Application of non-coding variants of the slc39a1 gene in the assessment of the risk of susceptibility to acute respiratory distress syndrome in children

By screening for functional SNPs in the SLC39A1 gene, the correlation between non-coding variants and susceptibility risk and severity of PARDS was identified, which solved the problems of lag and limitations in the diagnosis of PARDS in existing technologies and enabled the clinical application of early personalized treatment.

CN122168746APending Publication Date: 2026-06-09CHILDRENS HOSPITAL OF CHONGQING MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
CHILDRENS HOSPITAL OF CHONGQING MEDICAL UNIV
Filing Date
2026-04-14
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

Current technologies for diagnosing acute respiratory distress syndrome (PARDS) in children are lagging and limited, failing to effectively utilize genetic background information, making it difficult to provide early individualized treatment.

Method used

By screening for functional single nucleotide polymorphisms (SNPs) in the SLC39A1 gene, especially rs6724, rs11264734, and rs12027783, and combining bioinformatics methods, genotyping was performed to identify the correlation between non-coding variants and susceptibility risk and severity of PARDS, and an assessment model was constructed.

Benefits of technology

This enables early prediction of PARDS susceptibility and severity in high-risk populations, providing a clinical basis for individualized treatment and improving diagnostic accuracy and efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122168746A_ABST
    Figure CN122168746A_ABST
Patent Text Reader

Abstract

This invention discloses the application of a SNP in the SLC39A1 gene in assessing susceptibility risk for acute respiratory distress syndrome (ARDS) in children. The SNP is a non-coding variant, with the variant sites being rs6724, rs11264734, or / and rs12027783 in the SLC39A1 gene. This SNP in the SLC39A1 gene can serve as a genetic marker for ARDS susceptibility in children, used for clinical prediction of ARDS risk, severity, and prognosis. It facilitates early and accurate stratification of high-risk children and prediction of severity, providing a basis for personalized precision treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and genetics and medical diagnostics, and relates to the application of non-coding variants of the SLC39A1 gene for assessing susceptibility risk and severity of acute respiratory distress syndrome in children. Background Technology

[0002] Currently, the diagnosis of acute respiratory distress syndrome (PARDS) in children mainly relies on a comprehensive assessment of the cause of pulmonary edema, chest imaging examinations, oxygenation, and other indicators. This diagnostic model based on physiological characteristics has significant lag and limitations, and ignores the influence of genetic background on disease susceptibility and severity. It lacks "ideal" specificity, which prevents the implementation of appropriate treatment measures as early as possible, and is one of the reasons for its high mortality rate.

[0003] Although SNPs of many genes (such as SP-B, TNF-α, AGER, etc.) have been shown to be associated with susceptibility risk or severity of PARDS, they have not been truly applied to clinical diagnosis due to a lack of ideal specificity. In addition, they have not associated proteins (M1 macrophage polarization, vascular endothelium, inflammatory stress, etc.) in the peripheral blood of patients carrying different genotypes that are related to the occurrence, development, or severity of PARDS, resulting in insufficient application and evaluation efficacy.

[0004] This invention investigates the correlation between single nucleotide polymorphisms (SNPs) of the SLC39A1 gene and susceptibility risk and severity of PARDS. The aim is to integrate biomarkers with multidimensional information such as genetic susceptibility, endothelial vascular injury, and inflammatory stress phenotypes to achieve early and accurate stratification and severity prediction of PARDS, providing clinical and theoretical basis for the realization of personalized precision treatment. Summary of the Invention

[0005] Existing technologies are insufficient for assessing susceptibility risk or severity of PARDS, making prediction difficult. This invention provides an application of a non-coding variant of the SLC39A1 gene in assessing susceptibility risk to acute respiratory distress syndrome in children.

[0006] This invention addresses the current lack of research on the correlation between SLC39A1 gene SNPs and PARDS. Building upon the applicant's previous confirmed protective role of SLC39A1 in PARDS, this invention utilizes public databases to screen for functional SLC39A1 SNPs and completes genotyping in high-risk PARDS populations (children with severe pneumonia and sepsis), possessing significant research value and clinical significance. This invention aims to screen for potential functional SNPs in the SLC39A1 gene using bioinformatics methods, while simultaneously collecting clinical samples from high-risk PARDS children with severe pneumonia and sepsis. It will complete genotyping of target SNPs, clarify the genotypic distribution characteristics of each variant site, explore the correlation between SLC39A1 non-coding variants and PARDS susceptibility risk, severity, and prognosis, and provide reliable research targets and experimental data for in-depth analysis of its molecular regulatory mechanisms, bridging basic research and clinical translation. It can be used for clinical assessment of susceptibility risk and severity of acute respiratory distress syndrome in children, facilitating prognostic care and treatment strategies.

[0007] To achieve the objectives of this invention, the following implementation scheme is provided.

[0008] In one embodiment, the present invention provides an application of SNPs of the SLC39A1 gene in the risk assessment of susceptibility to acute respiratory distress syndrome in children, wherein the SNPs are non-coding variants and the variant sites are rs6724, rs11264734 or / and rs12027783 in the SLC39A1 gene.

[0009] Furthermore, the above applications further include: 1) Collect peripheral blood from the patient; 2) Extract DNA following the steps of the TIANamp genomic DNA kit from Tiangen; 3) Perform PCR according to the system; 4) Perform Sanger sequencing to identify the genotype; 5) Predicting susceptibility to acute respiratory distress syndrome (ARDS) and assessing its severity by identifying the presence or absence of the SLC39A1 gene SNP. Among them, the Sanger sequencing primers are: rs6724 F: CAAGCAGGCCCCTCACT (SEQ ID NO: 1); rs6724 R:CCCCAGTTGTGGGGAATAGG (SEQ ID NO: 2); rs11264734 / rs12027783 F:ATTAACAAGGAATTATGACTGGGGG (SEQ ID NO: 3); rs11264734 / rs12027783 R:AAGGAAAAGAAAAGAAATAAAGTTGC (SEQ ID NO: 4).

[0010] Furthermore, in the application of the present invention described above, when the sequencing results contain a mutant allele of the non-coding variant of the SLC39A1 gene, it can predict the risk of increased susceptibility and severity of acute respiratory distress syndrome in children.

[0011] In another embodiment, the SNP of the SLC39A1 gene is used as a biomarker to construct a model for assessing the susceptibility risk and severity of acute respiratory distress syndrome in children, wherein the SNP is a non-coding variant and the variant sites are rs6724, rs11264734 or / and rs12027783 in the SLC39A1 gene.

[0012] In some embodiments, the present invention provides a reagent, device, or method for detecting SNPs of the SLC39A1 gene, wherein the SNPs of the SLC39A1 gene serve as biomarkers for susceptibility risk and severity of acute respiratory distress syndrome in children, and the SNPs are non-coding variants with SNP variant sites of rs6724, rs11264734, or / and rs12027783.

[0013] In some embodiments, the present invention provides a method for screening SNPs of the SLC39A1 gene for assessing susceptibility risk and severity of acute respiratory distress syndrome in children, comprising: 1) Screen for SNP sites of the SLC39A1 gene from the NCBI database. The inclusion criterion is that the minor allele frequency (MAF) in the Chinese population and the 1000 Genomes Project is >0.05. Select SNP sites that meet the criteria. 2) Using the online databases RegulomeDB and HaploReg v4.2, we conducted bioinformatics functional analysis and linkage disequilibrium analysis on the selected SNP sites related to gene expression regulation, and obtained SNP sites with high Rank and Score scores in the RegulomeDB database. 3) Collect peripheral blood samples from children at high risk of severe pneumonia and sepsis; 4) Extract DNA following the steps of the TIANamp genomic DNA kit from Tiangen; 5) Perform PCR according to the system; 6) Genotyping was performed using Sanger sequencing; 7) Analyze and statistically analyze the correlation between SNPs of the SLC39A1 gene and the susceptibility risk and severity of acute respiratory distress syndrome in children; 8) Based on the statistical results, the SNP sites rs6724, rs11264734 or / and rs12027783 in the SLC39A1 gene were determined to be significantly associated with the susceptibility risk and severity of acute respiratory distress syndrome in children.

[0014] In some implementations, the eligible SNP sites in step 1) of the screening method of the present invention include rs6724, r2072704, rs4845586, rs6661009, rs11264734, rs11264736, rs11264743, rs12023699, rs12027783, rs72434030, and rs77790196.

[0015] In some implementations, the SNP sites with higher scores in step 2) of the screening method of the present invention are rs6724, rs11264734 and rs12027783.

[0016] In some embodiments, the Sanger sequencing in step 6) of the screening method of the present invention described above... Its sequencing primers are: rs6724 F: CAAGCAGGCCCCTCACT; rs6724 R:CCCCAGTTGTGGGGAATAGG; rs11264734 / rs12027783 F: ATTAACAAGGAATTATGACTGGGGG; rs11264734 / rs12027783 R: AAGGAAAAAGAAAAGAAATAAAGTTGC.

[0017] In some implementations, the analysis and statistics of step 7) of the screening method of the present invention are as follows: when the data follows a normal distribution and has homogeneity of variance, the differences between the two groups are compared using an independent samples t-test; if the data does not meet the conditions of normal distribution or homogeneity of variance, the Mann-Whitney U test (a nonparametric rank-sum test) is used for comparison between groups.

[0018] Technical effects: 1) Compared with the prior art, this invention only requires drawing a small amount of peripheral blood from high-risk groups (severe pneumonia, sepsis, etc.) when they are admitted to the ICU, and then sequencing the genotype after PCR to predict their susceptibility to progression to acute respiratory distress syndrome, severity, and even prognosis.

[0019] 2) The discovered non-coding variants are biological markers that integrate multi-dimensional information such as genetic susceptibility, endothelial vascular injury, and inflammatory stress phenotype, and have better evaluation valence.

[0020] 3) This provides clinical evidence for subsequent targeted therapy against SLC39A1. Attached Figure Description

[0021] Figure 1 This is a flowchart of the research process for Example 1.

[0022] Figure 2 The image shows the results of the agarose gel electrophoresis in Example 1 for identifying DNA purity and primer specificity.

[0023] Figure 3 The image shows the basic information and feature map of three strongly linked disequilibrium SNP sites of SLC39A1 in Example 1, including (A) basic information of candidate variants, (B) gene illustration and location of variants, (C) distribution of candidate variants in the world population, and (D) candidate variants belonging to strong linkage disequilibrium.

[0024] Figure 4 The results of the identification of candidate variant genotypes in the high-risk population of Example 1 are shown. (A) Various genotypes of candidate variants, and (BD) Genotype identification results of candidate variants in the high-risk population.

[0025] Figure 5 The graph shows the correlation between carrying the mutant allele and susceptibility factors for PARDS in Example 2. (A) is a logistic regression analysis graph of covariates, which suggests that the wild-type allele is a protective factor against PARDS. (B) is a bar chart showing the progression of high-risk children carrying the mutant allele, which suggests that the probability of PARDS is significantly increased.

[0026] Figure 6 The bar chart shows the correlation between sex and PARDS progression and carrying non-coding variants in Example 2, where (A) is the correlation analysis between sex and PARDS progression, and (B) is the correlation analysis between sex and carrying non-coding variants.

[0027] Figure 7 The figure shows the distribution of age in the high-risk non-PARDS group and the PARDS group, and the WT group and the MUT group in Example 2. (A) Distribution of age in the high-risk non-PARDS group and the PARDS group, and (B) Distribution of age in the WT group and the MUT group.

[0028] Figure 8 The bar chart shows the modified Glasgow Coma Scale for the WT group and MUT group in Example 2.

[0029] Figure 9The graphs show the total length of hospital stay, ICU stay, and mechanical ventilation duration for the WT group and the MUT group in Example 2. (A) Comparison of total length of hospital stay between the WT group and the MUT group; (B) Comparison of ICU stay between the WT group and the MUT group; (C) Comparison of mechanical ventilation duration between the WT group and the MUT group. Detailed Implementation

[0030] The following embodiments are provided to describe the present invention in more detail. However, these embodiments are provided only to help further understand the present invention and are not intended to limit the present invention. Those skilled in the art should understand that equivalent substitutions or corresponding improvements made to the content of the present invention still fall within the protection scope of the present invention.

[0031] Example 1: Screening for SLC39A1 gene polymorphisms (SNPs) 1. Experimental Materials and Methods Clinical Sample Sources and Collection This study protocol has been reviewed and approved by the Ethics Committee of the Children's Hospital Affiliated to Chongqing Medical University, with approval document number (2025) Lun Shen (Lin Yan) Pi Fu No. (392). All studies strictly followed the relevant principles of the Declaration of Helsinki, and informed consent forms for clinical research were signed with the legal guardians of the study subjects. Children admitted to the Pediatric Intensive Care Unit (PICU) of the hospital who met the inclusion criteria of international guidelines related to severe pneumonia and / or sepsis in children were selected as study subjects. Peripheral blood samples were collected for subsequent experimental analysis. Specific inclusion and exclusion criteria are detailed below.

[0032] screening of gene loci This study first screened SNP loci of the SLC39A1 gene from the NCBI database. The inclusion criterion was a minor allele frequency (MAF) > 0.05 in the Chinese population and the 1000 Genomes Project. Eleven eligible loci were ultimately selected, including rs6724, r2072704, rs4845586, rs6661009, rs11264734, rs11264736, rs11264743, rs12023699, rs12027783, rs72434030, and rs77790196. Subsequently, using the RegulomeDB and HaploReg v4.2 online databases, bioinformatics functional analysis and linkage disequilibrium analysis related to gene expression regulation were performed on these 11 SNP loci. The results showed that the four loci, rs6724, rs11264734, rs12027783, and rs11264743, had high Rank and Score scores in the RegulomeDB database (see Table 1). Rank is a grading system (1a-7) based on the database's integration of multidimensional functional genomics experimental evidence to assess the reliability of variant regulatory function; a lower rank number indicates stronger experimental support and higher reliability. The Score directly reflects the likelihood of a variant having a regulatory function, ranging from 0 to 1, with 1 representing the most likely regulatory variant. Furthermore, these loci exhibited strong linkage disequilibrium in the HaploReg v4.2 database. However, because the target gene corresponding to rs11264743 did not meet the criteria set in this study, rs6724, rs11264734, and rs12027783 were ultimately identified as target SNP loci for subsequent related research analyses.

[0033] Table 1. Rank and Score of Candidate Variants in the Regulome DB Database

[0034] Experimental instruments and reagents are shown in Tables 2 and 3.

[0035] Table 2. Major experimental instruments and their manufacturers

[0036] Table 3. Main Reagents, Product Numbers and Manufacturers

[0037] Experimental methods Inclusion and exclusion criteria for enrolled children High-risk non-PARDS children included in this study should meet the following criteria: a) children with sepsis meeting the diagnostic criteria of the 2005 International Consensus on Childhood Sepsis and / or children with severe pneumonia meeting the Guidelines for the Management of Community-Acquired Pneumonia in Children (2024 Revision) but not progressing to PARDS; b) informed consent from the child's guardians; c) age range of 29 days to 18 years; d) informed consent and relevant research data.

[0038] Children included in this study in the PARDS group should meet the following criteria: a) Children who meet the diagnostic criteria for sepsis and / or severe pneumonia and have progressed to PARDS (in accordance with the 2023 PARDS Second Edition International Guidelines); b) Children whose guardians have given informed consent; c) Children whose age range is 29 days to 18 years; d) Children who have given informed consent and whose study data is complete.

[0039] Exclusion criteria were as follows: a) Non-Han children (reason: limiting SNP studies to Han ethnicity (or more precisely, limiting to groups with similar genetic ancestral backgrounds) is mainly to overcome the confounding effects (especially group stratification) caused by differences in genetic structure due to human population history, and to improve the accuracy and effectiveness of association studies); b) Children under 28 days old; c) Children who had undergone CRRT treatment for sepsis before diagnosis; d) Children who did not give informed consent.

[0040] Research Process All children received standard treatment and clinical decisions after enrollment. A total of 166 children with severe pneumonia and / or sepsis who met the inclusion criteria were included. Peripheral blood samples (2 ml each) were collected upon admission and aliquoted into 1 mL tubes. One tube was used for direct PBMC extraction, and the other was cryopreserved at -80°C. DNA was extracted using a blood genomic DNA extraction kit (centrifuge column type) [TIANamp Genomic DNA Kit (catalog number: DP304)] and sent to Sanger sequencing at Sangon Biotech (Shanghai) Co., Ltd. for genotyping. In addition, medical records were collected, including basic information such as gender and age. Clinical data such as admission time, ICU admission time, time of initiation of mechanical ventilation, and modified Glasgow Coma Scale score upon ICU admission were also collected (this part of the study process is as follows). Figure 1 (As shown).

[0041] Collection and processing of clinical samples 1) Record detailed basic clinical information of children with severe pneumonia and / or sepsis included in this study, such as name, gender, age, race, hospital number, medical history, etc.

[0042] 2) Strictly follow medical blood collection standards, use EDTA anticoagulation vacuum blood collection tubes to collect approximately 2 mL of peripheral blood from the subject's elbow vein, and thoroughly mix by inverting; 3) The collected blood samples were aliquoted into 1mL tubes. One tube was used to extract PBMCs according to the method for extracting PBMCs from peripheral blood. The other tube was labeled with basic information and then frozen together with the PBMC cryopreservation tube at -80℃ for later use.

[0043] Extraction of DNA from peripheral blood whole blood After removing the frozen blood sample from the -80°C ultra-low temperature freezer, place it in a 4°C freezer until completely thawed, then invert it 10-15 times to thoroughly mix the whole blood cells. Perform whole blood genomic DNA extraction according to the operating procedures provided by TIANamp Genomic DNA Kit (Catalog No.: DP304) from Tiangen Biotech (Beijing) Co., Ltd., as follows: 1) Take 200μL of blood directly. If the amount is less than 200μL, add buffer GA to make up the difference. 2) Add 20 μL of Proteinase K solution and mix well; 3) Add 200 μL of buffer GB, invert thoroughly to mix, incubate at 70°C for 10 min, the solution should become clear, and then briefly centrifuge to remove water droplets from the inner wall of the tube cap.

[0044] 4) Add 200 μL of anhydrous ethanol and shake thoroughly for 15 seconds. Flocculent precipitate may appear at this time; briefly centrifuge to remove water droplets from the inner wall of the cap.

[0045] 5) Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3 (place the adsorption column in the collection tube), at 12000 rpm. ~ Centrifuge at 13,400 x g for 30 seconds, discard the waste liquid, and return the adsorption column CB3 to the collection tube.

[0046] 6) Add 500 μL of buffer GD to the adsorption column CB3 (please check that anhydrous ethanol has been added before use), 12000 rpm ( ~ Centrifuge at 13,400 x g for 30 seconds, discard the waste liquid, and return the adsorption column CB3 to the collection tube.

[0047] 7) Add 600 μL of wash buffer PW to the adsorption column CB3 (please check that anhydrous ethanol has been added before use), 12000 rpm ( ~ Centrifuge at 13,400 x g for 30 seconds, discard the waste liquid, and return the adsorption column CB3 to the collection tube.

[0048] 8) Repeat step 7.

[0049] 9) Place the adsorption column CB3 back into the collection tube, 12000 rpm ( ~ Centrifuge at 13,400 x g for 2 min and discard the waste liquid. Place the adsorption column CB3 at room temperature for several minutes to thoroughly dry any residual rinsing liquid in the adsorption material.

[0050] 10) Transfer the adsorption column CB3 into a clean centrifuge tube, add 50-200 μL of elution buffer TE to the middle of the adsorption membrane, incubate at room temperature for 2-5 min, and then centrifuge at 12000 rpm. ~ Centrifuge at 13,400 x g for 2 min and collect the solution in a centrifuge tube.

[0051] Sanger sequencing identifies genotypes. For SNP primer design and identification, the reaction primers used in this study were designed using an online primer design website developed by Novizan Pharmaceuticals Co., Ltd., with each site containing both forward (F) and reverse (R) primers. All primers were synthesized and purified by Sangon Biotech (Shanghai) Co., Ltd. Primers for candidate SNPs are shown in Table 4.

[0052] Table 4. Primer sequences of candidate SNPs

[0053] The results of agarose gel electrophoresis to identify the purity of peripheral blood DNA extraction and the specificity of candidate SNP primers are as follows: Figure 2 As shown.

[0054] PCR reaction 1) Preparation of PCR reaction system The PCR reaction system (20 μL system) was prepared in RNase-free PCR tubes according to the following components. The preparation of the reaction solution must be performed on ice. The reaction system is shown in Table 5.

[0055] Table 5. PCR reaction system

[0056] 2) Setting up the PCR reaction program After mixing the above reaction system, place it in a PCR instrument for reaction. The specific procedure is shown in Table 6.

[0057] Table 6. PCR reaction program settings

[0058] Sanger sequencing The candidate SNP reverse (R) primers designed in this study were used to perform Sanger sequencing on the PCR amplification products. The sequencing process was completed on a Thermo Fisher Scientific Applied Biosystems™ 3730XL sequencer in the United States to achieve genotyping. The sequencing results were read using Chromas software to read the sequencing peak diagram and interpret and confirm the genotype.

[0059] 2. Experimental Results Basic information and characteristics of the selected SNP sites In this study, we selected three strongly linkage-disequilibrium SNP sites of SLC39A1 from an online database as candidate variants for further research. The basic information and characteristics of these three candidate sites, rs6724, rs11264734, and rs12027783, are as follows: Figure 3 As shown.

[0060] Study the basic characteristics of patients in the cohort The study included a total of 166 children with severe pneumonia and / or sepsis. Both groups were matched for age, sex, and ethnicity. Basic information and clinical characteristics of the study population are shown in Table 7.

[0061] Table 7. General characteristics of clinical cohorts

[0062] Note: 1. Data labeling instructions: Non-normally distributed continuous data are expressed as “median (interquartile range)”, and the Mann-Whitney U test is used for comparisons between groups; Normally distributed continuous data are expressed as “mean ± standard deviation”, and the independent samples t test is used for comparisons between groups; Categorical data are expressed as “number (%)”, and the χ² test is used for comparisons between groups.

[0063] 2. Explanation of missing data: Data on the modified Glasgow Coma Scale (GCS) score was missing due to factors such as sedation and drowsiness, with only 127 cases ultimately included in the analysis. Data on total hospital stay, ICU stay, and mechanical ventilation duration were also missing due to reasons such as death, self-discharge, and surgical intervention, with only 103 cases ultimately included in the analysis. To assess the impact of missing data on the results, the study participants were divided into a complete data group and a missing data exclusion group, and baseline data were compared between the two groups. The results showed no statistically significant differences in age and gender composition between the two groups (P > 0.05), indicating balanced baseline characteristics and minimal selection bias due to missing data. Furthermore, the complete case distribution of ICU stay and mechanical ventilation duration was consistent with clinical practice, further supporting the reliability of the study results.

[0064] 3. Indicator Definitions: The modified GCS score uses a simplified version specifically for children (maximum score of 15 points, with lower scores indicating more severe impairment of consciousness); mechanical ventilation duration refers to the cumulative time from endotracheal intubation to successful extubation (if a second intubation is required, the time is calculated together).

[0065] Sequencing identification of non-coding variants DNA was extracted from the peripheral blood of the affected children and Sanger sequencing was performed to identify the genotypes of non-coding variants. The results were as follows: Figure 4 As shown, the results indicate that wild-type, heterozygous, and homozygous genotypes of the three non-coding variants are prevalent in children with severe pneumonia and / or sepsis. Among the genotypes identified for each of the three variants, there were 79 wild-type cases, 72 heterozygous mutation cases, and 15 homozygous mutation cases, exhibiting consistent frequencies, consistent with the results from the 1000 Genomes Project. This suggests that we can study this as a haplotype (i.e., an SNP combinatorial block).

[0066] 3. Discussion This study utilized the NCBI database for SNP screening of the SLC39A1 gene, strictly adhering to functional variant screening criteria. It focused on non-coding regions such as gene promoters, 3′UTRs, and introns, eliminating low-frequency, meaningless variants or those with weak regulatory function. Ultimately, it screened target SNP sites with high regulatory function scores and strong linkage disequilibrium. The entire screening process was scientifically rigorous. The NCBI database, as a globally authoritative genomics data platform, integrates massive amounts of human genetic variation and gene annotation information, providing comprehensive and reliable data support for disease candidate gene SNP screening. This effectively avoids research bias caused by blindly selecting sites and improves the accuracy of subsequent studies. Compared to whole-genome sequencing screening strategies, the candidate gene targeted screening method used in this study closely aligns with the research group's previous work, focusing on SLC39A1, a key PARDS protective gene. This significantly narrows the research scope, reducing experimental costs while precisely identifying subsequent research targets. It is also a commonly used and efficient screening method in current research on the genetic susceptibility of complex diseases.

[0067] This study selected children with severe pneumonia and sepsis as a high-risk group for PARDS for genotyping, which perfectly matches the clinical pathogenesis of PARDS and has strong clinical relevance. Clinical data show that severe pneumonia and sepsis are the leading causes of PARDS in children, with over 70% of PARDS cases secondary to these two conditions. Although not all of these children progress to PARDS, they are all at high risk. Individual genetic background differences are the core factor determining whether they develop the disease and the severity of their condition. Compared to directly including PARDS children in a controlled study with healthy children, genotyping of high-risk groups can more accurately identify genetic variations related to the pathogenesis of PARDS, eliminate the overall genetic background differences between healthy individuals and severely ill children, reduce confounding factors, and improve the accuracy of genetic locus screening. Meanwhile, this study strictly adhered to the sample inclusion and exclusion criteria, standardized the sample collection, DNA extraction, and genotyping procedures, ensuring the reliability of the typing results. It clarified the distribution frequency, allele frequency, and genotypic characteristics of each candidate SNP in high-risk PARDS populations, filling the data gap in the distribution of genetic variations of the SLC39A1 gene in high-risk PARDS populations.

[0068] In summary, this study successfully identified the functional non-coding SNP site of the SLC39A1 gene through standardized bioinformatics screening and completed precise genotyping in high-risk children with PARDS, clarifying the population distribution characteristics of candidate variants and laying a solid foundation for subsequent research. This study not only confirms the rationale for SLC39A1 as a candidate susceptibility gene for PARDS, but also provides a reliable experimental basis and target sites for further analysis of the association between SLC39A1 non-coding variants and PARDS, and for exploring its molecular regulatory mechanisms. It plays an important role in refining the theory of PARDS genetic susceptibility and realizing early risk warning for the disease.

[0069] The results of this study are summarized as follows: 1) Candidate SNP screening: Three target SNPs of the SLC39A1 gene were screened out, namely rs6724, rs11264734 and rs12027783, which showed strong linkage disequilibrium.

[0070] 2) Genotyping: Peripheral blood was collected from children at high risk of severe pneumonia and sepsis for Sanger sequencing, and the locus genotyping was successfully completed.

[0071] 3) Genotypic characteristics: All subjects had identical genotypes of the three SNPs, and their heterozygous / homozygous states were synchronized.

[0072] 4) Clear research value: It verifies the genetic stability of the target site and lays an experimental foundation for subsequent PARDS association analysis and mechanism research.

[0073] Example 2: Correlation study of SLC39A1 gene single nucleotide polymorphism with susceptibility risk and severity of PARDS. 1. Experimental Materials and Methods Clinical sample data The clinical sample data used in this study were all from the Pediatric Intensive Care Unit (PICU) of the Children's Hospital Affiliated to Chongqing Medical University. The study was approved by the Ethics Committee of the Children's Hospital Affiliated to Chongqing Medical University [Approval No. (2025) Lun Shen (Lin Yan) Approval No. (392)], and informed consent forms for clinical research were signed with all study subjects in accordance with the Declaration of Helsinki. The collected data included patients' medical records after admission, recording their gender, age, and other general information. Clinical indicators such as admission time, ICU admission time, start of mechanical ventilation time, modified Glasgow Coma Scale score upon ICU admission, discharge time, transfer out of ICU time, and end of mechanical ventilation time were also collected for clinical correlation analysis.

[0074] Experimental methods Clinical sample grouping 1) The collected clinical samples were divided into a high-risk non-PARDS group and a PARDS group according to whether they progressed to PARDS. The correlation between non-coding variants, age, gender and the progression of acute respiratory distress syndrome in children was analyzed.

[0075] 2) The collected clinical samples were divided into WT group and MUT group according to whether they carried mutant alleles (whether homozygous or heterozygous) based on Sanger sequencing results. The correlation between non-coding variants and susceptibility risk, severity and prognostic indicators of PARDS was analyzed.

[0076] Statistical methods When the data follows a normal distribution and has homogeneity of variance, the differences between two groups are compared using an independent samples t-test. If the data does not meet the conditions of normal distribution or homogeneity of variance, the Mann-Whitney U test (a nonparametric rank-sum test) is used for comparisons between groups. All statistical analyses were performed using GraphPad Prism 8.0.1 software. P <0.05 is the standard for statistical significance of the difference.

[0077] 2. Experimental Results Carrying a mutant allele is a susceptibility factor for the progression of acute respiratory distress syndrome in children. Statistical analysis results are shown below Figure 5The results showed that, under the codominant inheritance model, compared with high-risk children carrying mutant alleles (including heterozygous and homozygous mutations), children carrying the homozygous genotype of the reference allele had a significantly lower risk of developing PARDS (P=0.0169, OR=0.458, 95% CI: 0.239-0.865). Figure 5 A).

[0078] Further analysis showed that, compared with the wild-type group (WT group), children in the mutant group (MUT group) had a significantly increased risk of developing PARDS (P=0.0045). Figure 5 B).

[0079] The above results confirm that carrying the homozygous genotype of the reference allele is a protective factor against the progression of PARDS in high-risk children, while carrying the mutant allele is a susceptibility factor for the progression of PARDS in high-risk children.

[0080] Age, sex, and presence of non-coding variants were not associated with the progression of acute respiratory distress syndrome in children. To explore the association between age, sex, and the progression of high-risk children to PARDS and the presence of the SLC39A1 non-coding variant, this study first analyzed the association between sex and PARDS progression and non-coding variant carrier status. Results are shown below. Figure 6 In the association analysis between gender and PARDS progression, the proportion of high-risk male children who progressed to PARDS was 51.85%, while that of female children was 66.10%, with no statistically significant difference between the two groups. P = 0.1018) Figure 6 A); Similarly, in the association analysis between sex and SLC39A1 non-coding variant carrying, the proportion of high-risk male children carrying the variant was 52.78% and that of female children was 54.24%, with no statistically significant difference. P = 0.8726)( Figure 6 B).

[0081] Further stratified analysis by age revealed no significant difference in age distribution between the PARDS group and the high-risk non-PARDS group. P = 0.9098) Figure 7 A); There was no significant difference in age distribution between the wild-type (WT) group and the group carrying the SLC39A1 non-coding variant (MUT). P = 0.8497)( Figure 7 B).

[0082] In summary, the results of this study suggest that neither age nor sex is significantly associated with the progression of high-risk children to PARDS or the presence of SLC39A1 non-coding variants, indicating that there is no age or sex preference for SLC39A1 non-coding variants in the pathogenesis of PARDS.

[0083] Carrying a mutant allele is associated with adverse outcomes in children with acute respiratory distress syndrome. To investigate whether there are differences in clinical outcomes between high-risk infants carrying mutant alleles (whether homozygous or heterozygous), this study analyzed the modified Glasgow Coma Scale scores (MGS) of high-risk infants admitted to the ICU in the WT and MUT groups. Figure 8 The results showed that the MUT group had a lower Glasgow Coma Scale score compared to the WT group, suggesting that children carrying the mutant allele had more severe neurological involvement and systemic stress damage, and their condition was more serious.

[0084] To further investigate whether carrying mutant alleles affects the short-term prognosis of PARDS, this study conducted a correlation analysis on the total length of hospital stay, ICU stay, and duration of mechanical ventilation in high-risk children in different groups. The results are as follows: Figure 9 As shown. The results showed that, compared with the WT group, children in the MUT group had a longer total hospital stay ( P =0.0245)( Figure 9 A) ICU admission time ( P =0.0329)( Figure 9 B) and duration of mechanical ventilation ( P =0.0468)( Figure 9 C). The above results indicate that carrying the mutant allele is associated with a poor prognosis in children with acute respiratory distress syndrome.

[0085] 3. Discussion This study builds upon the preliminary findings of the first part, which involved functional SNP screening of the SLC39A1 gene and genotyping of high-risk individuals for PARDS. Employing a case-control study design, it delves into the association between SLC39A1 non-coding variants and susceptibility to PARDS. Simultaneously, it systematically analyzes the correlation between target variants and the severity and clinical prognosis of PARDS, using four core clinical indicators: Modified Glasgow Coma Scale score, total hospital stay, ICU stay, and duration of mechanical ventilation. The aim is to uncover potential genetic susceptibility markers for PARDS, providing a genetic basis for early risk stratification and clinical prognostic assessment. The results of this study are the first to reveal the association between SLC39A1 non-coding region variants and the onset and progression of PARDS, filling a research gap in the genetic susceptibility of this gene to PARDS and providing crucial clinical evidence for further in-depth investigations into its molecular mechanisms.

[0086] This study confirms a significant correlation between non-coding variants of the SLC39A1 gene and susceptibility to PARDS. Children carrying specific genotypes or alleles have a significantly increased risk of developing PARDS. This finding is highly consistent with our previous hypotheses and the conclusions of our basic research. PARDS, a complex critical illness regulated by multiple factors including genetics and environment, is primarily determined by the host's genetic background. Non-coding SNPs, as key genetic variations regulating gene expression, while not directly encoding proteins, can influence the expression levels of target genes by altering gene transcription efficiency and mRNA stability, thereby mediating differences in disease susceptibility among individuals. Our previous basic research has confirmed that SLC39A1 is a key protective gene mediating zinc ion uptake in type II alveolar epithelial cells and maintaining zinc homeostasis in lung tissue. Downregulation of SLC39A1 expression directly exacerbates lung inflammation and alveolar barrier damage, driving the progression of acute lung injury. The risky non-coding variants discovered in this section likely weaken the lung-protective effect of SLC39A1 by downregulating its normal expression, thereby increasing the body's susceptibility to PARDS. This also confirms from a clinical perspective the core regulatory role of SLC39A1 in the pathogenesis of PARDS and provides a new candidate target for the genetic susceptibility mechanism of PARDS.

[0087] In the correlation analysis of disease severity, this study selected four clinically recognized indicators for assessing severe illness: Modified Glasgow Coma Scale (MoGCS), total hospital stay, ICU stay, and duration of mechanical ventilation. The results showed that the SLC39A1 non-coding variant was significantly associated with all of these indicators, further clarifying the impact of this genetic variant on the progression and clinical outcome of PARDS. The MoGCS is a core indicator for assessing the degree of consciousness impairment and central nervous system involvement in children; a lower score indicates a more severe condition. This study found that children carrying the risk genotype had significantly lower MoGCS scores, suggesting more severe neurological involvement and systemic stress injury in these children. Total hospital stay, ICU stay, and duration of mechanical ventilation directly reflect the degree of lung damage, respiratory function recovery, and the difficulty of clinical treatment. The results showed that carriers of the risk genotype had significantly prolonged durations in all three indicators, indicating that the SLC39A1 non-coding variant not only affects the risk of PARDS but also further exacerbates disease severity, delays the recovery process, and increases the clinical burden and medical resource consumption. The above results fully demonstrate that the SLC39A1 non-coding variant can serve as a potential genetic marker for assessing the severity of PARDS and predicting short-term prognosis, providing a new genetic reference for clinical practice to achieve early stratification of high-risk children and develop individualized treatment plans.

[0088] From the perspective of clinical practice and disease prevention and control, the results of this study have significant clinical translational value. Currently, PARDS clinical diagnosis and treatment still lack precise early warning and prognostic assessment indicators, relying heavily on clinical symptoms and routine biochemical tests, making it difficult to achieve individualized risk prediction. However, the SLC39A1 functional non-coding variant screened in this study can be quickly identified through simple gene testing, facilitating early clinical identification of high-risk PARDS patients. This allows for proactive measures such as enhanced monitoring and active intervention for high-risk individuals, thereby reducing lung tissue damage and improving clinical prognosis. Furthermore, this study focuses on non-coding region genetic variants, overcoming the limitations of previous PARDS genetic studies that primarily focused on coding regions. This further enriches the theoretical system of PARDS genetic susceptibility and lays a solid clinical foundation for subsequent research into the molecular regulatory mechanisms of SLC39A1 non-coding variants and the development of targeted interventions, achieving a closed-loop research process from genetic target screening to clinical correlation validation.

[0089] In summary, this embodiment of the study, through clinical case-control analysis, is the first to confirm... SLC39A1 Non-coding gene variants are closely associated with susceptibility to PARDS and are significantly correlated with disease severity and prognostic indicators such as Modified Glasgow Coma Scale (MRCS), total hospital stay, ICU stay, and duration of mechanical ventilation. This clarifies the clinical value of this genetic variant as a potential biomarker for early warning and disease assessment of PARDS. The results echo the findings of the research team's previous basic research and pave the way for further in-depth exploration. SLC39A1 The molecular mechanisms by which non-coding variations mediate the progression of PARDS provide a key direction and have important theoretical significance and practical value for improving the genetic pathogenesis theory of PARDS and promoting precision clinical diagnosis and personalized prevention and treatment.

[0090] summary This embodiment, based on the SNP screening and genotype identification results of Example 1, conducts a case-control study to analyze the clinical association between loci and PARDS. The core research results are summarized as follows: 1) Disease susceptibility analysis: It was confirmed that three non-coding variants of SLC39A1 were significantly associated with susceptibility to PARDS, and children carrying risk genotypes had an increased risk of developing the disease.

[0091] 2) Assessment of the severity of the illness: Risk genotype was associated with a decrease in modified Glasgow Coma Scale score, indicating that the child's central nervous system was more severely affected and the illness was more critical.

[0092] 3) Analysis of clinical prognostic indicators: Children with high-risk genotypes had significantly longer total hospital stays, longer ICU stays, and longer mechanical ventilation times, and had worse prognoses.

[0093] 4) Clear clinical value: The SLC39A1 non-coding variant has been established as a PARDS susceptibility marker.

[0094] Example 3: Prediction of PARDS susceptibility and severity assessment in high-risk patients 1) Collect peripheral blood from the child; 2) Extract DNA according to the steps of the TIANamp Genomic DNA Kit (catalog number: DP304-03); 3) Perform PCR according to the system; 4) Sanger sequencing to identify genotypes.

[0095] Sanger sequencing primers: rs6724 F: CAAGCAGGCCCCTCACT; rs6724 R:CCCCAGTTGTGGGGAATAGG; rs11264734 / rs12027783 F: ATTAACAAGGAATTATGACTGGGGG; rs11264734 / rs12027783 R: AAGGAAAAAGAAAAGAAATAAAGTTGC; 5) Identify whether the sequenced gene contains SNP sites of non-coding variation in the SLC39A1 gene, namely rs6724, rs11264734, and rs12027783. If these three SNP sites are present, it can predict the patient (child)'s susceptibility to acute respiratory distress syndrome and the trend risk of increased severity.

Claims

1. Application of SNPs in the SLC39A1 gene in the risk assessment of susceptibility to acute respiratory distress syndrome in children, wherein the SNPs are non-coding variants and the variant sites are rs6724, rs11264734 or / and rs12027783 in the SLC39A1 gene.

2. The application as described in claim 1, further comprising: 1) Collect peripheral blood from the patient; 2) Extract DNA following the steps of the TIANamp genomic DNA kit from Tiangen; 3) Perform PCR according to the system; 4) Perform Sanger sequencing to identify the genotype; 5) Predicting susceptibility to acute respiratory distress syndrome and assessing severity by identifying the genotype of the SNP carrying the SLC39A1 gene in children. Among them, the Sanger sequencing primers are: rs6724 F: CAAGCAGGCCCCTCACT; rs6724 R:CCCCAGTTGTGGGGAATAGG; rs11264734 / rs12027783 F: ATTAACAAGGAATTATGACTGGGGG; rs11264734 / rs12027783 R: AAGGAAAAAGAAAAGAAATAAAGTTGC.

3. As described in claim 2, when the sequencing results contain a mutant allele of the SLC39A1 non-coding variant, it can predict the risk of increased susceptibility and severity of acute respiratory distress syndrome in children.

4. The use of SNPs of the SLC39A1 gene as biomarkers to construct a model for assessing susceptibility risk and severity of acute respiratory distress syndrome in children, wherein the SNPs are non-coding variants and the variant sites are rs6724, rs11264734 or / and rs12027783.

5. A reagent, device, or method for detecting SNPs in the SLC39A1 gene, wherein the SNPs in the SLC39A1 gene serve as biomarkers for assessing the susceptibility risk and severity of acute respiratory distress syndrome in children, wherein the SNPs are non-coding variants, and the variant sites are rs6724, rs11264734, or / and rs12027783 in the SLC39A1 gene.

6. A method for screening SNPs of the SLC39A1 gene for assessing susceptibility risk and severity of acute respiratory distress syndrome in children, comprising: 1) Screen for SNP sites of the SLC39A1 gene from the NCBI database. The inclusion criterion is that the minor allele frequency (MAF) in the Chinese population and the 1000 Genomes Project is >0.

05. Select SNP sites that meet the criteria. 2) Using the online databases RegulomeDB and HaploReg v4.2, we conducted bioinformatics functional analysis and linkage disequilibrium analysis on the selected SNP sites related to gene expression regulation, and obtained SNP sites with high Rank and Score scores in the RegulomeDB database. 3) Collect peripheral blood samples from children at high risk of severe pneumonia and sepsis; 4) Extract DNA following the steps of the TIANamp genomic DNA kit from Tiangen; 5) Perform PCR according to the system; 6) Perform Sanger sequencing to identify the genotype; 7) Analyze and statistically analyze the correlation between SNPs of the SLC39A1 gene and the susceptibility risk and severity of acute respiratory distress syndrome in children; 8) Based on the statistical results, the rs6724, rs11264734 or / and rs12027783 variant sites in the SLC39A1 gene were determined to be significantly associated with the susceptibility risk and severity of acute respiratory distress syndrome in children.

7. The screening method as described in claim 6, wherein the SNP sites meeting the criteria in step 1) include rs6724, r2072704, rs4845586, rs6661009, rs11264734, rs11264736, rs11264743, rs12023699, rs12027783, rs72434030, and rs77790196.

8. The screening method as described in claim 6, wherein the SNPs with higher scores in step 2) are rs6724, rs11264734 and rs12027783.

9. The screening method as described in claim 6, wherein the Sanger sequencing in step 6) Its sequencing primers are: rs6724 F: CAAGCAGGCCCCTCACT; rs6724 R:CCCCAGTTGTGGGGAATAGG; rs11264734 / rs12027783 F: ATTAACAAGGAATTATGACTGGGGG; rs11264734 / rs12027783 R: AAGGAAAAAGAAAAGAAATAAAGTTGC.

10. In the screening method as described in claim 6, the analysis and statistics in step 7) are as follows: when the data follows a normal distribution and has homogeneity of variance, the differences between the two groups are compared using an independent samples t-test; if the data does not meet the conditions of normal distribution or homogeneity of variance, the Mann-Whitney U test is used for comparison between groups.