure 8 In the figure, A represents the expression of mitochondrial ATP in trophoblast cells after transfection with FABP4 siRNA (si267). Figure 8 In the figure, B represents the expression of mitochondrial ATP in trophoblast cells after administration of the FABP4 inhibitor BMS309403. The results showed that the ATP content in the siRNA group was significantly lower than that in the NC group (P<0.01), and the BMS309403 group also resulted in a significant decrease in intracellular ATP content (P<0.01). These experimental results indicate that inhibition of FABP4 impairs the mitochondrial energy metabolism function of trophoblast cells, leading to reduced ATP production.
[0052] Reactive oxygen species (ROS) levels are an important indicator for assessing intracellular oxidative stress. In this embodiment, the fluorescent probe DCFH-DA was used to quantitatively detect intracellular ROS levels by flow cytometry. The results are as follows: Figure 9 As shown, Figure 9 In the figure, A represents the expression of ROS in trophoblast cells after the application of the FABP4 inhibitor BMS309403. Figure 9 In this context, B represents the quantitative analysis of average fluorescence intensity, derived from... Figure 9 As can be seen, compared with the NC group, the fluorescence signal distribution of the BMS309403 group was significantly shifted to the right, and the mean fluorescence intensity (MFI) was significantly increased (P<0.001).
[0053] The above results indicate that the siRNA and BMS309403 provided in this embodiment have the potential to become FABP4 inhibitors and thus be used as drugs for the treatment of preeclampsia.
[0054] While the disclosure is as stated above, its scope of protection is not limited thereto. Those skilled in the art can make various changes and modifications without departing from the spirit and scope of this disclosure, and all such changes and modifications will fall within the protection scope of this invention.
Claims
1. The application of FABP4 detection reagent in the preparation of preeclampsia diagnostic products, characterized in that, The FABP4 gene is located on the long arm of chromosome 8, region 2, band 1, subband 3, with coordinates 81478419-81483236, and a length of 4818 bp, including 4 exons and 3 introns.
2. A preeclampsia diagnostic product, characterized in that, The preeclampsia diagnostic product includes the FABP4 detection reagent as described in claim 1.
3. The preeclampsia diagnostic product as described in claim 2, characterized in that, The FABP4 detection reagent includes a FABP4 mRNA expression level detection reagent and / or a FABP4 protein expression level detection reagent.
4. The preeclampsia diagnostic product as described in claim 3, characterized in that, The FABP4 mRNA expression level detection reagent includes the primer pairs shown in SEQ ID No. 1 to SEQ ID No.
2.
5. The preeclampsia diagnostic product as described in claim 3, characterized in that, The FABP4 protein expression level detection reagent includes an antibody that specifically binds to the FABP4 protein.
6. The application of FABP4 inhibitors in the preparation of drugs for the treatment of preeclampsia, characterized in that, The FABP4 inhibitors include FABP4 gene expression inhibitors and / or FABP4 protein inhibitors.
7. The application as described in claim 6, characterized in that, The FABP4 gene expression inhibitor includes small interfering RNA that targets and inhibits FABP4 expression.
8. The application as described in claim 7, characterized in that, The small interfering RNA targeting and inhibiting FABP4 expression is selected from any one or more of si144, si267, and si371, wherein... The si144 consists of the nucleotide sequences shown in SEQ ID No. 3 and SEQ ID No. 4; The si267 is composed of the nucleotide sequences shown in SEQ ID No. 5 and SEQ ID No. 6; The si371 consists of the nucleotide sequences shown in SEQ ID No. 7 and SEQ ID No.
8.
9. The application as described in claim 6, characterized in that, The FABP4 protein inhibitor is the small molecule inhibitor BMS309403.