New use of RNA binding protein HNRNPA1 in regulating copper death of rheumatoid arthritis synovial fibroblasts
By identifying and binding to the m6A modification sites of copper death-related genes in RA-FLS using HNRNPA1, the stability of their mRNA is enhanced, and the copper death pathway is activated, thus solving the problems of abnormal proliferation and death resistance in RA-FLS and achieving the effects of inhibiting proliferation and repairing mitochondrial damage.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- FIRST AFFILIATED HOSPITAL OF ANHUI UNIV OF CHINESE MEDICINE
- Filing Date
- 2026-03-18
- Publication Date
- 2026-06-09
Smart Images
Figure CN122163762A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular target research technology for rheumatic and immune diseases, specifically involving a novel application of an RNA-binding protein, HNRNPA1, in regulating copper death in synovial fibroblasts of rheumatoid arthritis. Background Technology
[0002] Rheumatoid arthritis (RA) is a systemic autoimmune disease characterized by chronic synovitis, articular cartilage and bone destruction. Synovial fibroblasts (FLS), as the main mesenchymal cell type in synovial tissue, exhibit tumor-like biological behaviors in the pathological process of RA, including abnormal proliferation, apoptosis resistance, excessive secretion of inflammatory factors, and enhanced invasiveness. They are one of the core effector cells driving synovial hyperplasia and joint structural destruction. Although the abnormal activation mechanism of RA-FLS has been extensively studied, the regulatory relationship between its metabolic reprogramming and novel programmed cell death patterns remains insufficiently understood.
[0003] In recent years, copper death (Cuproptosis) has emerged as a newly discovered copper-dependent programmed cell death mechanism. Its mechanism primarily relies on the lipoylation modification of mitochondrial respiratory chain-related proteins. Under copper overload conditions, it triggers protein aggregation, loss of iron-sulfur clusters, and proteotoxic stress, ultimately leading to cell death. Unlike traditional apoptosis, necrosis, and ferroptosis, Cuproptosis does not depend on caspase activation or lipid peroxidation, but rather specifically targets cells with active mitochondrial metabolism. Respiratory-associated leukocyte-fluidocyte syndrome (RA-FLS) exhibits the pathological characteristics of mitochondrial hyperfunction and active metabolism, suggesting that it may be a potential target cell type for Cuproptosis.
[0004] On the other hand, the role of epitranscriptome regulation in the pathogenesis of rheumatoid arthritis (RA) is receiving increasing attention. N6-methyladenosine (m6A) modification, as the most abundant form of RNA epigenetic modification, has a regulatory network composed of three classes of proteins: "writers," "erasers," and "readers." Among them, HNRNPA1 (Heterogeneous Nuclear Ribonucleoprotein A1), as one of the classic m6A reading proteins, is widely involved in the regulation of mRNA stability, splicing, and translation efficiency, and is abnormally expressed in various inflammatory diseases. Previous studies have suggested that HNRNPA1 may be involved in immune cell activation and inflammatory signal transduction. Summary of the Invention
[0005] This invention provides a novel use of the RNA-binding protein HNRNPA1 in regulating copper death in synovial fibroblasts of rheumatoid arthritis (RA-FLS), aiming to intervene in the abnormal proliferation and death resistance of RA-FLS through epigenetic transcriptional regulation mechanisms, and to provide a new molecular strategy for targeted therapy of RA-FLS.
[0006] Specifically, this invention discovers that HNRNPA1, as an m6A reading protein, can enhance the stability of the mRNA transcript by recognizing m6A modification sites on the mRNA of copper death-related genes, thereby activating the copper death pathway, inducing RA-FLS death, and inhibiting its proliferation.
[0007] Furthermore, overexpression of HNRNPA1 can recognize and bind to the m6A modification site of SLC3A2 mRNA, enhance its transcript stability, restore the expression of SLC3A2 and copper death-related proteins ATP7B, DLAT, FDX1, and SLC31A, reduce malondialdehyde (MDA) levels, increase copper ion concentration and the activity of antioxidant enzymes SOD and POD, thereby repairing mitochondrial ultrastructural damage, inhibiting abnormal cell proliferation and inducing apoptosis.
[0008] Furthermore, this invention verifies that SLC3A2 is one of the key downstream target genes regulated by HNRNPA1. Knockdown of SLC3A2 reverses HNRNPA1-mediated copper death activation and proliferation inhibition. Overexpression of HNRNPA1 significantly upregulates the mRNA and protein expression levels of SLC3A2, accompanied by the recovery of expression of copper death-related proteins (such as ATP7B, DLAT, FDX1, and SLC31A). In addition, it can significantly improve abnormalities in copper death-related biochemical indicators in RA-FLS, including reducing malondialdehyde (MDA) levels, increasing copper ion concentration and antioxidant enzyme (SOD, POD) activity, and repairing mitochondrial ultrastructural damage.
[0009] It is worth noting that the regulatory effect of HNRNPA1 on SLC3A2 does not depend on changes in the abundance of its m6A modification, but rather on enhancing the stability or translation efficiency of its mRNA by recognizing existing m6A sites, thus demonstrating its functional characteristics as an m6A reading protein.
[0010] At the functional level, HNRNPA1 overexpression can significantly inhibit the proliferation of RA-FLS, and in vitro experiments showed a significant decrease in cell viability, suggesting its potential application value in reversing the pathological phenotype of RA-FLS. Attached Figure Description
[0011] Figure 1 To detect the mRNA and protein expression of key copper death genes in RA-FLS.
[0012] Figure 2To detect the mRNA and protein expression of the m6A regulatory gene associated with copper death in RA.
[0013] Figure 3 The effects of HNRNPA1 overexpression on the copper death phenotype, biochemical parameters, mitochondrial structure and proliferation in RA-FLS.
[0014] Figure 4 Analysis of the regulatory effect of HNRNPA1 on SLC3A2 and the m6A mechanism.
[0015] Figure 5 To verify the efficiency of SLC3A2 siRNA screening and knockdown.
[0016] Figure 6 Experimental validation of SLC3A2 as a key downstream target of HNRNPA1. Detailed Implementation
[0017] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings.
[0018] Example 1
[0019] 1. Cell Culture
[0020] Human synovial fibroblasts (FLS) were cultured in DMEM complete medium containing 10% fetal bovine serum at 37°C in a 5% CO2 incubator. Cells in good growth condition from passage 3 to 8 were selected for subsequent experiments.
[0021] 2. Cell transfection
[0022] When the cell confluence in the 6-well plate reached 70%, transfection was performed using GP-transfect-Mate transfection reagent (Germart, catalog number G04009). In the gene knockdown assay, a transfection complex was prepared in each well using 4 μL of SLC3A2-specific siRNA, 8 μL of transfection reagent, and 750 μL of serum-free medium. In the plasmid overexpression and siRNA co-transfection assay, a complex was prepared in each well using 1 μg of pcDNA3.1-HNRNPA1 overexpression plasmid, 2 μL of siRNA, 4 μL of transfection reagent, and 1250 μL of serum-free medium. The complexes were incubated at room temperature for 20 min before being added to cell culture plates. After 4 h, the medium was replaced with complete medium, and the cells were cultured for another 48 h. Transfection efficiency was verified by RT-qPCR.
[0023] 3. HNRNPA1 overexpression
[0024] The pcDNA3.1-HNRNPA1 overexpression plasmid or the pcDNA3.1 empty vector control was transfected into RA-FLS cells using the 2-cell transfection method. Cells were collected 48 h after transfection for subsequent functional analysis.
[0025] 4. SLC3A2 gene knockdown
[0026] SLC3A2-specific siRNA or negative control si-NC was transfected into RA-FLS cells using the 2-cell transfection method to verify the function of SLC3A2.
[0027] 5. HNRNPA1 overexpression and SLC3A2 knockdown co-transfection
[0028] In RA-FLS, the pcDNA3.1-HNRNPA1 plasmid and SLC3A2-specific siRNA (or corresponding control) were simultaneously transfected using a 2-cell co-transfection method to verify whether the function of HNRNPA1 depends on SLC3A2.
[0029] 6. RT-qPCR
[0030] Total RNA was extracted from cells using the TRIzol method, and its concentration and purity were determined using an ultra-micro spectrophotometer. 1 μg of RNA was used to synthesize cDNA using a reverse transcription kit containing dsDNase. Real-time quantitative PCR was performed using SYBR GreenMaster Mix on an ABI StepOne Plus system. The reaction program was: 95℃ pre-denaturation for 30 s, followed by 40 cycles (95℃ denaturation for 15 s, 60℃ annealing / extension for 30 s). Relative gene expression levels were measured using a 22... ⁻△△Ct The method was used for calculation, with β-actin as the internal reference gene. Primers for each detection indicator are as follows:
[0031] Gene Amplicon Size (bp) Forward primer (5'→3') Reverse primer (5'→3') Hu-β-actin 96 CCCTGGAGAAGAGCTACGAG GGAAGGAAGGCTGGAAGAGT Hu-CBLL1 90 GGGTGGTCTTGATGTTCGCA GTTCTTTGAGTTCGCGGTGC Hu-DKC1 126 CGGAAGTGGGGTTTAGGTCC TTTGGCAGACTCATCCTGCT Hu-FBL 190 ATTGACTCCACAGCCTCAGC TCTCTCGCAATCCTGACAGC Hu-IGF2BP3 200 CTTCCTGGTGAAGACTGGCT TATCCAGCACCTCCCACTGTAA Hu-YTHDC1 134 CATCTTCCGTTCGTGCTGTC GGACCATACACCCTTCGCTT Hu-ACTG2 163 TGTGTGAAGAGGAGACCACC ACATAGCTGTCTTTCTGGCCC Hu-MYH10 154 TGGTCTTCATGAGCCACCAG TGCCATCAGCTTGGTGAGAG Hu-NCKAP1 154 AGAAGCAAGGACAAGTTTGGA TGTAGTTGTGCAAGCTGTTGA Hu-SLC3A2 95 GCAAGGCTCCTGACTTCCTT CCGTAGCTGAAAACAGGGGT Hu-HNRNPA1 131 GCAATAGCAGGTGGAACCCT GGAGCCATTCGCGCTATACT
[0032] 7. Western blot
[0033] Protein concentration was determined using the BCA method. 20 μg of total protein was subjected to SDS-PAGE electrophoresis and then transferred to a PVDF membrane. The membrane was blocked with TBST solution containing 5% skim milk powder at room temperature for 2 h, incubated overnight at 4°C with the corresponding primary antibody, washed, and then incubated with HRP-labeled secondary antibody at room temperature for 2 h. Development was performed using an ECL chemiluminescence kit, with β-actin as an internal control, and grayscale values were determined using ImageJ software. The primary antibody was as follows:
[0034] Product Name factory Item number batch number Theoretical molecular weight Antibody source Dilution ratio Separating gel concentration β-actin Zs-BIO TA-09 19AW0505 42kDa mice 1:1000 10% Goat anti-mouse IgG Zs-BIO ZB-2305 142637 1:10000 Goat anti-rabbit IgG Zs-BIO ZB-2301 139931 1:10000 FDX1 Affinity DF7950 81q5719 19kDa rabbit 1:1000 10% DLAT Proteintech 13426-1-AP 00022666 70kDa rabbit 1:2000 10% SLC31A Zenbio R27288 M20DE3P 21kDa rabbit 1:500 10% ATP7B Affinity AF0410 35h9072 157kDa rabbit 1:500 10%
[0035] 8. m6A-RIP-qPCR
[0036] Total RNA was extracted from cells using the TRIzol method (Thermo Fisher, catalog number 15596018). 10 μg of RNA was used to construct a 200 μL immunocapture system with m6A antibody and Affinity Beads (with a non-Immune IgG negative control and a positive control included). After incubation at room temperature for 90 min, the system was treated with NDE / CEM, magnetically attached, and washed with WB / PDB buffer. Input samples (1 μg RNA) were processed simultaneously and, along with the immunocapture samples, released RNA via Protein Digestion Solution (incubation at 55°C for 15 min). RNA was recovered using RNA Binding Beads and eluted with Elution Buffer. 10 μL of enriched RNA was collected and cDNA was synthesized using the NovoScript® Reverse Transcription Kit (Novoprotein, catalog number E041-01B) (42℃ for 20 min, 75℃ for 5 min). The cDNA was then detected using the NovoStart® SYBR qPCR SuperMix (Novoprotein, catalog number E099-01B) on an ABIStepOne Plus instrument. A 20 μL reaction mixture contained SLC3A2-specific primers (upstream 5'-GGGCCTGGACTCTTCTCCTA-3', downstream 5'-GGCCCACATCCCCAAAGTTA-3', amplifying a fragment of 82 bp). The reaction conditions were: 95℃ pre-denaturation for 1 min, 40 cycles (95℃ for 20 s, 60℃ for 45 s), using 2... ⁻△△Ct The relative enrichment degree is calculated using the method.
[0037] (1) The reaction system is as follows:
[0038] system volume 2×NovoStart®SYBR High-Sensitivity qPCR SuperMix 10uL Forward Primer (10µM) 0.4uL Reverse Primer (10µM) 0.4uL cDNA 2uL RNase Free Water 7.2uL Total 20uL
[0039] (2) The primers for each detection indicator are as follows:
[0040] Gene Amplicon Size (bp) Forward primer (5'→3') Reverse primer (5'→3') Hu-SLC3A2 82 GGGCCTGGACTCTTCTCCTA GGCCCACATCCCCAAAGTTA
[0041] 9. Cell proliferation assay (CCK-8 assay)
[0042] After digestion and resuspension of FLS and RA-FLS, 1×10⁻⁶ ppm was used per well. 4 One cell line, 100 μL, was seeded into 96-well plates and incubated overnight at 37°C with 5% CO2. RA-FLS cells were transfected and cultured for another 48 h. Then, 10 μL of CCK-8 solution was added to each well, and after incubation for 1 h, the absorbance was measured at 450 nm using a microplate reader. Cell-free culture medium + CCK-8 solution served as a blank control.
[0043] 10. Transmission electron microscopy observation
[0044] Cell samples were prefixed with 2.5% glutaraldehyde, postfixed with 1% osmium tetroxide, dehydrated with graded ethanol, impregnated with propylene oxide, and then embedded in epoxy resin (Eponate 12). Ultrathin sections of 70 nm thickness were prepared using a Leica UC-7 microtome, stained with lead citrate, and observed and imaged under a JEM1400 transmission electron microscope.
[0045] 11. Detection of Copper-Related Biochemical Indicators for Mortality
[0046] The relevant indicators were detected using reagent kits developed by Nanjing Jiancheng: Malondialdehyde (MDA, catalog number A003-1) was detected using the TBA method, with the sample reacting with the reagent at 95℃ for 40 min, and then quantified colorimetrically at 532 nm; Superoxide dismutase (SOD, catalog number A001-3) was detected using the WST-1 method, with the absorbance measured at 450 nm after incubation at 37℃ for 20 min, and enzyme activity calculated based on inhibition rate; Peroxidase (POD, catalog number A084-2-1) was detected by catalyzing the hydrogen peroxide reaction, with enzyme activity measured colorimetrically at 420 nm after reaction at 37℃ for 30 min; Copper ions (Catalog number E010-1-1) were detected using the complexation colorimetric method, with the absorbance of the blue complex measured at 600 nm after incubation at 37℃, and concentration calculated using a standard curve.
[0047] Experimental results:
[0048] Figure 1 The mRNA expression levels of four key copper death genes in normal synovial fibroblasts (FLS) and RA-FLS were detected using RT-qPCR. The results showed that the mRNA expression levels of SLC3A2, NCKAP1, MYH10, and ACTG2 were significantly reduced in RA-FLS compared to the FLS control group. Western blot analysis revealed that the protein expression levels of SLC3A2, NCKAP1, MYH10, and ACTG2 also showed a significant decreasing trend, consistent with the mRNA expression characteristics.
[0049] Figure 2The results, obtained via RT-qPCR, showed that compared to the FLS control group, the mRNA expression of CBLL1, DKC1, FBL, HNRNPA1, and YTHDC1 was significantly decreased in RA-FLS, while the mRNA expression of IGF2BP3 was significantly increased. Further Western blot analysis also revealed decreased protein expression of CBLL1, DKC1, FBL, HNRNPA1, and YTHDC1 in RA-FLS, while IGF2BP3 protein expression was increased. Based on the validation results of RT-qPCR and Western blot, HNRNPA1 showed the most significant expression difference between the RA group and the normal control group, and was therefore selected as the core target for further in-depth mechanistic research.
[0050] Figure 3 To verify the core regulatory role of HNRNPA1, an HNRNPA1 overexpression experiment was conducted in RA-FLS cells, with RA-FLS cells transfected with an empty vector serving as a control (OE-NC group). Compared with the OE-NC group, HNRNPA1 overexpression effectively reversed the abnormal expression of key copper death proteins ATP7B, DLAT, FDX1, and SLC31A; it also significantly improved the disturbances of copper death-related biochemical indicators in RA-FLS, including reduced malondialdehyde (MDA) levels, upregulated copper ion concentration, and increased expression of superoxide dismutase (SOD) and peroxidase (POD). Furthermore, transmission electron microscopy revealed that it could repair mitochondrial ultrastructural damage. In cell function experiments, CCK-8 results showed that HNRNPA1 overexpression significantly inhibited the proliferation of RA-FLS cells compared with the OE-NC group. These results indicate that upregulating HNRNPA1 can improve the disease phenotype of RA-FLS by reversing the copper death phenotype and inhibiting cell proliferation.
[0051] Figure 4To investigate the molecular mechanism by which HNRNPA1 reverses the disease phenotype of RA-FLS, this study first verified its regulatory relationship with SLC3A2, a key gene for copper death. Western blot and RT-qPCR results showed that overexpression of HNRNPA1 in RA-FLS significantly upregulated both the protein and mRNA expression of SLC3A2, suggesting that HNRNPA1 may be a potential upstream positive regulator of SLC3A2. Given that HNRNPA1 is a classic m6A reading protein, this invention further investigated whether this regulation depends on its alteration of the m6A modification level of SLC3A2 mRNA. m6A-RIP-qPCR analysis showed that compared with normal FLS, the enrichment of m6A modification in SLC3A2 mRNA was significantly reduced in RA-FLS; however, after overexpression of HNRNPA1, the abundance of m6A modification did not change significantly. This suggests that the upregulation of SLC3A2 by HNRNPA1 is not achieved by changing the abundance of its m6A modification, but may depend on the regulation of mRNA stability or translation efficiency after m6A site recognition.
[0052] Figure 5 To verify whether SLC3A2 is a key downstream target of HNRNPA1 function, three siRNAs targeting SLC3A2 were first screened by qPCR. The results showed that all three siRNAs significantly reduced the mRNA expression level of SLC3A2. Among them, SLC3A2-siRNA1 showed the highest knockdown efficiency, and this sequence was used in subsequent experiments.
[0053] Figure 6 The results of the follow-up experiments showed that, compared with si-NC, the expression of key copper death proteins ATP7B, DLAT, FDX1, and SLC31A was significantly downregulated in the si-SLC3A2 group, oxidative stress was aggravated (decreased SOD activity), copper homeostasis was disrupted (increased MDA levels, decreased POD activity and copper ion content), and RA-FLS proliferation activity was significantly enhanced, suggesting that SLC3A2 is a key factor in maintaining RA-FLS homeostasis. More importantly, after overexpression of HNRNPA1 on the basis of si-SLC3A2, although the copper ion level, MDA, and POD levels differed from those in the RA group, none of the above molecular, biochemical, and proliferation indicators recovered to the si-NC level, and there was no substantial improvement compared with the si-SLC3A2 group. In summary, knocking down SLC3A2 significantly blocked the activation of copper death and the inhibition of RA-FLS proliferation by HNRNPA1, confirming that the function of HNRNPA1 is highly dependent on its downstream target SLC3A2.
Claims
1. A novel application of RNA-binding protein HNRNPA1 in regulating copper death in synovial fibroblasts of rheumatoid arthritis, characterized by, Overexpression of HNRNPA1 can recognize and bind to the m6A modification site of SLC3A2 mRNA, enhance its transcript stability, restore the expression of SLC3A2 and copper death-related proteins ATP7B, DLAT, FDX1, and SLC31A, reduce malondialdehyde (MDA) levels, increase copper ion concentration and the activity of antioxidant enzymes SOD and POD, thereby repairing mitochondrial ultrastructural damage, inhibiting abnormal cell proliferation and inducing apoptosis.
2. The novel use of the RNA-binding protein HNRNPA1 as described in claim 1 in regulating copper death in synovial fibroblasts of rheumatoid arthritis, characterized in that, HNRNPA1 regulation of SLC3A2 mRNA does not increase the abundance of its m6A modification, but only relies on its reading function of existing m6A sites.
3. The novel use of the RNA-binding protein HNRNPA1 as described in claim 1 in regulating copper death in synovial fibroblasts of rheumatoid arthritis, characterized in that, SLC3A2 is a downstream target essential for the function of HNRNPA1. Knocking down SLC3A2 can reverse HNRNPA1-mediated copper death activation and proliferation inhibition.
4. A novel use of the RNA-binding protein HNRNPA1 as described in any one of claims 1-3 in regulating copper death in synovial fibroblasts of rheumatoid arthritis, characterized in that, Formulations that achieve overexpression of the RNA-binding protein HNRNPA1 can be used in the preparation of formulations that regulate copper death in synovial fibroblasts of rheumatoid arthritis.
5. The novel use of the RNA-binding protein HNRNPA1 as described in claim 4 in regulating copper death in synovial fibroblasts of rheumatoid arthritis, characterized in that, The formulation for overexpressing the RNA-binding protein HNRNPA1 is the pcDNA3.1-HNRNPA1 overexpression plasmid or its functional nucleotide sequence.