A mixed enzyme preparation for catalytically synthesizing d-chiro-inositol and a preparation method of d-chiro-inositol
By mutating specific amino acid sequences of inositol dehydrogenase and ketoisomerase, a mixed enzyme preparation was constructed and co-expressed in recombinant strains, solving the problem of low enzyme activity and achieving efficient production and cost reduction of D-chiral inositol.
Patent Information
- Application Number
- CN202610334516.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-18
- Publication Date
- 2026-06-09
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and in particular to a mixed enzyme preparation for catalytic synthesis of D-chiral inositol and a method for preparing D-chiral inositol. Background Technology
[0002] D-chiro-inositol (DCI) is one of the nine isomers of inositol that is optically active. Recent studies have found that, in addition to its role in promoting hepatic lipid metabolism, D-chiro-inositol also possesses unique physiological functions such as insulin sensitization, blood sugar reduction, improvement of ovulation in patients with polycystic ovary syndrome, regulation of hormone balance, improvement of menstrual disorders, and antioxidant, anti-aging, and anti-inflammatory effects.
[0003] Inositol is oxidized to 2-ketoinositol under the catalysis of inositol dehydrogenase (IDH); 2-ketoinositol then undergoes isomerization to 1-ketoinositol under the catalysis of ketoisomerase (IS); 1-ketoinositol is then reduced again under the catalysis of inositol dehydrogenase to finally produce chiral inositol. However, existing technologies generally suffer from low enzyme activity of ketoisomerases and inositol dehydrogenases, resulting in limited overall conversion rates, which is a key bottleneck restricting the yield of D-chiral inositol.
[0004] Therefore, traditional techniques need to be improved. Summary of the Invention
[0005] In view of this, the present invention provides a mixed enzyme preparation for catalytic synthesis of D-chiral inositol and a method for preparing D-chiral inositol, which overcomes the defects of low enzyme activity of ketoisomerases and inositol dehydrogenases in the prior art, which leads to limited overall conversion rate.
[0006] To achieve the above objectives, in a first aspect, the present invention provides a mixed enzyme preparation for catalyzing the synthesis of D-chiral inositol, the mixed enzyme preparation having enzymatic activity for catalyzing the reaction of muscle inositol to D-chiral inositol, the mixed enzyme preparation comprising an inositol dehydrogenase mutant and a ketoisomerase mutant, the amino acid sequence of the inositol dehydrogenase mutant being any one of the following: (1) The 95th amino acid in the amino acid sequence shown in SEQ ID NO.1 is mutated from K to R; (2) The 124th amino acid in the amino acid sequence shown in SEQ ID NO.1 is mutated from R to K; (3) The amino acid sequence shown in SEQ ID NO.1 is obtained by mutating the 95th amino acid from K to R and the 124th amino acid from R to K; The amino acid sequence of the ketoisomer mutant is shown in any of the following: (1) The 99th amino acid in the amino acid sequence shown in SEQ ID NO.3 is mutated from T to S; (2) The 213th amino acid in the amino acid sequence shown in SEQ ID NO.3 is mutated from D to N; (3) The 99th amino acid in the amino acid sequence shown in SEQ ID NO.3 is mutated from T to S, and the 213th amino acid is mutated from D to N.
[0007] Compared with the prior art, the present invention mutates specific sites of wild-type inositol dehydrogenase (amino acid sequence as shown in SEQ ID NO.1) and wild-type ketoisomerase (amino acid sequence as shown in SEQ ID NO.3). After mutation, the resulting inositol dehydrogenase mutant and ketoisomerase mutant have higher enzyme activities, which can significantly improve the conversion rate of D-chiral inositol in the process of catalyzing the reaction of muscle inositol to produce chiral inositol.
[0008] Furthermore, the enzyme activity ratio of the inositol dehydrogenase mutant to the ketoisomerase mutant is 0.5:(0.5-2).
[0009] Furthermore, the amino acid sequence of the inositol dehydrogenase mutant is shown in any of the following: (1) The amino acid sequence shown in SEQ ID NO.23; (2) The amino acid sequence shown in SEQ ID NO.24; (3) The amino acid sequence shown in SEQ ID NO.25.
[0010] The amino acid sequence shown in SEQ ID NO.23 is the inositol dehydrogenase mutant K95R, the amino acid sequence shown in SEQ ID NO.24 is the inositol dehydrogenase mutant R124K, and the amino acid sequence shown in SEQ ID NO.25 is the inositol dehydrogenase mutant K95R / R124K.
[0011] The encoding gene for the inositol dehydrogenase mutant K95R is shown in SEQ ID NO.26; the encoding gene for the inositol dehydrogenase mutant R124K is shown in SEQ ID NO.27; and the encoding gene for the inositol dehydrogenase mutants K95R / R124K is shown in SEQ ID NO.28.
[0012] Furthermore, the amino acid sequence of the ketoisomerase mutant is shown in any of the following examples: (1) The amino acid sequence shown in SEQ ID NO.29; (2) The amino acid sequence shown in SEQ ID NO.30; (3) The amino acid sequence shown in SEQ ID NO.31.
[0013] The amino acid sequence shown in SEQ ID NO.29 is the ketoisomerase mutant T99S, the amino acid sequence shown in SEQ ID NO.30 is the ketoisomerase mutant D213N, and the amino acid sequence shown in SEQ ID NO.31 is the ketoisomerase mutant T99S / D213N.
[0014] The coding gene for the ketoisomerase mutant T99S is shown in SEQ ID NO.32; the coding gene for the ketoisomerase mutant D213N is shown in SEQ ID NO.33; and the coding gene for the ketoisomerase mutants T99S / D213N is shown in SEQ ID NO.34.
[0015] Secondly, the present invention provides a method for preparing a mixed enzyme preparation, comprising the following steps: A recombinant strain containing both the inositol dehydrogenase mutant encoding gene and the ketoisomerase mutant encoding gene was constructed. The recombinant strain was fermented and cultured to induce the expression of the inositol dehydrogenase mutant and the ketoisomerase mutant.
[0016] Specifically, the preparation process of the above-mentioned mixed enzyme preparation includes the following steps: Recombinant strains containing both the inositol dehydrogenase mutant gene and the ketoisomerase mutant gene were seed cultured to obtain seed liquid. The seed culture was inoculated into the fermentation medium at an inoculation rate of 1% to 5% by volume for fermentation culture. When the dissolved oxygen level rose, feeding was started, and the culture was continued until the OD reached 50%. 600 When the OD value reaches 65-75, add an inducing agent for induction culture until the OD value reaches 65-75. 600 The value stops increasing, and fermentation broth is obtained; The fermentation broth is centrifuged to collect the bacterial cells. After the bacterial cells are resuspended, the cells are broken up, centrifuged again, and the supernatant is collected to obtain the crude enzyme solution of the mixed enzyme preparation.
[0017] The seed culture involves inoculating the recombinant strain into LB liquid medium and culturing it with shaking at 30℃~40℃ and 200rpm~300rpm for 5h~6h to obtain a seed culture. The fermentation culture temperature is 30℃~40℃, and the air volume is 0.5m³ / h. 3 / h~1m 3 / h, rotation speed of 200rpm~400rpm, pressure of 0.01MPa~0.05MPa, pH value of 6.5~7.5, dissolved oxygen content of 15%~35%; and / or, The induction culture temperature is 25℃~35℃, the inducer is L-arabinose, and the final concentration of the inducer is 1g / L~5g / L.
[0018] Compared with existing technologies, this invention co-expresses an inositol dehydrogenase mutant and a ketoisomerase mutant to construct a single recombinant engineered strain, replacing the existing method of constructing cells with two enzymes separately. This simplifies the production process of D-chiral inositol, shortens the production cycle, and reduces the cost of cell culture, making it more suitable for large-scale industrial production.
[0019] Thirdly, the present invention provides the use of the aforementioned mixed enzyme preparation, the use of which includes catalyzing the reaction of muscle inositol to produce D-chiral inositol.
[0020] Fourthly, the present invention provides a method for preparing D-chiral inositol, comprising adding muscle inositol and NAD to a 25mM~50mM buffer solution. + The crude enzyme solution, containing metal ions and mixed enzyme preparations, was used to make the concentration of muscle inositol in the reaction system 150g / L~300g / L, and NAD+. + The concentration of the enzyme is 0.5mM~1mM, the total concentration of crude enzyme in the mixed enzyme preparation is 2mg / ml~8mg / ml, and the concentration of metal ions is 2mM~5mM.
[0021] The metal ions include manganese ions, magnesium ions, or zinc ions; the buffer solution includes PBS buffer, Tris-HCl buffer, or HEPE buffer; the reaction temperature is 50℃~70℃, and the pH value is 7~9.
[0022] Compared with the prior art, the enzyme preparation of the present invention, which includes specific inositol dehydrogenase mutants and ketoisomerase mutants, can effectively improve the conversion rate of D-chiral inositol by catalyzing the reaction of muscle inositol to D-chiral inositol. Detailed Implementation
[0023] To make the technical problems to be solved, the technical solutions, and the beneficial effects of the present invention clearer, the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are only for explaining the present invention and are not intended to limit the present invention.
[0024] It should be understood that, unless otherwise specified, all raw materials used in the following examples are commercially available.
[0025] Example 1: Construction of the recombinant expression vector pYB1s-ioIG1-GT501 S1. The amino acid sequences of wild-type inositol dehydrogenase ioIG and wild-type ketoisomerase GT50 were artificially synthesized and mutated. Alpha-Fold site prediction was used, and saturation mutation screening was performed on the predicted key sites. Finally, the ioIG mutants K95R, R124K, and K95R / R124K and the GT50 mutants T99S, D213N, and T99S / D213N were obtained. The amino acid sequence of wild-type inositol dehydrogenase ioIG is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.2; the amino acid sequence of wild-type ketoisomerase GT50 is shown in SEQ ID NO.3, and the nucleotide sequence is shown in SEQ ID NO.4.
[0026] The amino acid sequence of the ioIG mutant K95R is shown in SEQ ID NO.23; the amino acid sequence of the ioIG mutant R124K is shown in SEQ ID NO.24; and the amino acid sequence of the ioIG mutant K95R / R124K is shown in SEQ ID NO.25.
[0027] The nucleotide sequence encoding the ioIG mutant K95R is shown in SEQ ID NO.26; the nucleotide sequence encoding the ioIG mutant R124K is shown in SEQ ID NO.27; and the nucleotide sequence encoding the ioIG mutant K95R / R124K is shown in SEQ ID NO.28.
[0028] The amino acid sequence of the GT50 mutant T99S is shown in SEQ ID NO.29; the amino acid sequence of the GT50 mutant D213N is shown in SEQ ID NO.30; and the amino acid sequence of the GT50 mutant T99S / D213N is shown in SEQ ID NO.31.
[0029] The nucleotide sequence encoding the GT50 mutant T99S is shown in SEQ ID NO.32; the nucleotide sequence encoding the GT50 mutant R124K is shown in SEQ ID NO.33; and the nucleotide sequence encoding the GT50 mutant K95R / R124K is shown in SEQ ID NO.34.
[0030] S2. Using F1 as the upstream primer and F2 as the downstream primer, and the nucleotide sequence shown in SEQ ID NO.2 as the template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.) to obtain the correct ioIG1 gene fragment. The PCR amplification system is shown in Table 1.
[0031] S3. Using F3 as the upstream primer and F4 as the downstream primer, and the nucleotide sequence shown in SEQ ID NO.4 as the template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.) to obtain the correct GT501 gene fragment. The PCR amplification system is shown in Table 1.
[0032] S4. Using pYB1s-F as the upstream primer and pYB1s-R as the downstream primer, and using the empty pYB1s vector as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.) to obtain the correct pYB1s expression vector fragment. The PCR amplification system is shown in Table 1.
[0033] Table 1 PCR system (10 μL) Components volume 5×Phusion HF buffer (reaction buffer) 2μL dNTPs (2.5 mmol / L) (deoxyribonucleotides) 0.8μL template 0.2μL upstream primer 0.3μL Downstream primer 0.3μL DMSO (dimethyl sulfoxide) 0.3μL Phu high-fidelity DNA polymerase (2 U / μl) 0.1μL <![CDATA[ddH2O]]> 6μL The PCR reaction procedures for all of the above were as follows: pre-denaturation: 98℃ pre-denaturation for 3 min; amplification cycle: 98℃ denaturation for 10 s, 55℃ annealing for 30 s, 72℃ extension for 4.5 min, 32 cycles; completion: 72℃ extension for 10 min.
[0034] S5. The ioIG1 gene fragment, GT501 gene fragment, and pYB1s expression vector fragment were ligated using the Gibson assembly method (10 μL system). The ligation system is shown in Table 2. The Gibson ligation product was obtained. The Gibson ligation product was then added to *E. coli* DH5α competent cells (Beijing TransGen Biotech Co., Ltd.), incubated on ice for 30 min, then in a 42 ℃ water bath for 90 s, and then placed on ice for 2 min. 1 mL of LB medium was then added, and the cells were incubated at 37 ℃ for 1 h on a shaker. Finally, the cells were plated on LB agar plates containing streptomycin sulfate and incubated overnight at 37 ℃. Single clones were picked, plasmids were extracted, and sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for sequencing verification. The correctly sequenced vector was named pYB1s-ioIG1-GT501.
[0035] Table 2 Gibson linkage reaction system Components Volume / μL expression vector pYB1s 2 ioIG gene fragment 1 GT50 gene fragment 1 2× Heiff Clone Enzyme Premix 5 Double distilled water (DDW) To 10 The sequences of the above primers F1~F4, pYB1s-F, and pYB1s-R are as follows (5) , -3 , ): F1:GCTAACAGGAGGAATTAACCATGCTAAATGTAGGAGTTATAGG, SEQ ID NO.5; F2:TCTCCTTGGTAGTTGAGGACTTTTTATAAAATTCCGGCTTCTC, SEQ ID NO.6; F3: TACCAGATCTACCCTCGAGCTCGAGTCAAACACGTTCAAT, SEQ ID NO.7; F4:GTCCTCAACTACCAAGGAGAAAACGAGCTCATGAAGTTAGT; SEQ ID NO.8; pYB1s-F: CTCGAGGGTAGATCTGGTAC, SEQ ID NO.9; pYB1s-R: GGTTAATTCCTCCTGTTAGC, SEQ ID NO. 10.
[0036] Example 2: Construction of the recombinant expression vector pYB1s--GT502--ioIG2 S1. Using F5 as the upstream primer and F6 as the downstream primer, and the nucleotide sequence shown in SEQ ID NO.2 as the template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.). The PCR amplification system is shown in Table 1. The PCR amplification reaction procedure is as described in Example 1, and the correct ioIG2 gene fragment is obtained.
[0037] S2. Using F7 as the upstream primer and F8 as the downstream primer, and the nucleotide sequence shown in SEQ ID NO.4 as the template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.). The PCR amplification system is shown in Table 1. The PCR amplification reaction procedure is as described in Example 1, and the correct GT502 gene fragment is obtained.
[0038] S3. Using pYB1s-F as the upstream primer, pYB1s-R as the downstream primer, and the pYB1s empty vector as the template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aibote Biotechnology Co., Ltd.). The PCR amplification system is shown in Table 1. The PCR amplification reaction procedure is as described in Example 1 to obtain the correct pYB1s expression vector fragment.
[0039] S4. The GT502 gene fragment, ioIG2 gene fragment, and pYB1s expression vector fragment were ligated using the Gibson assembly method (10 μL system). The ligation system is shown in Table 2. The Gibson ligation product was obtained. The Gibson ligation product was then added to DH5α competent cells (Beijing TransGen Biotech Co., Ltd.), incubated on ice for 30 min, then incubated in a 42 ℃ water bath for 90 s, and then placed on ice for 2 min. 1 mL of LB medium was then added, and the cells were incubated at 37 ℃ for 1 h on a shaker. Finally, the cells were plated on LB agar plates containing streptomycin sulfate and incubated overnight at 37 ℃. Single clones were picked, plasmids were extracted, and sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for sequencing verification. The correctly sequenced vector was named pYB1s--GT502--ioIG2.
[0040] The sequences of the above primers F5~F8, pYB1s-F, and pYB1s-R are as follows (5) , -3 , ): F5:TCCTCAACTACCAAGGAGAAAACATGGCGCTGACCGTGGGT, SEQ ID NO.11; F6:GTACCAGATCTACCCTCGAGTTAGATCGCCGCCGCCGGGTTAA, SEQ ID NO.12; F7:GCTAACAGGAGGAATTAACCGAGCTCATGAAGTTAGTCTTCA, SEQ ID NO.13; F8:TTTCTCCTTGGTAGTTGAGGACTTCTCGAGTCAAACACGTTCAA, SEQ ID NO.14; pYB1s-F: CTCGAGGGTAGATCTGGTAC, SEQ ID NO.9; pYB1s-R: GGTTAATTCCTCCTGTTAGC, SEQ ID NO. 10.
[0041] Example 3 Construction of recombinant strains S1. Constructing the mutant plasmid ioIG K95R --GT50: Using the recombinant expression vector pYB1s-ioIG1-GT501 constructed in Example 1 as a template, and K95R-F as the upstream primer and K95R-R as the downstream primer, a mutant plasmid containing both the ioIG mutant K95R gene and the wild-type GT50 gene was obtained by PCR amplification, which is plasmid 1.
[0042] K95R-F:ACATCTTCTGCGAGCGTCCCGGTGAGCTTCA, SEQ ID NO.15; K95R-R:TGAAGCTCACCGGACCGTCCGCAGAAGATGT, SEQ ID NO. 16.
[0043] S2. Constructing the mutant plasmid ioIG K95R / R124K --GT50: Using plasmid 1 as a template, with R124KF as the upstream primer and R124KR as the downstream primer, a mutant plasmid containing the ioIG mutant GK95R / R124K gene and the wild-type GT50 gene was obtained by PCR amplification, which is plasmid 2.
[0044] R124KF: CAAGTTGGCTTCAACAAACGTTTTGATCCGAAC, SEQ ID NO.17; R124KR:GTTCGGATCAAAACGTTTGTTGAAGCCAACTTG, SEQ ID NO. 18.
[0045] S3. Constructing the mutant plasmid ioIG K95R / R124K --GT50 T99S Using plasmid 2 as a template, T99SF as the upstream primer and T99SR as the downstream primer, a mutant plasmid containing the ioIG mutant GK95R / R124K gene and the GT50 mutant T99S gene was obtained by PCR amplification, which is plasmid 3.
[0046] T99SF:CAGATTGGCTGCAAAAGCGTCATCGCAGTTCCG, SEQ ID NO.19; T99SR: CGGAACTGCGATGACCGCTTTTGCAGCCAATCTG, SEQ ID NO. 20.
[0047] S4. Constructing the mutant plasmid ioIG K95R / R124K --GT50 T99S / D213N Using plasmid 3 as a template, with D213NF as the upstream primer and D213NR as the downstream primer, a mutant plasmid containing the ioIG mutant GK95R / R124K gene and the GT50 mutant T99S / D213N gene was obtained by PCR amplification, which is plasmid 4.
[0048] S5. Constructing the mutant plasmid GT50 T99S -ioIG: using the recombinant vector pYB1s--GT502--ioIG2 Using T99SF as the upstream primer and T99SR as the downstream primer, a mutant plasmid containing the GT50 mutant T99S gene and the wild-type ioIG gene was obtained by PCR amplification, which is plasmid 5.
[0049] D213N:TGGTGCGCTTCGCAACCGTCATCGCGTATG, SEQ ID NO.21; D213NR: CATACGCGATGACGGTTGCGAAGCGCACCA, SEQ ID NO. 22.
[0050] S6. Constructing the mutant plasmid GT50 T99S / D213N -ioIG: Using plasmid 5 as a template, with D213NF as the upstream primer and D213NR as the downstream primer, a mutant plasmid containing the GT50 mutant T99S / D213N gene and the wild-type ioIG gene was obtained by PCR amplification, which is plasmid 6.
[0051] S7. Constructing the mutant plasmid GT50 T99S / D213N -ioIG K95R Using plasmid 6 as a template, K95R-F as the upstream primer and K95R-R as the downstream primer, PCR amplification was performed to obtain a mutant plasmid containing the GT50 mutant T99S / D213N and the ioIG mutant K95R gene, which is plasmid 7.
[0052] S8. Constructing the mutant plasmid GT50 T99S / D213N -ioIG K95R / R124K Using plasmid 7 as a template, with R124KF as the upstream primer and R124KR as the downstream primer, a mutant plasmid containing the genes of the GT50 mutant T99S / D213N and the ioIG mutant K95RR124K was obtained by PCR amplification, which is plasmid 8.
[0053] The systems and procedures for each of the above PCR amplification processes are the same as those for the amplification process in Example 1.
[0054] After each of the above PCR reactions was completed, the template was digested using the restriction endonuclease DpnI. The digestion reaction system for each reaction was: 1 μL of 10× buffer, 8 μL of PCR product, and 1 μL of DpnI. The digestion was carried out at 37°C for 1 h to obtain the digested solution.
[0055] After digestion, 10 μL of the digestate was added to each *E. coli* DH5α competent cell. The cells were incubated on ice for 30 min, then heat-shocked at 42°C for 90 s, and incubated on ice for 5 min. 600 μL of LB broth was added, and the cells were incubated at 37°C for 1 h. The resulting culture was then spread onto LB agar plates (containing 50 μg / mL streptomycin sulfate) until the bacterial culture was completely absorbed. The plates were inverted and incubated overnight at 37°C. The plasmids were then extracted and sent to BGI Genomics for sequencing verification.
[0056] S9. Preparation of Expression Strains: E. coli BW25113 competent cells were prepared using the CaCl2 method. Plasmids 1-8, recombinant expression vectors pYB1s-ioIG1-GT501 and pYB1s-GT502-ioIG2 were transformed into E. coli BW25113 competent cells, respectively. The cells were then plated onto LB agar plates containing streptomycin sulfate and incubated overnight at 37 °C. Positive clones were selected. The successfully transformed bacteria were named recombinant strain 1, recombinant strain 2, recombinant strain 3, recombinant strain 4, recombinant strain 5, recombinant strain 6, recombinant strain 7, recombinant strain 8, recombinant strain 9, and recombinant strain 10.
[0057] Among them, recombinant bacteria 1 contains plasmid 1, recombinant bacteria 2 contains plasmid 2, recombinant bacteria 3 contains plasmid 3, recombinant bacteria 4 contains plasmid 4, recombinant bacteria 5 contains plasmid 5, recombinant bacteria 6 contains plasmid 6, recombinant bacteria 7 contains plasmid 7, recombinant bacteria 8 contains plasmid 8, recombinant bacteria 9 contains the recombinant expression vector pYB1s--ioIG1--GT501, and recombinant bacteria 10 contains the recombinant expression vector pYB1s-GT502-ioIG2.
[0058] Example 4 Induction of enzyme production S1. Select recombinant strains 1 to 10 and inoculate them into 10 300ml LB mediums. Culture them at 37℃ and 220rpm for 5.5h with shaking to obtain seed liquid 1 to seed liquid 10 of recombinant strains 1 to 10.
[0059] S2. Seed solutions 1 to 10 were inoculated at a volume ratio (v / v) of 2% into 10 fermenters (30L each) containing fermentation medium for fermentation culture. The culture conditions were: temperature: 37℃; airflow: 0.5m³ / h. 3 / h; Rotation speed: 300rpm; Pressure: 0.02MPa; pH: Adjusted to pH 7 with ammonia; Dissolved oxygen: 20%; After about 12 hours of cultivation, dissolved oxygen and pH increased significantly, and feeding was started.
[0060] The feeding rate during the above fermentation process is shown in Table 3.
[0061] Table 3 Feeding Rate Replenishment period Feeding rate (g / h) Start refilling ~ 3 hours 180 3 hours before induction 250 After induction 210 When the bacterial biomass grows to OD 600 After the value reached 75, the temperature was lowered to 30℃ and L-arabinose with a final concentration of 2g / L was added to start induction culture. After the biomass of the cells stopped increasing, the cells were transferred to fermentation tanks to obtain fermentation broth 1 to fermentation broth 10.
[0062] Among them, fermentation broth 1 contains ioIG mutant K95R and wild-type GT50; fermentation broth 2 contains ioIG mutant K95R / R124K and wild-type GT50; fermentation broth 3 contains ioIG mutant K95R / R124K and GT50 mutant T99S; fermentation broth 4 contains ioIG mutant K95R / R124K and GT50 mutant T99S / D213N; fermentation broth 5 contains GT50 mutant T99S and wild-type ioIG; and fermentation broth 6 contains GT... The following are the contents of the fermentation broth: 50 mutant T99S / D213N and wild-type ioIG; fermentation broth 7 contains GT50 mutant T99S / D213N and ioIG mutant K95R; fermentation broth 8 contains GT50 mutant T99S / D213N and ioIG mutant K95R / R124K; fermentation broth 9 contains wild-type ioIG and wild-type GT50 (prepared from recombinant strain 9); and fermentation broth 9 contains wild-type GT50 and wild-type ioIG. The crude enzyme solution 10 is prepared from recombinant strain 10.
[0063] The fermentation medium in the fermenter consisted of: citric acid 2 g / L, potassium dihydrogen phosphate 14 g / L, dipotassium hydrogen phosphate 4.5 g / L, ammonium sulfate 4 g / L, glucose 20 g / L, magnesium sulfate 0.6 g / L, yeast powder 1 g / L, pantothenic acid 2 mg / L, defoamer 0.1 g / L, and 100×trace element-10 ml / L.
[0064] The culture medium for feeding consisted of: 600 g / L glucose, 2 g / L magnesium sulfate, 10 g / L yeast extract, and 100× trace element 2 at 10 mL / L.
[0065] The concentrations of each component in the above 100× Trace Element I are: CoCl2 6H2O 25mg / L, MnCl2 4H2O 150mg / L, CuCl2 2H2O 15mg / L, H3BO3 30mg / L, Na2MoO4 2H2O 25mg / L, ZnSO4 7H2O 130mg / L, and ferric citrate 1g / L.
[0066] The concentrations of each component in the above 100× Trace Element II are: CoCl2·6H2O 40mg / L, MnCl2 4H2O 24mg / L, CuCl2 2H2O 25mg / L, H3BO3 50mg / L, Na2MoO4 2H2O 40mg / L, ZnSO4 7H2O 160mg / L, and ferric citrate 0.4g / L.
[0067] S3. Enzyme Solution Preparation: Fermentation broths 1 through 10 were centrifuged at 8000 rpm for 20 min, and the bacterial cells were collected. The fermentation broth was discarded, and the bacterial cells were resuspended in PBS buffer. The cells were then homogenized and disrupted at a homogenization pressure of 45 MPa for 3 cycles, with the temperature of the circulating solution maintained below 25℃. The cells were then centrifuged at 8000 rpm for 20 min, and the supernatant was collected to obtain crude enzyme solution 1 containing both ioIG mutant K95R and wild-type GT50; crude enzyme solution 2 containing both ioIG mutant K95R / R124K and wild-type GT50; and crude enzyme solution 3 containing both ioIG mutant K95R / R124K and GT50 mutant T99S. 4. Crude enzyme solution containing 5R / R124K and GT50 mutant T99S / D213N; 5. Crude enzyme solution containing both GT50 mutant T99S and wild-type ioIG; 6. Crude enzyme solution containing both GT50 mutant T99S / D213N and wild-type ioIG; 7. Crude enzyme solution containing both GT50 mutant T99S / D213N and ioIG mutant K95R; 8. Crude enzyme solution containing both GT50 mutant T99S / D213N and ioIG mutant K95R / R124K; 9. Crude enzyme solution containing both wild-type ioIG and wild-type GT50 (prepared from fermentation broth 9); 10. Crude enzyme solution containing both wild-type GT50 and wild-type ioIG (prepared from fermentation broth 10).
[0068] Example 5 Enzyme Activity Assay Enzyme activity was determined by high-performance liquid chromatography (HPLC). A 1.0 mL reaction system was prepared by adding muscle inositol and NAD to a phosphate buffer solution with a pH of 8 and a concentration of 50 mM. + The crude enzyme solution prepared in Example 4 and manganese sulfate were used to make the muscle inositol concentration 20 mmol / L, the manganese sulfate concentration 2mM, and the total crude enzyme concentration 3mg / ml (wherein the enzyme activity ratio of inositol dehydrogenase to ketoisomerase was 0.5:1), and the reaction was carried out at 50℃ for 30min.
[0069] According to the above preparation method of the reaction system, reaction system 1 to reaction system 10 were prepared respectively. The crude enzyme solution 1 to crude enzyme solution 10 prepared in Example 4 were added to reaction system 1 to reaction system 10 respectively. The above reaction systems were reacted at 50°C for 30 min respectively. The concentration of D-chiral inositol in each reaction solution was determined by high performance liquid chromatography (HPLC).
[0070] Detection conditions for high performance liquid chromatography: Column: 4.6×250 mm amino column with a particle size of 5 μm; Mobile phase: acetonitrile and 50 mM ammonium acetate aqueous solution in a volume ratio of 75:25; Column temperature: 30℃; Flow rate: 1.0 mL / min; Detector: differential refractive index detector.
[0071] One enzyme activity unit (U) is defined as the amount of enzyme required to generate 1 μmol of D-chiral inositol per minute under the above conditions. Taking the enzyme activity of crude enzyme solution 9 as 100%, the relative enzyme activities of each crude enzyme solution are calculated. The relative enzyme activities of crude enzyme solutions 1 to 10 are shown in Table 4.
[0072] Table 4 Results of enzyme activity assay crude enzyme solution relative enzyme activity Crude enzyme solution 9 100 % 10g crude enzyme solution 124% Crude enzyme solution 1 137% Crude enzyme solution 2 162% Crude enzyme solution 3 175% Crude enzyme solution 4 187% Crude enzyme solution 5 150% Crude enzyme solution 6 175% Crude enzyme solution 7 212% crude enzyme solution 8 250% As can be seen from the above results, after mutating specific sites of wild-type inositol dehydrogenase and wild-type ketoisomerase, the enzyme activities of the resulting inositol dehydrogenase mutant and ketoisomerase mutant were significantly improved.
[0073] Example 6 Preparation of D-chiral inositol Preparation of the reaction system (total volume 1L): Add muscle inositol and NAD to a 25mM PBS buffer at pH 7. + The crude enzyme solution prepared in Example 4 and manganese sulfate.
[0074] Prepare reaction systems 1 to 10 according to the above-described process, wherein crude enzyme solution 1 to crude enzyme solution 10 are added to reaction systems 1 to 10 respectively.
[0075] The concentrations of each component in reaction systems 1 through 10 are: muscle inositol 200 g / L, NAD... + 0.5 mM, crude enzyme 4 mg / ml (the ratio of inositol dehydrogenase to ketoisomerase activity in the crude enzyme is 0.5:1), manganese sulfate 3 mM.
[0076] The reaction systems 1 through 10 were reacted at 50°C for 12 hours to obtain conversion solutions. The yield and conversion rate of D-chiral inositol were determined by high-performance liquid chromatography (HPLC). The results are shown in Table 5.
[0077] Detection conditions for high performance liquid chromatography: Column: 4.6×250 mm amino column with a particle size of 5 μm; Mobile phase: acetonitrile and 50 mM ammonium acetate aqueous solution in a volume ratio of 75:25; Column temperature: 30℃; Flow rate: 1.0 mL / min; Detector: differential refractive index detector.
[0078] Conversion rate calculation method: Conversion rate (%) = (mass of D-chiral inositol generated ÷ total mass of initially added inositol) × 100%.
[0079] Table 5. Conversion rates of D-chiral inositol prepared from different crude enzyme solutions crude enzyme solution D-chiral inositol production (g / L) D-chiral inositol conversion rate % Crude enzyme solution 9 17 8.5 10g crude enzyme solution 20.4 10.2 Crude enzyme solution 1 23 11.5 Crude enzyme solution 2 26.2 13.1 Crude enzyme solution 3 28 14 Crude enzyme solution 4 29.4 14.7 Crude enzyme solution 5 24.6 12.3 Crude enzyme solution 6 27.6 13.8 Crude enzyme solution 7 33 16.5 crude enzyme solution 8 39.6 19.8 The results above show that the inositol dehydrogenase mutant and ketoisomerase mutant obtained by mutating specific sites of wild-type inositol dehydrogenase and wild-type ketoisomerase in this invention have higher enzyme activities, which can significantly improve the yield and conversion rate of D-chiral inositol in the process of catalyzing the reaction of muscle inositol to D-chiral inositol.
[0080] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A mixed enzyme preparation for catalyzing the synthesis of D-chiral inositol, characterized in that, The mixed enzyme preparation has enzymatic activity that catalyzes the reaction of muscle inositol to produce D-chiral inositol. The mixed enzyme preparation includes an inositol dehydrogenase mutant and a ketoisomerase mutant, and the amino acid sequence of the inositol dehydrogenase mutant is shown in any of the following: (1) The 95th amino acid in the amino acid sequence shown in SEQ ID NO.1 is mutated from K to R; (2) The 124th amino acid in the amino acid sequence shown in SEQ ID NO.1 is mutated from R to K; (3) The amino acid sequence shown in SEQ ID NO.1 is obtained by mutating amino acid position 95 from K to R and amino acid position 124 from R to K; and / or, The amino acid sequence of the ketoisomer mutant is shown in any of the following: (1) The 99th amino acid in the amino acid sequence shown in SEQ ID NO.3 is mutated from T to S; (2) The 213th amino acid in the amino acid sequence shown in SEQ ID NO.3 is mutated from D to N; (3) The 99th amino acid in the amino acid sequence shown in SEQ ID NO.3 is mutated from T to S, and the 213th amino acid is mutated from D to N.
2. The mixed enzyme preparation according to claim 1, characterized in that, The enzyme activity ratio of the inositol dehydrogenase mutant to the ketoisomerase mutant is 0.5:(0.5~2).
3. The mixed enzyme preparation according to claim 1, characterized in that, The amino acid sequence of the inositol dehydrogenase mutant is shown in any of the following: (1) The amino acid sequence shown in SEQ ID NO.23; (2) The amino acid sequence shown in SEQ ID NO.24; (3) The amino acid sequence shown in SEQ ID NO.
25.
4. The mixed enzyme preparation according to claim 1, characterized in that, The amino acid sequence of the ketoisomer mutant is shown in any of the following: (1) The amino acid sequence shown in SEQ ID NO.29; (2) The amino acid sequence shown in SEQ ID NO.30; (3) The amino acid sequence shown in SEQ ID NO.
31.
5. A method for preparing a mixed enzyme preparation, used to prepare the mixed enzyme preparation according to any one of claims 1 to 4, characterized in that, Includes the following steps: A recombinant strain containing both the inositol dehydrogenase mutant encoding gene and the ketoisomerase mutant encoding gene was constructed. The recombinant strain was fermented and cultured to induce the expression of the inositol dehydrogenase mutant and the ketoisomerase mutant.
6. The preparation method according to claim 5, characterized in that, Includes the following steps: Recombinant strains containing both the inositol dehydrogenase mutant gene and the ketoisomerase mutant gene were seed cultured to obtain seed liquid. The seed culture was inoculated into the fermentation medium at an inoculation rate of 1% to 5% by volume for fermentation culture. When the dissolved oxygen level rose, feeding was started, and the culture was continued until the OD reached 50%. 600 When the OD value reaches 65-75, add an inducing agent for induction culture until the OD value reaches 65-75. 600 The value stops increasing, and fermentation broth is obtained; The fermentation broth is centrifuged to collect the bacterial cells. After the bacterial cells are resuspended, the cells are broken up, centrifuged again, and the supernatant is collected to obtain the crude enzyme solution of the mixed enzyme preparation.
7. The preparation method according to claim 6, characterized in that, The seed culture involves inoculating the recombinant strain into LB liquid medium and culturing it with shaking at 30℃~40℃ and 200rpm~300rpm for 5h~6h to obtain a seed culture; and / or, The fermentation culture temperature is 30℃~40℃, and the air volume is 0.5m³ / h. 3 / h~1m 3 / h, rotation speed of 200rpm~400rpm, pressure of 0.01MPa~0.05MPa, pH value of 6.5~7.5, dissolved oxygen content of 15%~35%; and / or, The induction culture temperature is 25℃~35℃, the inducer is L-arabinose, and the final concentration of the inducer is 1g / L~5g / L.
8. The use of the mixed enzyme preparation according to any one of claims 1 to 4, characterized in that, The applications include catalyzing the reaction of muscle inositol to produce D-chiral inositol.
9. A method for preparing D-chiral inositol, characterized in that, Add muscle inositol and NAD to a 25mM~50mM buffer solution. + The crude enzyme solution, containing metal ions and mixed enzyme preparations, was used to make the concentration of muscle inositol in the reaction system 150g / L~300g / L, and NAD+. + The concentration of the enzyme is 0.5mM~1mM, the total concentration of crude enzyme in the mixed enzyme preparation is 2mg / ml~8mg / ml, and the concentration of metal ions is 2mM~5mM.
10. The preparation method according to claim 9, characterized in that, The metal ions include manganese ions, magnesium ions, or zinc ions; and / or, The buffer solution includes PBS buffer, Tris-HCl buffer, or HEPE buffer; and / or, The reaction temperature is 50℃~70℃, and the pH value is 7~9.