A SNP marker related to the level of anti-streptococcus agalactiae igm antibody of tilapia and application thereof

By screening for SNP markers associated with the level of anti-Streptococcus agalactiae IgM antibodies in tilapia and using genotyping technology, the genetic improvement problem of disease resistance traits in tilapia breeding was solved, achieving early screening and improved breeding efficiency.

CN122168768APending Publication Date: 2026-06-09PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610567205.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-27
Publication Date
2026-06-09

Smart Images

  • Figure CN122168768A_ABST
    Figure CN122168768A_ABST
Patent Text Reader

Abstract

The present application relates to the field of biotechnology, and more particularly to a SNP marker related to the level of anti-streptococcus agalactiae IgM antibody of tilapia and application thereof. The present application screens out QTLs, functional genes and key signal pathways significantly related to the level of anti-streptococcus agalactiae IgM antibody of tilapia by RNA-Seq and BSA-Seq technologies, and further identifies two SNP markers closely related to the level of anti-streptococcus agalactiae IgM antibody of tilapia, thereby providing important genetic targets and tools for molecular marker-assisted breeding of anti-streptococcus agalactiae of tilapia.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more particularly to an SNP marker associated with the level of anti-streptococcal IgM antibody in tilapia and its application. Background Technology

[0002] Tilapia (Oreochromis spp.) is an important freshwater aquaculture fish, but its development has long been severely hampered by streptococcal disease caused by Streptococcus agalactiae. This disease is prone to outbreaks during hot seasons, characterized by rapid onset and high mortality. Traditional breeding techniques have made slow progress in the genetic improvement of disease resistance traits, generally suffering from low phenotypic selection efficiency and limited genetic gain.

[0003] With the development of molecular biology techniques, molecular marker-assisted breeding (MAS) has provided a new technical approach for disease-resistant breeding. This method, by screening DNA markers closely associated with target traits, enables precise selection in early generations, thereby significantly improving breeding efficiency. Among these, single nucleotide polymorphism (SNP) markers have become one of the most promising marker types in MAS due to their wide distribution in the species genome, high stability, and suitability for automated detection.

[0004] Immunoglobulin M (IgM) is a core effector molecule of humoral immunity in bony fish. Serum-specific IgM antibody levels are a key phenotype for assessing vaccine efficacy and disease resistance in fish. Higher serum-specific IgM antibody levels after vaccine immunization or pathogen infection indicate better vaccine protection and higher survival rates after pathogen infection. Studies have shown that antibody-related immune traits are heritable in different species. For example, in pigs, specific SNP sites in the FcRn and PSMC2 genes have been shown to be significantly associated with antibody levels against classical swine fever virus and African swine fever virus. In cattle, genome-wide association studies (GWAS) have identified SNP sites associated with bovine tuberculosis antibody levels and molecular markers associated with yak immunoglobulin (IgA, IgG, IgM) levels. In chickens, studies have located quantitative trait loci and key genes associated with Newcastle disease virus, avian influenza virus, and hemocyanin antibody responses. These results provide important evidence for marker-assisted selection of disease resistance traits. However, the key genetic loci and molecular markers that regulate the level of anti-streptolysin Agalactiae IgM antibodies in tilapia are still unclear, which limits the application of this trait in efficient marker-assisted breeding. Summary of the Invention

[0005] The main functions of immunoglobulin IgM include complement activation, pathogen agglutination, regulation of immune homeostasis, and assisting in pathogen clearance through antibody-dependent cell-mediated cytotoxicity. Previous studies have found that offspring of Nile tilapia immunized with an inactivated Streptococcus agalactiae vaccine exhibit stronger resistance to Streptococcus agalactiae, suggesting that post-immunization IgM gene expression levels can serve as a potential marker for selecting tilapia for resistance to Streptococcus agalactiae. Furthermore, compared to IgM gene expression levels, the concentration of specific IgM antibodies in serum more accurately reflects the level of immune response to specific antigens and the effectiveness of vaccine immunoprotection, thus representing a more promising candidate trait for disease resistance.

[0006] The applicant previously conducted genetic analysis on 24 full-sib families obtained from the identification of offspring from 433 mixed families, assessing the genetic parameters of IgM antibody immune response levels in tilapia. The results showed that IgM antibody immune response level is a highly heritable trait and can serve as an important trait for disease resistance breeding in tilapia, laying the foundation for cultivating new tilapia varieties / strains with high disease resistance.

[0007] In view of this, the present invention proposes an SNP marker related to the level of anti-streptococcal IgM antibody in tilapia and its application.

[0008] The technical solution of this invention is implemented as follows:

[0009] In a first aspect, the present invention provides SNP markers associated with the level of anti-Streptococcus agalactiae IgM antibody in tilapia, wherein the SNP markers are SNP1 and / or SNP2, and the SNP marker site information is as follows:

[0010]

[0011] Refer to the Nile tilapia O_niloticus_UMD_NMBU genome version.

[0012] Secondly, the present invention provides a product for detecting the SNP marker, the product comprising: primer sets with nucleotide sequences as shown in SEQ ID NO: 1-2, and primer sets with nucleotide sequences as shown in SEQ ID NO: 3-4.

[0013] Thirdly, the present invention provides an application for detecting the SNP marker in products, for any of the following applications:

[0014] (A1) To identify or predict the level of anti-streptolysin Agalactiae IgM antibodies in tilapia for non-diagnostic purposes;

[0015] (A2) Assist in the screening and cultivation of tilapia varieties / strains resistant to Streptococcus agalactiae.

[0016] Furthermore, the product comprises PCR markers and / or gene chips developed using SNP1 and SNP2 sequence information, wherein the PCR markers are PCR-RFLP markers, TaqMan markers, KASP markers, AS-PCR markers, or HRM markers.

[0017] Furthermore, the product is used for genotyping of SNP1 and / or SNP2 loci.

[0018] Furthermore, genotyping was performed using sequencing, real-time fluorescence PCR, SnaPshot, gene chip, or mass spectrometry.

[0019] Fourthly, the present invention provides a method for SNP marker-assisted selection related to the level of anti-streptococcal IgM antibody in tilapia, comprising the following steps:

[0020] Genotyping was performed on the SNP1 and / or SNP2 loci of the selected individuals. The SNP marker locus information is shown below:

[0021]

[0022] Refer to the Nile tilapia O_niloticus_UMD_NMBU genome version;

[0023] Select individuals whose genotyping results meet either of the following (B1) and (B2):

[0024] (B1) The genotype of SNP1 locus is CT or TT;

[0025] (B2) The genotype of the SNP2 locus is AG or GG.

[0026] Furthermore, PCR markers and / or gene chips are developed using SNP1 and SNP2 sequence information, wherein the PCR markers are PCR-RFLP markers, TaqMan markers, KASP markers, AS-PCR markers, or HRM markers.

[0027] Furthermore, genotyping was performed using sequencing, real-time fluorescence PCR, SnaPshot, gene chip, or mass spectrometry.

[0028] the term :

[0029]

[0030] Sequencing method: The base composition of the target site is directly read by nucleic acid sequencing to determine the genotype; including Sanger first-generation sequencing (suitable for low-throughput single-site verification) and targeted second-generation high-throughput sequencing (suitable for medium- and high-throughput multi-site / multi-sample parallel detection).

[0031] Real-time fluorescence PCR: Based on PCR amplification, the genotype of the target locus is determined by the difference in fluorescence signals collected in real time during the amplification process, including TaqMan probe method and high-resolution melting curve analysis (HRM).

[0032] Gene chip method: Based on the principle of complementary base pairing, allele-specific probes of a large number of loci are fixed on a solid-phase carrier, and multi-site parallel typing is achieved by the difference in hybridization signals between the test sample and the probe.

[0033] SnaPshot method: A medium-throughput SNP genotyping technique based on the principle of single-base extension. It uses a primer adjacent to the SNP site and adds four different fluorescently labeled "stop" nucleotides (ddNTPs) to the reaction, causing the primer to extend by only one base. Then, these extension products that are only one base short are separated by capillary electrophoresis, and the SNP type is read based on the fluorescence color and fragment length.

[0034] Mass spectrometry: including MassARRAY technology based on MALDI-TOF, which accurately determines genotype by detecting the molecular weight difference of amplified products at the target site.

[0035] IgM antibody level: refers to the concentration or titer of specific immunoglobulin M against Streptococcus agalactiae in tilapia serum. IgM is a core effector molecule in the humoral immune response of fish, and its level is significantly correlated with the strength of the humoral immune response of tilapia to this pathogen. It is a core phenotypic indicator for assessing and quantifying the streptococcal resistance trait in tilapia.

[0036] Identification: refers to the determination, verification and grading of the level of anti-streptolysinic IgM antibody in tilapia individuals or groups based on the genotype of SNP markers.

[0037] Prediction refers to the prospective assessment of the potential level of anti-Streptococcus agalactiae IgM antibody phenotype in tilapia individuals or populations based on SNP marker genotypes before pathogen infection or vaccine immunization. This allows for early, non-destructive screening and significantly improves breeding efficiency.

[0038] Assisted screening: In the early stages of breeding (such as the seedling or juvenile stage), non-destructive screening of the population is carried out based on SNP genotypes to identify and retain individuals with high disease resistance potential in advance, while eliminating individuals with low disease resistance potential, thereby significantly improving selection pressure and selection accuracy.

[0039] Assisted breeding: In the subsequent mating, family establishment and strain purification process, SNP genotype information is used to guide the selection of parents, ensuring the aggregation and stable inheritance of disease resistance genes, thereby accelerating the fixation of disease resistance traits and shortening the breeding cycle.

[0040] The beneficial effects of the present invention include at least the following:

[0041] This invention utilizes RNA-Seq and BSA-seq technologies to systematically screen for QTLs, functional genes, and key signaling pathways significantly associated with IgM antibody levels against Streptococcus agalactiae in tilapia. Furthermore, it identifies two SNP marker sites closely related to IgM antibody levels. This invention elucidates the molecular basis of disease-resistant immune responses from a multi-omics perspective and obtains molecular markers with significant application value, providing direct and efficient targets and tools for marker-assisted breeding of tilapia against Streptococcus agalactiae. Attached Figure Description

[0042] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0043] Figure 1 The figure shows the statistical results of the distribution of differentially expressed genes. The horizontal axis represents different sets of differentially expressed genes, and the vertical axis represents the number of genes. The blue, orange, and green bars represent all differentially expressed genes, upregulated differentially expressed genes, and downregulated differentially expressed genes, respectively. "DC, DH, DL" represent the control group, the high antibody level group, and the low antibody level group, respectively.

[0044] Figure 2 The results of Venn diagram analysis for differentially expressed genes in three comparison combinations are shown. Combination A (DC vs DL) shows differentially expressed genes between the low antibody level group and the control group; combination B (DC vs DH) shows differentially expressed genes between the high antibody level group and the control group; and combination C (DH vs DL) shows differentially expressed genes between the high and low antibody level groups. The numbers on each region in the figure represent the number of genes in the corresponding category, and overlapping regions indicate the number of differentially expressed genes shared by related combinations within that region.

[0045] Figure 3The results show the enrichment of differentially expressed genes via the KEGG signaling pathway. Different colors in the figure represent six categories of biological metabolic pathways: cellular processes, environmental information processing, genetic information processing, human diseases, metabolism, and organismal systems.

[0046] Figure 4 The figure shows the results of logistic regression analysis on the association between SNP molecular markers and IgM antibody levels. The molecular markers in the figure were analyzed using both allelic and dominant models. The P-value in the figure represents the significance level of the association between allele / genotype and IgM antibody levels (P < 0.05 is marked as *, P < 0.01 is marked as **). The OR (95% CI) represents the association strength between a specific allele or genotype and IgM antibody levels and its 95% confidence interval. The red dots in the figure represent the estimated OR (Odds Ratio), and the horizontal lines represent the 95% confidence interval range of the OR, from the lower limit to the upper limit. The vertical dashed line (OR=1) is the null line, and the confidence interval falling entirely to the left of the dashed line (OR<1) indicates that it has a statistically protective effect. Detailed Implementation

[0047] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall be followed. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0048] Table 1 Sequence Information Table

[0049]

[0050] In this application, the physical coordinates of SNP sites and the alignment of RNA-Seq and BSA-Seq reads are based on the Nile tilapia reference genome version O_niloticus_UMD_NMBU (RefSeq Assembly accession: GCF_001858045.2). Detailed information about this genome version can be found in the NCBI Datasets database (https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_001858045.2 / ).

[0051] Example 1: Screening for SNP molecular markers associated with the level of immune response against Streptococcus agalactiae IgM in tilapia

[0052] 1. Laboratory animals

[0053] The experimental fish were obtained from three Nile tilapia populations: the Huadu population (D), the Panyu population (Y), and the Hainan population (N). The Huadu population was purchased from Guangzhou Yongsheng Aquatic Products Co., Ltd., Guangdong Province; the Panyu population was purchased from Guangdong Tilapia Breeding Farm, Guangzhou City, Guangdong Province; and the Hainan population was purchased from Hainan Changsheng Fish and Turtle Seedling Farm, Haikou City, Hainan Province. The fish measured 11.16 cm ± 1.08 cm in length and 28.11 g ± 4.24 g in weight. The experimental fish were housed in 185 cm × 90 cm × 150 cm pond cages. Before the experiment, random sampling confirmed that the fish were free of common pathogens, and each fish was tagged with a PIT electronic tag.

[0054] 2. Preparation of Streptococcus agalactiae immersion vaccine

[0055] Following the method reported by Ke et al. (2021) (Ke X, et al. The immune efficacy of aStreptococcus agalactiae immersion vaccine for different sizes of youngtilapia. Aquaculture, 2021, 534: 736289), the following steps were taken to prepare the Streptococcus agalactiae immersion vaccine: Streptococcus agalactiae was inoculated into BHI liquid medium and cultured at 30 °C for 12 h. Then, 100 mL of the bacterial culture was transferred to 10 mL of LBHI liquid medium and cultured at 30 °C with shaking at 200 rpm for 24 h. The bacterial culture was aliquoted into 500 mL centrifuge bottles, centrifuged at 4 °C and 10,000 rpm for 10 min, and the bacterial pellet was collected. The pellet was resuspended in 500 mL PBS, and formaldehyde was added to a final concentration of 0.4%. The pellet was then inactivated at 4 °C for 24 h. After inactivation, the bacterial cells were washed three times with PBS to remove residual formaldehyde. The inactivated bacterial culture was then plated onto blood agar plates and cultured at 30 °C for 24 h to confirm complete inactivation. The bacterial suspension concentration was determined using a turbidimeter, and the suspension was homogenized three times under 1500 Pa pressure using a high-pressure homogenizer to obtain the Streptococcus agalactiae vaccine antigen. The soaking adjuvant was an aqueous solution containing 2‰ (M / V) peptidoglycan, 4‰ (V / V) palm oil, 1‰ (M / V) carbomer, 4‰ (V / V) glycerol, and 1‰ (V / V) diethanolamine. The Streptococcus agalactiae vaccine antigen was added to the soaking adjuvant to prepare the Streptococcus agalactiae soaking vaccine, with a final antigen concentration of 1 × 10⁻⁶. 9 CFU / mL.

[0056] 3. Immersion Immunization Procedure

[0057] Three Nile tilapia fry populations were immunized with agalactiae Streptococcus vaccine using a immersion immunization method. Before immunization, the fry were immersed in a skin treatment solution (a aqueous solution of formaldehyde 1.5‰ (V / V), benzalkonium chloride 0.0015‰ (M / V), glycolic acid 0.05‰ (M / V), and glycerol 15‰ (V / V)) for 5 minutes to remove surface mucus, followed by rinsing three times in clean water for 10 minutes each time. Then, they were immersed in the prepared agalactiae Streptococcus vaccine for 1 hour. The control group was treated with a immersion solution without agalactiae Streptococcus vaccine antigen, with the remaining treatments the same as the vaccine-immunized group. Dissolved oxygen was maintained above 5 mg / L throughout the immunization process, and the temperature was 26 ℃ ± 2 ℃. A booster immunization was administered two weeks after the initial immunization according to the same immunization schedule. After immunization, the fry were fed commercial tilapia feed at 3% of their body weight daily, with the water temperature maintained at 28 ℃ ± 2 ℃ and dissolved oxygen maintained above 5 mg / L.

[0058] 4. Serum collection and specific IgM antibody detection

[0059] The applicant's preliminary experiments revealed that after immunizing tilapia with Streptococcus agalactiae vaccine, the serum IgM antibody level against Streptococcus agalactiae showed a pattern of first rising and then falling, reaching its peak in the third week after the first immunization. Therefore, serum was collected from each fish in the third week after the first immunization (when the antibody level reached its peak) for the detection of IgM antibody levels against Streptococcus agalactiae.

[0060] Serum-specific IgM antibody levels were determined using an indirect ELISA method. The specific steps were as follows: Inactivated Streptococcus agalactiae were first diluted to 1×10⁻⁶ with coating buffer bicarbonate buffer (pH 9.6). 8 Add 100 μL of CFU / mL solution to each well of a 96-well microplate, including a blank control, and coat overnight at 4°C. Discard the coating solution, add 200 μL of PBST to each well and wash three times on a shaker for 5 min each time. Then add 200 μL of 5% skim milk powder to each well and block at 37°C for 2 h. After washing three times with PBST, add 100 μL of 1:250 diluted serum and incubate at 37°C for 1 h. After washing with PBST, add 100 μL of 1:5000 diluted mouse anti-tilapia IgM monoclonal antibody (Aquatic) and incubate at 37°C in the dark for 1 h. After washing with PBST, add 100 μL of 1:10000 diluted goat anti-mouse IgG-HRP conjugate antibody (Sigma-Aldrich) and incubate at 37°C in the dark for 1 h. Wash three times with PBST. Add 100 μL of TMB substrate solution and develop the color at 37°C in the dark for 30 minutes. After 1 minute, add 50 μL of stop solution (2M H2SO4); measure the absorbance at 450 nm using an ELISA reader, and plot a standard curve based on serial dilutions of known concentrations of tilapia IgM standard, converting the OD values ​​into the corresponding specific IgM antibody content (μg / mL).

[0061] 5. Transcriptome analysis

[0062] One hundred tilapia were randomly selected from the *Streptococcus agalactiae* vaccine-immunized population (D) in Huadu. Serum samples were collected three weeks after the first immunization (at the peak of serum IgM antibodies), and head and kidney tissues were simultaneously dissected and cryopreserved in liquid nitrogen. Based on the anti-*Streptococcus agalactiae* IgM antibody levels in the serum of each tilapia, RNA was extracted from the head and kidney tissues of five individuals (DH-1~DH-5, IgM content 188.24 ± 27.87 μg / mL) with extremely high antibody levels and five individuals (DL-1~DL-5, IgM content 34.51 ± 13.98 μg / mL) with extremely low antibody levels. Simultaneously, head and kidney tissues were randomly selected from five tilapia from the control group for RNA extraction for transcriptome sequencing analysis.

[0063] (1) Quality assessment and analysis of transcriptome data

[0064] Transcriptome sequencing was performed on 14 head kidney samples from tilapia (control group: DC-1~DC-5; high antibody level group: DH-1~DH-5; low antibody level group: DL-1~DL-4; library construction of DL-5 sample was unsuccessful). A total of 91.25 Gb of high-quality sequence data was obtained from all samples, with each sample achieving 5.71 Gb of clean data. Statistical analysis of the alignment results showed that the alignment efficiency between the reads and the reference genome for each sample ranged from 88.83% to 93.52%. The Q30 base percentage was 97.29% or higher (Table 2). These data indicate that the sequencing results were of good quality and can be used for subsequent analysis.

[0065] Table 2. Transcriptome sequence data statistics

[0066]

[0067] (2) Differentially expressed genes

[0068] Differentially expressed genes were screened using DESeq2 software based on the gene count values ​​in each sample. The screening criteria for significantly differentially expressed genes were a Fold Change value greater than or equal to 2 and an FDR value less than 0.01. Genes (DEGs) showing significant differences were analyzed between DL (low antibody level group) vs. DH (high antibody level group), DC (control group) vs. DH (high antibody level group), and DC (control group) vs. DL (high antibody level group).

[0069] The results are as follows Figure 1 As shown: In the DC vs DH group, there were 816 differentially expressed genes (DEGs), of which 331 genes were upregulated and 485 genes were downregulated; in the DC vs DL group, there were 1418 differentially expressed DEGs, of which 435 genes were upregulated and 983 genes were downregulated; in the DL vs DH group, there were 342 differentially expressed DEGs, of which 69 genes were upregulated and 273 genes were downregulated.

[0070] The differentially expressed genes of the three comparison combinations A, B, and C (defined in the attached diagram) were analyzed using Venn diagrams. The intersection of A and B with C was taken simultaneously, as shown below. Figure 2 As shown, 151 common genes were obtained (shaded area in the figure). This set represents genes that responded to the vaccine within the group and showed significant differences in expression between groups, including 43 upregulated genes and 108 downregulated genes.

[0071] (3) Differentially expressed genes related to antibody immune response levels

[0072] Based on the KEGG signal pathway analysis results, such as Figure 3 As shown, 27 important immune-related genes that were significantly differentially expressed in individuals with high and low antibody levels were further screened from immune-related signaling pathways, including the C-type lectin receptor signaling pathway, the intestinal immune network for IgA production, the cell adhesion molecule pathway, the primary immunodeficiency pathway, the phagosome pathway, apoptosis, focal adhesion pathway, cytokine-cytokine receptor interaction pathway, the MAPK signaling pathway, the mTOR signaling pathway, and the Notch signaling pathway. Gene interaction network diagrams were constructed based on the differentially expressed immune-related genes. The results showed that tilapia with high antibody levels mainly synthesize large amounts of IgM by activating the MHC antigen presentation signaling pathway, the TCR / BCR signaling pathway, and the integrin cell adhesion pathway, while inhibiting the apoptosis signaling pathway.

[0073] 6. BSA-seq analysis

[0074] Based on the detection value of anti-Streptococcus agalactiae IgM antibody in tilapia serum at week 3 after the first immunization (when the antibody peak is reached), 30 individuals with extremely high IgM antibody levels and 30 individuals with extremely low IgM antibody levels were selected from the Huadu (D), Hainan (N), and Panyu (Y) tilapia populations after immersion immunization with Streptococcus agalactiae vaccine. The corresponding individuals were located according to the PIT marker, and tail fin tissue was collected. After extracting total DNA, the groups were mixed in equal amounts to form the extremely high IgM antibody level group and the extremely low IgM antibody level group. After library construction in the mixed pool as shown in Table 3, the genome was resequencing and BSA analysis were performed.

[0075] Table 3. Statistical analysis of antibody phenotype determination in mixed-sample pools

[0076]

[0077] (1) Quality assessment of BSA sequencing libraries

[0078] Genomic DNA was collected from individuals with high and low IgM antibody levels in the population, respectively. These samples were then mixed in equal volumes to construct high-IgM antibody pools (DH, NH, YH) and low-IgM antibody pools (DL, NL, YL). The raw image data files obtained from high-throughput sequencing were converted into raw sequencing sequences through base calling analysis. The raw data was then filtered for quality control to obtain cleanreads.

[0079] Statistical results show that: in the Huadu population, a total of 206,545,690 clean reads were obtained from the high IgM antibody pool (DH), with a Q30 percentage of 97.73%; and 222,347,694 clean reads were obtained from the low IgM antibody pool (DL), with a Q30 percentage of 98.13%. In the Hainan population, 212,353,164 clean reads were obtained from high IgM antibody (NH), with a Q30 percentage of 98.15%; and 206,378,074 clean reads were obtained from low IgM antibody (NL), with a Q30 percentage of 96.92%. In the Panyu population, 224,395,220 clean reads were obtained from high IgM antibody (YH), ​​with a Q30 percentage of 96.81%; and 221,976,232 clean reads were obtained from low IgM antibody (YL), with a Q30 percentage of 97.42%.

[0080] The genome coverage of each pool is as follows: The total reads of the DH, DL and other 6 pool samples all exceeded 200 million, with the average coverage depth concentrated in the range of 30~32×. The coverage of 1×, 5× and 10× was no less than 97.46%, 94.68% and 91.43% respectively. All indicators met the sequencing quality control standards for analysis. The coverage of the reference genome in each pool was high and uniform, and the sequencing coverage effect was good, which can meet the needs of subsequent analysis.

[0081] (2) SNP detection and annotation

[0082] This application conducted genome-wide variant detection on three groups of samples, obtaining a total of 11,394,463 single nucleotide polymorphisms (SNPs). Further functional annotation was used to classify these variant sites, revealing that most variants were distributed in intergenic regions, intronic regions, and upstream and downstream regulatory regions of genes. Variants detected in gene coding regions included synonymous mutations, non-synonymous mutations, splicing site variations, and sequence variations located in the 5'UTR and 3'UTR regions.

[0083] According to the Clean Reads mapping results of the tilapia reference genome, SNP polymorphic markers were detected in the mixed pools of the D, N, and Y populations. After screening, 4,845,731 SNPs were obtained in the D population, 4,851,896 SNPs in the N population, and 4,696,836 SNPs in the Y population.

[0084] (3) QTL positioning area

[0085] Before conducting association analysis, the original SNP data underwent rigorous quality control screening, with specific criteria including: (1) removing multi-allelic loci and retaining only diallelic SNPs; (2) removing loci with sequencing depth (read support) less than 4 in both pools; (3) excluding SNPs with homozygous and identical genotypes in both pools; and (4) removing loci in the recessive pool whose genotypes are inconsistent with the recessive parent, as well as loci in which both parents are homozygous but inconsistent with each other. After the above screening steps, a total of 12,716,791 high-quality reliable SNP loci were obtained from the three populations.

[0086] The SNP was analyzed using the Euclidean distance (ED) association algorithm, with the median + 3SD of the fitted values ​​for all loci used as the association threshold, which was calculated to be 0.05. Based on the association threshold, 11, 20, and 13 QTLs related to the level of anti-Streptococcus agalactiae IgM antibody were located from the three tilapia populations (D, N, and Y populations), respectively, with total lengths of 33.75 Mb, 27.85 Mb, and 27.8 Mb, respectively. The intersection of the QTL locations from the three populations yielded 5 common QTL regions with a total length of 12.05 MB, as shown in Table 4.

[0087] Table 4. Statistics on SNP Intersection Association Regions

[0088]

[0089] (4) Screening of candidate genes

[0090] A total of 106 labeled genes were identified using BSA-seq, of which 57 were immune-related genes.

[0091] 7. Conjoint Analysis

[0092] Comparative analysis of 106 annotated genes from the BSA-seq mapping region and 151 differentially expressed genes from the RNA-seq transcriptome revealed three overlapping genes: mannose receptor C2 (Mrc2), programmed death-ligand 1 (PD-L1), and major histocompatibility complex class II α chain (MHC II α). These are considered important candidate functional genes related to IgM antibody immune response levels. From these three functional genes and other important immune-related genes annotated with QTL mapping regions, two SNP sites significantly associated with anti-streptolysinic IgM antibody levels were screened (Table 5).

[0093] Table 5 SNP sites significantly associated with IgM antibody levels

[0094]

[0095] Refer to the Nile tilapia O_niloticus_UMD_NMBU genome version.

[0096] 5. Genotype distribution and chi-square test of SNP loci

[0097] A two-tailed extreme phenotypic grouping design was used. Ninety individuals with high IgM and ninety individuals with low IgM were selected from the Huadu (D) population immunized with Streptococcus agalactiae vaccine, forming a high-IgM population and a low-IgM population, respectively. DNA was extracted from the tail fins of each tilapia.

[0098] Genotyping of the above SNP loci was performed using the Sequenom MassARRAY method. The specific procedure is as follows:

[0099] (1) DNA sample quality control: All DNA samples to be tested were assessed for concentration and integrity using agarose gel electrophoresis to confirm that the sample quality met the requirements for subsequent experiments (concentration ≥10 ng / μL, no obvious degradation).

[0100] (2) Primer design and synthesis: Based on the flanking sequences of the target SNP site, polymerase chain reaction primers for target amplification and extension primers for single-base extension were designed and synthesized using Sequenom's AssayDesign 3.1 software, as follows:

[0101] SNP1 primers:

[0102] F1: CCATGTTGTTTGCTTTTGC (as shown in SEQ ID NO: 1);

[0103] R1: ATTGGACTGTTAACTGCGG (as shown in SEQ ID NO: 2);

[0104] Amplified nucleic acid sequence:

[0105] CCATGTTGTTGCTTTTGCTAGTATTTGTGCTCATCTTGTTCTCCAGCTTAATTCAGGGACCATGAC[T / C]ACAACCTGCCGCAGTTAACAGTCCAAT (as shown in SEQ ID NO: 5 / 6);

[0106] SNP2 primers:

[0107] F2: AACACTCATCTTCAGCTCC (as shown in SEQ ID NO: 3);

[0108] R2: GAGAGTGTTTCTGGCATC (as shown in SEQ ID NO: 4);

[0109] Amplified nucleic acid sequence:

[0110] AACACTCATCTTCAGCTCCATAAAGAAGTGCTTCACTGGGTTCA[G / A]TCCAACAGATGAGATTTATGCTGTTATTAAAAGCACCAAGTGAGTTTATTAGATGCCAGAAACACTGCTC (as shown in SEQ ID NO: 7 / 8);

[0111] (3) Multiplex PCR amplification: Multiplex PCR was performed in 384-well plates to amplify DNA fragments containing the target SNP sites. The reaction system contained HotStar Taq DNA polymerase, dNTPs, MgCl2, and a mixture of multiplex PCR primers. The cycling parameters were: 94°C for 2 min pre-denaturation; followed by 45 cycles of amplification (94°C for 20 s, 56°C for 30 s, 72°C for 1 min); and a final extension at 72°C for 3 min.

[0112] (4) Residual nucleotide digestion: The PCR products were treated with shrimp alkaline phosphatase to remove residual dNTPs in the system and prevent them from interfering with the subsequent single-base extension reaction. The reaction conditions were: incubation at 37 °C for 40 min, followed by heating at 85 °C for 5 min to inactivate the enzyme.

[0113] (5) Single base extension reaction: The reaction was performed using the iPLEX® reaction system. Extension primers, a specific termination mixture, and DNA polymerase were added to the SAP-treated product. The reaction program was as follows: initial denaturation at 94 °C for 30 s; followed by 40 cycles of extension reaction (94 °C for 5 s, 52 °C for 5 s, 80 °C for 5 s, for a total of 5 cycles, repeated 40 times); and finally, holding at 72 °C for 3 min.

[0114] (6) Mass spectrometry detection and genotyping: After resin desalting and purification, the extension reaction products were spotted onto a SpectroCHIP® chip. Mass spectrometry data were acquired using a MassARRAY® Typer 4.0 system. By analyzing the molecular weight mass-to-charge ratio peaks of the extension products, the genotype of each sample at each SNP locus was automatically determined using the accompanying Type 4.0 software.

[0115] (7) Data quality control: Strict quality control is performed on the genotyping results. Only loci with acceptable call rates are retained for analysis (samples that fail to genotype are removed during analysis).

[0116] Chi-square test analysis was performed to analyze the differences in the distribution frequencies of genotypes and alleles of SNP loci in the high IgM and low IgM populations. The results are shown in Table 6: The genotype distribution frequencies and allele distribution frequencies of SNP1 and SNP2 located on the MHC II gene were significantly different between the high IgM antibody level population and the low IgM antibody level population (p < 0.05).

[0117] Table 6. Statistical table of SNP locus genotype distribution and chi-square test results.

[0118]

[0119] In the low antibody level population, the genotype frequencies of SNP1 were CC: 23.8%, CT: 17.5%, and TT: 58.7%. In the high antibody level population, the TT genotype frequency significantly increased to 78.8%, while the CC genotype frequency decreased to 8.8%. The frequency of the T allele in the high antibody level population (84.8%) was significantly higher than that in the low antibody level population (68.0%).

[0120] The genotype frequencies of SNP2 loci in the low antibody level population were AA: 41.7%, AG: 23.8%, and GG: 34.5%. In the high antibody level population, the frequency of the GG genotype (53.8%) was significantly higher than that in the low antibody level population, while the frequency of the AA genotype (25.6%) was relatively lower. The frequency of the G allele in the high antibody level population (64.1%) was higher than that in the low antibody level population (46.4%).

[0121] Example 2: Validation of SNP sites and evaluation of their application potential in breeding populations with high IgM antibody levels in tilapia.

[0122] This application employs univariate binary logistic regression analysis to examine the association between SNP1, SNP2, and IgM antibody levels using both allelic and dominant models. High and low antibody levels were assigned values ​​of 0 and 1, respectively, with the corresponding alleles or genotypes as independent variables.

[0123] The analysis results show (Table 7 and Figure 4Both SNP1 and SNP2 were significantly associated with IgM antibody levels (P<0.05). At the allele level, the T allele of SNP1 was associated with high antibody levels, while the C allele was associated with low antibody levels; the G allele of SNP2 was associated with high antibody levels, while the A allele was associated with low antibody levels. Individuals carrying the CT or TT genotype at SNP1 had a significantly lower risk of low antibody levels than those carrying the CC genotype (OR=0.307, 95% CI: 0.117–0.808, P<0.05). Similarly, at the SNP2 locus, individuals carrying the AG or GG genotype had a significantly lower risk of low antibody levels compared to those carrying the AA genotype (OR=0.483, 95% CI: 0.247–0.942, P<0.05).

[0124] Table 7 Logistic regression analysis of SNP sites and IgM antibody levels

[0125]

[0126] In summary, the SNP1 and SNP2 provided by this invention are molecular markers significantly associated with IgM antibody levels against Streptococcus agalactiae in tilapia. Both are located in important MHC II regions, and their dominant alleles and corresponding genotypes can serve as genetic markers: when breeding tilapia populations with high IgM antibody levels, individuals carrying the T allele (CT or TT genotype) at SNP1 are preferentially selected; and individuals carrying the G allele (AG or GG genotype) at SNP2 are preferentially selected. Therefore, the molecular markers provided by this invention have significant application potential in assisting the screening and breeding of tilapia varieties / strains with high IgM antibody levels against Streptococcus agalactiae.

[0127] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A SNP marker associated with tilapia anti-Streptococcus agalactiae IgM antibody levels, characterized in that, The SNPs are labeled as SNP1 and / or SNP2, and the SNP labeling site information is as follows: ; Refer to the Nile tilapia O_niloticus_UMD_NMBU genome version.

2. The product for detecting the SNP mark as described in claim 1, characterized in that, The product components include primer sets with nucleotide sequences as shown in SEQ ID NO: 1-2, and primer sets with nucleotide sequences as shown in SEQ ID NO: 3-4.

3. The application of the SNP marker as described in claim 1 to the product, characterized in that, For use in any of the following applications: (A1) To identify or predict the level of anti-streptolysin Agalactiae IgM antibodies in tilapia for non-diagnostic purposes; (A2) Assist in the screening and cultivation of tilapia varieties / strains resistant to Streptococcus agalactiae.

4. The application as described in claim 3, characterized in that, The product comprises PCR markers and / or gene chips developed using SNP1 and SNP2 sequence information, wherein the PCR markers are PCR-RFLP markers, TaqMan markers, KASP markers, AS-PCR markers, or HRM markers.

5. The application as described in claim 3, characterized in that, The product is used for genotyping of SNP1 and / or SNP2 loci.

6. The application as described in claim 5, characterized in that, Genotyping was performed using sequencing, real-time fluorescence PCR, SnaPshot, gene chip, or mass spectrometry.

7. A method for SNP marker-assisted breeding related to the level of anti-streptococcal IgM antibody in tilapia, characterized in that, Includes the following steps: Genotyping was performed on the SNP1 and / or SNP2 loci of the selected individuals. The SNP marker locus information is shown below: ; Refer to the Nile tilapia O_niloticus_UMD_NMBU genome version; Select individuals whose genotyping results meet either of the following (B1) and (B2): (B1) The genotype of SNP1 locus is CT or TT; (B2) The genotype of the SNP2 locus is AG or GG.

8. The method as described in claim 7, characterized in that, PCR markers and / or gene chips are developed using SNP1 and SNP2 sequence information, wherein the PCR markers are PCR-RFLP markers, TaqMan markers, KASP markers, AS-PCR markers, or HRM markers.

9. The method as described in claim 7, characterized in that, Genotyping was performed using sequencing, real-time fluorescence PCR, SnaPshot, gene chip, or mass spectrometry.